بایگانی برچسب‌ها: نوشتار-فرهنگ-واژه‌ها

تناقض چیست؟

تعریف تناقض

تناقض موضوعی مرتبط با منطق است و یکی از روابطی است که میتواند بین دو گزاره (قضیه، گزاره چیست؟) وجود داشته باشد.

شرط لازم برای برقراری رابطه تناقض بین دو گزاره در منطق ارسطویی این است که

  1. بین آن دو گزاره از لحاظ کیفیت و کمیت و جهت یگانگی وجود نداشته باشد
  2. بین آن دو گزاره در هشت چیز یگانگی وجود داشته باشد

روشنگری در مورد شرط 1

منظور از یگانگی نداشتن در کیفیت این است که یکی ایجابی و دیگری سلبی باشد.

منظور از یگانگی نداشتن در کمیت این است که یکی جزئی و دیگری کلی باشد.

منظور از یگانگی نداشتن در جهت این است که هر یک، یکی از جهات جداگانه را داشته باشند.

روشنگری در مورد شرط 2

هشت چیزی که در شرط دوم به آنها اشاره شد از این قرارند:

1- یگانگی در موضوع

اگر گفته شود «صندلی چوبی است و میز چوبی نیست»، میان این دو گزاره تناقض نیست زیرا در موضوع یگانگی ندارند.

2- یگانگی در محمول

اگر گفته شود «صندلی چوبی است، صندلی میز نیست» میان این دو گزاره تناقض نیست زیرا در محمول یگانگی ندارند.

3- یگانگی در مکان

اگر گفته شود «صندلی که در آشپزخانه است آهنی است، صندلی که در اتاق کار است آهنی نیست» این دو گزاره با یکدیگر تناقض ندارند زیرا در مورد مکان با یکدیگر یگانگی ندارند.

4- یگانگی در زمان

اگر گفته شود «صندلی امروز شکسته است، صندلی دیروز شکسته نبود» میان این دو گزاره تناقض وجود ندارد زیرا این دو گزاره در مورد زمان یگانگی ندارند.

5- یگانگی در شرط

اگر گفته شود «اگر صندلی از آهن ساخته شود محکم خواهد بود، اگر صندلی از چوب ساخته شود شکننده خواهد بود»، میان این دو گزاره تناقض وجود ندارد چون در شرط با یکدیگر یگانگی ندارند.

6- یگانگی در اضافه

اگر گفته شود «جنس صندلی من چوبی است، جنس صندلی شما چوبی نیست» میان این دو تناقض وجود ندارد زیرا در اضافه با یکدیگر یگانگی ندارند.

7- یگانگی در جزء و کل

اگر گفته شود «وزن تمام صندلی ها بیش از 1000 کیلوگرم است، وزن یک صندلی کمتر از 10 کیلوگرم است» بین این دو گزاره تناقض وجود ندارد زیرا این دو گزاره با یکدیگر در جزئ و کل بودن یگانگی ندارند.

8- یگانگی در قوه و فعل

اگر گفته شود «تمام صندلی ها میتوانند از چوب ساخته شوند، برخی از صندلی ها از چوب ساخته نشده اند» میان این دو گزاره تناقض وجود ندارد زیرا این دو گزاره در مورد قوه و فعل با یکدیگر یگانگی ندارند.

اصل/قانون تناقض

قضایایی که با یکدیگر در تناقض هستند نه قابل اجتماع هستند نه قابل ارتفاع. یعنی اگر در میان دو گزاره که با یکدیگر تناقض دارند یکی از قضایا درست باشد، گزاره دیگر قطعاً نادرست است. و همینطور اگر یکی از دو گزاره صحت نداشته باشد، گزاره دیگر یقیناً صحت دارد.

چیزهایی که در تعریفشان تناقض وجود دارد یقیناً نمیتوانند وجود داشته باشند (استعداد وجود ندارند)، مثلاً یک دایره چهارگوش و یا یک مربع به شعاع 2 سانتیمتر و یا یک اسب سفید نامرئی نمیتوانند وجود داشته باشند، یعنی ممتنع الوجود هستند.

از اصل تناقض در بسیاری از استدلالهای منطقی و ریاضی برای اثبات نظریات و گزاره های مختلف استفاده میشود. برخی از افراد گاهی در اینکه تناقض سبب بطلان یک قضیه میشود شک میکنند، و سعی میکنند اصل تناقض را اینگونه زیر سوال ببرند، اما این زیر سوال بردن آنها خود بی معنی است چرا که دو گزاره زیر خود با یکدیگر در تناقض هستند

الف – اصل تناقض درست است

ب- اصل تناقض نادرست است

و اگر کسی که این شبهه را مطرح میکند درست بگویند نباید به درست بودن اصل تناقض شک کنند زیرا از نظر آنها میان الف و ب اختلافی وجود ندارد. آیا این افراد میپذیرند که هم الف و هم ب درست است؟ اگر آنرا نپذیرند پذیرفته اند که اصل تناقض درست است.

همجنسگرایی چیست؟

پیشگفتار

مسئله همجنسگرایی از طرف مسئولان نظام (حتی از تریبون های رسمی) بعنوان یک بهانه برای حمله به تمدن و دموکراسی و آزادی و غرب مورد استفاده قرار میگیرد. با یک برادر بسیجی صحبت میکردم، و از او خواستم که بگوید چرا با دموکراسی و انتخابات آزاد که همه بتوانند در آن شرکت کنند مخالف است. پاسخ داد، من نمیتوانم ببینم یک مجلس لیبرال بیاید در این مملکت تصمیم بگیرد که مرد میتواند با مرد ازدواج کند و من تنها نیستم، اکثریت مردم ایران مثل من فکر میکنند و طرفدار اخلاقیات اسلامی هستند.

به او گفتم، اگر ادعای دوم تو درست باشد که اکثریت مردم ایران مثل تو فکر میکنند که تو اتفاقا باید طرفدار دموکراسی باشی چون اکثریت مثل تو فکر میکنند و در مجلس نیز اکثر نمایندگان با این مسئله مخالفت خواهند کرد و رای علیه این مسئله خواهند داد پس نگرانی تو بیهوده است اما تو خود خوب میدانی که اکثریت مثل تو فکر نمیکنند و چون میدانی که در اقلیت هستی سعی میکنی نظر خود را بر اکثریت دگراندیش تحمیل کنی چون فکر میکنی طرز فکر تو از طرف خدا آمده است.

جایی دیگر با برادر دیگری که بسیار عصبانی بود از دست آزادیخواهان صحبت میکرم، به وی گفتم ما برای ایجاد شرایط بهتر برای زندگی بشر و سعادت بشر تلاش میکنیم چرا از آزادیخواهان اینقدر کینه داری؟ گفت کدام سعادت؟! شما به اون همجنسبازی که در غرب است میگویید سعادت؟! کدام آزادی؟ آزادی همجنسبازی؟ دو تا مرد با هم راه میروند معلوم نیست کدام فاعل است کدام مفعول؟ شما میخواهید جوانان ما مشروب بخورند و همجنسگرا شوند؟

هدف من از بازگویی این دو خاطره یادآوری این واقعیت است که مسئله همجنسگرایی برای مذهبیون به دلیل شناخت غلط آنها از انسان که ریشه در بدآموزیهای پیشوایان دینیشان دارند مسئله ای حل نشده و حل نشدنی است. این نوشتار تلاش میکند با معرفی درکی بهتر از پدیده همجنسگرایی به مقایسه آن با بینش اسلام نسبت به آن است. پس از مرور مجازات همجنسگرایان در شریعت اسلام پرداخته و در پایان به اهمیت دفاع از حقوق همجنسگرایان و دیگر اقلیتهای دینی میپردازد.

تمایلات جنسی در انسانها را میتوان در چهار شاخه کلی دسته بندی کرد. به این دسته بندی Sexual orientation میگویند.

  • علاقه مند به جنس مخالف (هترو سکسوال Heterosexual)
  • علاقه مند به جنس موافق (همجنسگرا، هموسکسوال Homosexual)
  • علاقه مند به دو جنس موافق و مخالف (بیسکسوال Bisexual)
  • عدم علاقه به برقراری تماس جنسی (اسکسوال Asexual)

اینکه یک شخص چگونه به یکی از این 4 شاخه اصلی تعلق میگیرد هنوز برای دانشمندان مسئله ای روشن نیست! هرچند که بسیاری از دانشمندان در مورد اینکه این تمایلات در دوران کودکی توسط عکس العمل های بیولوژیکی، روانشناسی و جامعه شناسی شکل میگیرد اتفاق نظر دارند اما  تئوریهای مختلفی از منابع مختلفی برای این تمایلات از جمله فاکتورهای ژنتیکی و ترشحات هورمونی و یا تجربیات در دوران کودکی امروزه برای توضیح این مسئله مطرح هستند.

درک یک تمایل جنسی متفاوت

در بسیاری از گفتگوها در مورد همجنسگرایی شنیده میشود که کسی میگوید من همجنسگرایی را درک نمیکنم. من در پاسخ به این سخن میگویم که من نیز همجنسگرایی را درک نمیکنم، چون من و شما همجنسگرا نیستیم نمیتوانیم کاملا احساسات و چگونگی تمایلات جنسی یک همجسنگرا را درک کنیم.

مگر یک مرد میتواند احساس زن از بدنیا آوردن نوزاد را درک کند؟‌ یا در  یک زن میتواند احساس ارضای جنسی یک مرد را درک کند؟‌ ما میتوانیم با یکدیگر در مورد چگونگی این احساس سخنانی رد و بدل کنیم اما آیا این سخنان همان واقعا همان احساس و تمام آنرا را منتقل نمیکنند واقعیت این است که در چنین موضوعاتی تا فرد آن تجربه را نداشته باشد نمیتواند آنرا بخوبی درک کند. نمونه دیگر از این نوع مسائل شنا کردن است، آیا میتوان در پای تخته و تنها با صحبت کردن به کسی که شنا کردن بلد نیست به او شناکردن آموخت؟‌ چنین شخصی در اولین تماس با آب متوجه خواهد شد که این تجربه با آنچه او فکر میکرده است بسیار متفاوت است. درک یک تمایل جنسی متفاوت از آنچه یک فرد دارد برای او کاری بسیار دشوار است. این کار به دلیل اکتسابی نبودن یعنی طبیعی بودنش با تجربه نیز حاصل نمیشود.

مثلا اگر شخصی بینایی نابینا شود میتواند ادعا کند که نابینایی را شناخته است، اما مثلا زنی دگرجنسگرایی که یک یا چند بار با زنان دیگری همبستر شده است نمیتواند ادعا کند که همجسنگرایی را درک کرده است. مگر اینکه این تجربه در او سبب تمایل بیشتر و تکرار آن شده باشد و او اکنون خود را همجنسگرا بداند. و الا کسی نمیتواند بگوید قبلا همجنسگرا بوده و اکنون تغییر یافته،‌ همانطور که یک دگرجنسگرا نمیتواند همجنسگرا شود یک همجنسگرا نیز نمیتواند دگرجنسگرا شود. باید همچنین توجه داشت در میان تمایلات جنسی اقسام بیشتری علاوه بر همجنسگرایی و دگرجنسگرایی وجود دارند همچون «دوجنسگرایی-Bisexual»، که نباید با «تراجنسی» (‌Transexual) که یک تمایل جنسی نیست اما یک اقلیت جنسی است اشتباه گرفته شود.

بطور کلی اگر یک انسان بتواند در طول زندگی اش تنها خودش را بخوبی بشناسد کار بزرگ و ارزشمندی انجام داده است چه برسد به درک دیگران از جنسی مخالف یا تمایل جنسی مخالف. اینجاست که انسان امروزی رفته رفته هرچه بیشتر میفهمد مدارا و نرمش بیشتری نسبت به مسائل مربوط به تمایلات جنسی نشان میدهد و کشورهای دنیا به سوی آزادی دادن بیشتر و به رسمیت شناختن بیشتر همجسنگرایان و حقوقشان هستند نه به دنبال محدود کردن و غیر قانونی کردن و یا پنهان کردن آن.

مثلا شخصی از مردی همجنسگرا به شوخی میپرسید آیا مثلا تو حاضر نیستی با فلان هنرپیشه زیبا همبستر شوی؟‌ و آن همجنسگرا میگفت نه واقعا نه و شخص مقابل باور نمیکرد.  جالب اینجاست که درک دگرجنسگرایی نیز برای همجنسگرایان بسیار دشوار و شاید ناممکن است. یعنی کسی که مرد است و تنها تمایل به مردان دارد نیز نمیتواند واقعا خود را بجای یک دگرجنسگرا قرار دهد. او نیز میتوانست همین پرسش را از دگرجنسگرا بکند که آیا تو اوقعا حاضر نیستی با زیباترین هنرپیشیه مرد همبستر شوی و این تنها حق به جانب بودن دگرجنسگرا است که به او اجازه میدهد چنین پرسشی را مطرح کند و الا هردو این پرسشها به یک اندازه نابخردانه اند.

نمونه ای از دشوار بودن شناخت دگرجنسگرایی برای همنجسگرایان که من تجربه کردم این بود که شخصی برای من پس از آشنایی با دیدگاه های من در همجنسگرایی بعنوان یک دگرجنسگرا پیامی فرستاد و گفت مرد حسابی یعنی میخواهی بگویی تو حاضر نیستی با اینها همبستر شوی؟‌ پس از بازکردن پیوند آن پیام با تصاویری از تماس جنسی همجنسگرایان دیدم که اگر آنها را نمیدیدم احتمالا روز خیلی بهتری میداشتم. پاسخ من برای آن شخص این بود که نه من چنین تمایلی ندارم ولی از پرسش شما میتوان استنباط کرد که شما دارید،‌ خوب دوست من شاید شما همجسنگرا هستید و یا اینکه دستکم تمایل جنسی به هر دو جنس دارید یعنی دوجنسگرا هستید و سخن من نیز است که این طبیعیست. بالاخره وقتی میگویم فلان درصد مردم همجنسگرا هستند معناییش این است که به احتمال همان درصد در میان هر جمعیتی همانقدر آدم همجنسگرا میتوان یافت. یا دیگیری میگفت من همجنسگرا نیستم چون حاضرم فقط فاعل باشم نه مفعول، در حالی که او بازهم یک همجنسگراست چون میل جنسی به همجنس دارد.

نتیجه این بخش آنکه درک تمایلات جنسی ناممکن و یا دستکم بسیار دشوار است و این موجب شکل گرفتن باورهای غلط بسیاری میشود و اینجاست که ما باید بدانیم نمیتوانیم زیاد در این مورد بدانیم و دستکم دلیل این بحث برانگیز بودن را بشناسیم.

همجسنگرایی چه نیست؟

برخی از روی نادانی و نداشتن تجربه زندگی در جامعه ای که همجنسگرایان در آن آزادند برداشتهای غلطی از همجنسگرایان و چگونگی آنان دارند.

از میان این برداشتهای غلط این است که همجنسگرایان در تمایلات جنسی زیاده خواهند. برای نمونه روزی در یک برنامه تلویزیونی که میهمانی همجسگرا داشت یکی از بینندگان در تماس تلفنی از وی پرسید آیا خود شما حاضر هستید با من بخوابید؟ همجنسگرا بودن یک آدم به این معنا نیست که آن آدم همواره به دنبال تماس جنسی با این و آن است و یا به دنبال افزودن بر شمار شرکای جنسی اش است. همجنسگرایان مانند دیگران در میزان تمایلات جنسیشان متفاوتند، عده ای تنها یک شریک جنسی دارند و با او ازدواج میکنند، عده ای شرکای جنسی بیشتر و عده ای بدون شریکند.

در میان دگرجنسگرایان نیز همین قضیه صادق است برای نمونه به زنانی که شرکای جنسی زیادی دارند میگویند فاحشه،‌ این عنوان به سادگی به زنی که پیش از ازدواج رابطه جنسی داشته باشد یا با بیش از یک مرد نیز رابطه جنسی داشته باشد تعلق میگیرد، اما در طرف مقابل زیاده روی جنسی برای مردها در اسلام نه تنها مشکلی ندارند بلکه سنت و شیوه زندگی محمد و امامان و اسلامگرایان و ملایان نیز هست. یک مرد میتواند چهار زن رسمی داشته باشد و بی نهایت زن صیغه ای و برده و اشکالی هم ندارند مردها در دید الله و محمد موجوداتی همواره به دنبال جفت گیری هستند و حتی صفتی شبیه «فاحشه»‌ برای توصیف چنین مردانی وجود ندارد. میل جنسی ممکن است شبیه غذا خوردن بین افراد متفاوت باشد، گاهی خوراک یک پرخر میتواند خوراک دو آدم سالم و ده آدم گرسنه باشد،‌ اسلام این قاعده را تنها برای مرد مسلمان دگرجنسگرا به رسمیت میشناسد.

همجنسگرا بودن یک شخص همچنین به معنی گویش نرم و یا به اصطلاح «اوا خواهری»‌ نیز نیست، در میان دگرجنسگرایان و ملایان نیز چنین گویش هایی دیده میشود، در میان همجنسگرایان نیز افرادی که جدی و یا خشک صحبت میکنند وجود دارد.

همجنسگرا بودن یک شخص تضمینی بر هیچ نوع رفتار خاصی نیست، به روشنی در میان شهدای انقلاب، حزب اللهی ها و ملایان کسانی وجود دارند که تمایلات همجنسگرایانه دارند به عبارت دیگر اینکه یک انسان چگونه انسانیست را نمیتوان از روی گرایش جنسی وی آموخت.

یک همجسنگرا مانند یک دگرجنسگرا میتواند باهوش، کم‌هوش، لوس،‌ خوش اخلاق، عصبی، با اعتماد به نفس یا بی اعتماد به نفس باشد. رفتار او مانند دیگران از تجربیات زندگی او، ویژگیهای وراثتی او و آنچه خود برای خود انتخاب کرده است میباشد. این است که پیش قضاوتی در مورد یک انسان به دلیل همجنسگرا بودن او کاری نابخردانه است.

مجازات همجنسگرایان در اسلام

تماس جنسی دو همجنس در اسلام ممنوع است و مجازات های بسیار خشن و غیر انسانی نیز برای آن در نظر گرفته شده است. در اسلام به رابطه جنسی دو مرد لواط گفته میشود که این نام مشتق از قوم لوط است. قومی که در قرآن الله به دلیل همجنسگرا بودنشان آنها را سنگباران (سوره شعرا) میکند و از اینجاست که در اسلام همجنسگرایی محکوم به سنگسار است.

 

نفرت مذهبیون از همنجسگرایی از کجاست؟

اینکه کس دیگری در رخت خواب چه میکند و یا چه نمیکند به یک کس دیگر چه ارتباطی میتواند داشته باشد؟‌ دلیل اینکه اسلامگرایان و حتی مذهبیون دیگر اینقدر نگران همجسنگراییِ همجنسگرایان هستند چیست؟ اگر از خودشان بپرسید خواهید شنید که به غیر از مزخرفاتی که در قرآن در مورد قوم لوط نیز مشتق از آن نام آن است و اینکه خدا گفته همجنسگرایی بد است و ما هم مغز خود را داده ایم دست عربی که با خدا رابطه مستقیم داشت ندارند.

یعنی به غیر از تقلید و تسلیم در مقابل اباطیلی که آنها را الهی میدانند ندارند،‌ اما این دلیل روشنی برای مخالفت مذهبیون با همجنسگرایی نیست. دلیل اینکه همجنسگرایی در اسلام مورد خشم قرار میگیرد این است که به دلیل شناخت ضعیف الله و محمد از انسان همجنسگرایی بجای یک گرایش جنسی یک هوس و شهوترانی دیده میشود.

چرا اینگونه است؟‌ برای من بعنوان یک دگرجنسگرا همجنسگرایی شهوت رانی نیست. برای نمونه ممکن است من به فاحشه‌خانه رفتن و پرداخت مبلغ کلانی برای تماس جنسی بگویم شهوترانی، ولی من فکر نمیکنم یک آدم دگرجنسگرا روزی با بخود بگوید بد نیست امروز کمی همجنسگرایی کنم همانطور که ممکن است به خود بگوید بد نیست امروز مقدار زیادی الکل مصرف کنم یا از مواد مخدر استفاده کنم. به عبارت دیگر برای یک دگرجنسگرا همجنسگرایی یک تفریح و یک لذت دیگر که اگر بخواهد میتواند داشته باشد ولی چون خدا گفته نداشته باشد نمیخواهد داشته باشد نیست!

اما همجنسگرایی برای یک همجنسگرا همان تمایل جنسی است یعنی او اگر بخواهد تماس جنسی داشته باشد طبیعتا با همجنس خود خواهد داشت،‌ اینجاست در مخالفت اسلام و سایر دینها با همجنسگرایی دورویی و تضادی دیده میشود که خود ناشی از باطل بودن این ادیان دارد.

همانطور که در نمونه های پیشین گفتم گاهی نفرت عجیبی از اسلامگرایان در مورد همجنسگرایی شنیده میشود،‌ برای نمونه کسی که به من میگفت حاضر به تغییر حکومت ایران نیست چون مخالف همجنسگرایی است هنگامی این سخن را میگفت که از روی عصبانیت به دنبال یافتن آسان ترین علت برای دفاع خود از حکومت دینی میگشت و از میان تمام موضوعات همجسنگرایی را انتخاب کرد.

این نفرت شدید نسبت به همجنسگرایی و همجنسگرایان که گاهی از اسلامگرایان و یا حتی در میان باورمندان در دنیای غیرب شنیده میشود نشان از وغقعیت های عمیق تری دارد، دلیل واقعی این تنفر چیست؟‌ به باور من این تنفر همانطور که گفتیم از روی نادانی و شناخت غلط منابع دینی از انسان است اما افزون بر آن گاهی از روی حسادت نیز هست.

در میان مذهبیون نیز افراد همجنسگرایی همچون سایر اقشار جامعه وجود دارد اما آنها به دلیل آموزه های دینی و فشارهای خانواده و محیط هرگز همجنسگرا بودن خود را نپذیرفته اند بلکه آنرا بعنوان یک هوس و شهوت سرکوب کرده اند. زندگی یک همجنسگرا که چنین کاری میکند برای او زندگی بسیار پست و دشواریست. گاهی همجنسگرایان مذهبی با یک جنس مخالف ازدواج میکنند و فرزندانی نیز دارند اما در درونشان میل به تماس با جنس مخالف دارند اما این میل را سرکوب میکنند و سعی میکنند با دعا و تقوا این مسئله حل نشدنی را در زندگی خود پنهان کنند. بنابر این وقتی میبینند شخص دیگری که او نیز همجنسگراست آزادانه با یک همجنس روابط رومانتیک یا جنسی دارد بسیار ملتهب میشوند چرا که آنها نیز اگر اسلام دست و پایشان را نبسته بود و حقوقشان را زیر پا نمیگذاشت خوب میرفتند رسما همجنسگرا میشدند. اینجاست که حسادت موجب خشم مذهبیون همجنسگرا میشود.

اگر شما یک دگرجنسگرا هستید که تنها و تنها به جنس مخالف گرایش دارید،‌ احتمالا خیلی خوب درک میکنید که اگر روزی کسی شما را مجبور به تماس جنسی با همجنس خودتان بکند،‌ آنروز برای شما یکی از تلخ ترین روزهای زندگیتان خواهد بود. برای نمونه یکی از دوستان مذکر من به من میگفت که اگر روزی به زندان بیافتد حاضر است اعدامش بکنند ولی به او تجاوز نکنند. از جمله دلایل اینکه تجاوز در تمام دنیا از جمله دور افتاده ترین قبیله ها امری ناپسند و جرمی بزرگ تلقی میشود نیز همین صدماتی است که به قربانی وارد میشود. چه این قربانی زن باشد و چه مرد. حال شخصی همجنسگرا را تصور کنید که از روی بد شانسی در خانواده ای جد اندر جد آخوند بدنیا آمده است و در کودکی با جنس مخالف ازدواج داده اند. او در این زندگی تاریک ۵۰ و ۶۰  که سالگی چه احساسی نسبت به همجنسگرایی خواهد داشت؟ احساس او این خواهد بود که من هم دوست داشتم اما بخاطر خدا نکردم یا اگر کردم هم خدا به دلایلی که عدالت خدا را ناقض است مرا خواهد بخشید.

ملایان و اسلامگرایان و آدمهای بسیار مذهبی از آنجا که زنان و مردان را در همه جا از هم جدا کرده اند و از آنجا که تنها در توالت لازم است زنان و مردان جدا باشند میتوان گفت همه جا را به توالت تبدیل کرده اند، در طول حیات خود بیشتر در میان انبوه مردان قرار میگیرند،‌ در جاهایی که تفکیک جنسی صورت میگیرد مانند پادگان، حجره های حوزه علمیه قم و غیره ملایان هم به دلیل گرایشات همجنسگرایانه هم متناسب نبودن یا بودن شرایط گاهی خاطرات خوشی از آمیزش با یکدیگر را در کارنامه زندگی خود دارند.

چنین افرادی که نمیدانند همجنسگرا هستند گاهی در کمال ناباوری این خاطرات را با افتخار بازگو میکنند و از فاعل بودن خود و مفعول قرار دادن دیگری در جمع های خصوصی تعریف میکنند بگونه ای که گویا با همجنسگرایی در صورتی که فاعل باشند مشکلی ندارند و مایل به آنند اما در صورتی که مفعول باشند نه. گاهی این خاطرات مرز قانونمندی و اخلاق را نیز رد میکنند و تبدیل به تجاوز و یا کودک آزاری میشوند. این مجرمین از طرفی مجبورند همسرشان که مادربچه‌ها میخوانند را بطور مدام تحمل کنند اما خاطراتشان همچنان باقیست و شاید طمع به تماس جنسی در حیات پس از مرگشان در بهشت نیز آنها را تا حدی آرام میکند. اما این تناقض حل شدنی نیست و گاهی در تنفرورزی و مخالفت بیش از حد با حقوق همجنسگرایان میتوان این دست پیچیدگیها را نیز دید.

همنجسگرایی غیراخلاقی نیست

همجنسگرایی اغلب از طرف کسانی که آنرا نمیشناسند و در مورد آن تحقیقی نکرده اند بعنوان یک بیماری و یا یک چیز غیر طبیعی مطرح میشود. این دسته از اشخاص فکر میکنند شخص همجنسگرا نوع زندگی جنسی خود را انتخاب میکند و شخص همجنسگرا یک انسان منحرف از لحاظ جنسی است. در حالی که تحقیقات علمی به شدت با این نوع طرز فکر مخالف هستند، تحقیقات ژنتیکی نشان میدهند که ساختار ژنتیکی همجنسگرایان بطور مشخص و واضحی به همدیگر شبیه است و از لحاظ روانشناختی نیز با هتروسکسوال ها تفاوت اساسی دارند، لذا اتحادیه روانشناسی امریکا (APA) در سال 1973 همجنسگرایی را از لیست بیماری های روانی رد کرد و از سال 1975 همجنسگرایی را بعنوان یک مسئله ذاتی و درون زادی و خارج از اختیار شخص همجنسگرا مطرح کرد و اعلام کرد که همجنسگرایی در این افراد حتی قبل از اینکه با کسی تماس جنسی داشته باشند شکل میگیرد. همجنسگرایی همچنین در لیست بیماریها و انحرافات جنسی سازمان بهداشت جهانی نیز دیده نمیشود و این بدان معنی است که مجامع علمی جهان همجنسگرایی را یک بیماری نمیدانند.

تحقیقات نشان میدهد که بسیاری از این اشخاص تلاش کرده اند که دیگر همجنسگرا نباشند و هتروسکسوال شوند اما با شکست روبرو شدند. بنابر این دانشمندان به این نتیجه رسیدند که همجنسگرایی یک بیماری نیست و نمیتوان افراد را طبیعی و همجنسگرا نامید!  همجنسگرایان نیز انسانهای طبیعی هستند و انحرافی از لحاظ جنسی ندارند و غیر طبیعی و یا مریض خواندن آنها کاملا غیر علمی است. همجنسگرایی حتی در میان حیوانات مختلف نیز وجود دارد (1).

نکته ای که مذهبیون و بسیجیان نمیخواهند درک کنند این است که همجنسگرایی پدیده ای غربی نیست! همجنسگرایان در هر جامعه و در هر تاریخی از آن جامعه وجود داشته و تعداد آنها نیز قابل توجه است. حتی در قرآن در کنار حوری هایی که قرار است در خدمت مومنان باشند از غلام های زیبایی صحبت میشود که در اختیار مسلمانان همجنسگرا قرار خواهند گرفت.  آیت الله شهید محراب دستغیب در کتاب معاد خود اعلام میدارد که قوت جنسی انسان در بهشت 100 برابر میشود. به نظر میرسد طبق این تئوری این نابغه و دانشمند بزرگ اسلامی چون 72 حوری وجود دارد احتمالا 28 غلام هم وجود خواهد داشت.

همجنسگرایی در یونان باستان، روم باستان وجود داشته و احکام مشخصی در مورد آن بجای مانده است که امروز قابل دسترسی است. همجنسگرایان در تمامی جوامع امروزی بشری نیز وجود دارند، در بسیاری از کشورهای اسلامی این افراد مجبور هستند بصورت زیر زمینی و پنهانی به برقراری ارتباط با یکدیگر بپردازند که این بسیار خطرناک است و اگر مذهبیون شعور داشته باشند باید درک کنند که پنهانی بودن چنین مسائلی باعث مشکلات بسیار زیاد پزشکی (مثل رواج ایدز) در جامعه میشود.

همجنسگرایان در طول تاریخ توسط مذهبیون مورد ظلم قرار گرفته اند اما حال که بشر دوران سیاه حکومت دینی را پشت سر گذاشته است روز به روز برای ایجاد شرایط بهتر برای زندگی انسانها قدمهای بزرگتری برمیدارد و امروزه با توجه به اطلاعات علمی ای که در باره مسئله همجنسگرایان وجود دارد در کشورهای پیشرو  حق حیات و حتی ازدواج را برای همجنسگرایان در نظر میگیرند تا این دسته افراد هم بتوانند همچون سایر انسانها زندگی آرام و عادی و برابری را تجربه کنند. آزاد بودن همجنسگرایی در غرب اصولا بعنوان بی بند و باری جنسی از طرف اسلامگرایان مطرح میشود این در حالیست که طبق قوانین کشورهای بسیاری مثل انگلستان اگر شوهری با اجبار به همسرش تماس جنسی برقرار کند همسر آن شخص میتواند شوهر قانونی اش را به دادگاه بکشاند و اگر بتواند این مسئله را اثبات کند دادگاه وی را به تجاوز کردن محکوم خواهد کرد و حتما میدانید که یکی از سنگین ترین جرمها در غرب تجاوز است. از طرف دیگر بر خلاف نظر حضرت امام، اگر در آمریکا شخصی که بیش از 18 سال سن دارد با شخصی که کمتر از 18 سال سن دارد به هر عنوان چه در صورت تمایل طرفین و چه در صورت عدم تمایل طرفین رابطه جنسی برقرار کند بازهم شخص را بعنوان متجاوز مجرم خواهند شناخت. این افراد که در تمام عمرشان در نهایت نجف و کربلا و قم را دیده اند خیلی راحت در مورد تمام جهان حکم صادر میکنند و نظرات مضحک میدهند.

آدمهای مذهبی همچنان فکر میکنند همجنسگرایان را باید به تیر بست و آتش زد و یا اعدام کرد و در داخل یک گودال گذاشت و سنگ بر سر و صورتشان کوبید (فیلم سنگسار را از اینجا ببینید) … تا دیگر کسی به فکر همجنسگرایی نیافتند. گروهی از افراد مذهبی دست به اختراع مفاهیم غیر علمی ای زدند که انتخابی بودن همجنسگرایی را اثبات کنند ولی حرف های این افراد در رد مسئله تمایلات جنسی همانقدر مسخره است که استدلال های آنها در مورد رد سایر تئوری های علمی مثل تکامل و بیگ بنگ.

اما حتی محمد و الله اسلام نیز میدانستند که همجنسگرایی از بین بردنی نیست،  نگاهی به تازینامه نشان میدهد که الله در خانه فحشای تخیلیش‌اش که شاید از خوابهای ملتحم محمد باشند و مسلمانان آنرا بهشت میخوانند خدمات جنسی را برای مسلمانان همجنسگرا نیز آماده کرده است:

سوره الطور آیه 24:

غلامانی که در خدمتشان هستند و از زیبایی بمانند مروارید پنهان در صدف هستند به دور آنها میچرخند.

سوره الانسان آیه 19

همواره پسرانی به گردشان میچرخند که چون آنها را ببینی پنداری مرواریدی پراکنده اند.

اگر این غلمان بهشتی برای جفت گیری اهل بهشت بوجود نیامده باشند چه نیازی است که خدای جهان یادآوری کند آنها بسیار ناز و زیبا هستند.

چرا باید مدافع حقوق دگرباشان جنسی بود؟

در چند دهه اخیر تغییرات بزرگی در قوانین و شیوه برخورد حکومتهای مختلف دنیا با همجنسگرایی و حقوق همجسنگرایان همچون حق ازدواج آنها بوجود آمده است. برای نمونه در آمریکا که در گذشته همجنسگرایان را نه بطور غیرقانونی و برای عبرت دیگران به دار میکشیدند امروز همجنسگرا بودن جرم نیست. در بسیاری از ایالت های آمریکا و کشورهای دیگر ازدواج همجسنگرایان به رسمیت شناخته میشود و به آنها اجازه داده میشود که بتوانند عشق را در زندگی تجربه کنند، و از مزایای حقوقی ازدواج همچون ارث، حقوق طرفین در هنگام طلاق و غیره استفاده کنند.

این تغییرات حتی در کشورهای دموکراتیک هرگز به آسانی اتفاق نیافتاده اند و نتیجه تلاش و مبارزه هوشمندانه و خالصانه هزاران تن از همجنسگرایان و مدافعان حقوق آنان بوده اند. این جنبشها و نتایج آنها نمونه درخشان بزرگی در تاریخ از تغییر مسالمت آمیز توسط مبارزات فرهنگی و آگاهی بخشی بسیار گسترده در طی سالیان بوجود آمده اند. و الا همیشه اینگونه نبود. در حالی که پیش از پایان هزاره جدید هنگامی که بیماری ایدز در آمریکا قربانی میگرفت از همجنسگرایان در تلویزیون میخواستند که همجنسگرایی نکنند گویا دست خودشان است و اگر بخواهند و مثلا ایمان و تقوا داشته باشند میتوانند دگرجنسگرا باشند. چنین برخورد ابلهانه ای دیگر کمتر وجود دارد،‌ تلاشهای فرهنگی و حقوقی مدافعان حقوقشان این نتیجه را به همراه داشت که امروز به دلیل تغییر بینش مردم در جامعه سیاستمدارانی که سالها با حقوق همجسنگرایان مخالفت میکردند مجبور شدند تغییر عقیده دهند. و این تغییر همانند برافتادن برده داری در تاریخ تکامل اخلاقی بشر دارای اهمیت است. این تغییر همچنین برای کسانی که به دنبال بهبود اجتماع هستند نمونه ای بسیار درخشان و عبرت آموز برای مطالعه و بررسی است.

اما چرا باید از حقوق همجنسگرایان و اقلیتهای جنسی دفاع کرد؟‌ چون آنها انسانند و دفاع از حقوق همجسنگرایان برای ما همان دفاع از حقوق بشر است. این اما تمام قضیه نیست، حال که دانستیم همجسنگرایان در جامعه همواره وجود داشته اند و آدمهای شرور و هوسرانی نیز نیستند و نمیتوان میل جنسی افراد را تغییر داد و نمیتوان به انسانهای همجسنگرا گفت که از میل جنسیشان استفاده نکنند باید از خود بپرسیم ما برای یک همجنسگرا چه نوع زندگی ای میخواهیم؟‌ آیا ما میخواهیم یک همجنسگرا تمام عمرش را به سرخوردگی، شرم و مورد تبعیض و تحقیر قرار گرفتن بگذراند؟

فرق یک همجسنگرا با یک دگرجنسگرا فقط در رفتار جنسی آنها در زندگی خصوصیشان است. یک همجنسگرا به دلیل انسان بودنش میتواند یک عضو مفید برای جامعه یا حتی یک ادم معمولی بیگناه باشد. بنابر این دو رفتار روبروی ماست، یکی آنکه از روی نادانی و نفرت عدالت را زیر پا گذاشته و زندگی او را با تبدیل کردنش به یک تبهکار به جرم طبیعی بودن تباه کنیم و دیگر افراد جامعه را از داشتن یک عضو همجنسگرا که میتواند همچون یک دگرجنسگرا یک معلم خوب، یک ورزشکار خوب،‌ یک مدیر خوب، یک سیاستمدار خوب، یک آشپز خوب، یک پزشک خوب، یک دانشمند خوب، یک کشاورز خوب، یک شاعر خوب ، و حتی یک مرجع تقلیبد خوب باشد محروم کنیم.

از طرف دیگر روابط جنسی همجنسگرایانه که چه کسی بخواهد و چه نخواهد اتفاق خواهند افتاد نیز باید قانونمند باشند یعنی نباید در چنین روابطی حق کسی ضایع شود و یا راهی برای دفاع مظلوم از حق خود وجود نداشته باشد. رابطه جنسی میان همجسنگرایان همچون دیگر روابط جنسی میتواند غیر اخلاقی یا غیر قانونی باشد، برای نمونه تجاوز یعنی تماس جنسی بدون توافق و یا رابطه جنسی با کودک که هردو در اسلام اخلاقی و قانونی و حق به شمار میروند به روشنی غیر عادلانه هستند چه میان دو همجنس اتفاق بیافتند چه میان دو جنس متفاوت. به رسمیت نشناختن حق تماس دو جنس موافق و جرم بودن خود آن سبب پنهان ماندن و در نتیجه تکرار جرایم دیگر مربوط به رابطه جنسی میشود.

پایان

برقراری و دفاع از حقوق همجنسگرایان یک حرکت کاملا اخلاقی و در دفاع از انسانیت و آزادی و برابری است و ماهیت ضد بشر و خردستیز ادیان ابراهیمی طبق معمول در مورد هر حرکتی که به سمت آزادی و انسانیت است در مقابله آنها با این حرکتها نمود جدی پیدا میکند.

همجنسگرایی یک واقعیت اجتماعی است و در میان ایرانیان نیز همجنسگرایان بسیاری وجود دارند که وظیفه انساندوستان و آزاد اندیشان است که جامعه را از واقعیت هایی که اسلامگرایان سعی در پنهان کردن آنها دارند آگاه کنند.

منابع :

(1)- به اینجا نگاه کنید.

آتیسم چیست؟

نویسنده – جورج اچ. اسمیت

برگردان به پارسی – امیر غلامی

* برگرفته از کتاب  اتئیسم: ردّیه ای بر خدا

احمقان در دل می گویند «خدایی وجود ندارد.» آنها فاسدانی هستند زشت کار،  هیچ یک از نیکوکاران نیستند. ( مزامیر، عهدعتیق، 14.1)

1.  اسطوره ی اتئیسم

عبارت فوق که به کرات نقل قول شده، نگرش اغلب دینداران معمولی نسبت به اًتئیسم است. اَتئیسم (یا بیخدایی) چه بسا کم اقبال ترین – و ناشناخته ترین – دیدگاه فلسفی در میان آمریکاییان معاصر باشد. اغلب با ترس و ناباوری بدان می نگرند، انگار که این  آموزه از  پلیدی های بسیار – از بی اخلاقی، بدبینی و کمونیسم گرفته، تا نهیلیسم تمام عیار-  پشتیبانی می کند.

معمولاً تصور می کنند که اتئیسم تهدیدی برای فرد و جامعه است. فیلسوفی در مورد آن می نویسد که اَتئیسم «علم است که از خرد و ترس از خدا تهی گشته ، و مستقیماً ما را به پلیدترین رذایل جنگ مدرن راه  می برد…. » اخیرا وینسنت میچلّی ادعا کرده که «هر صورتی از اَتئیسم، حتی اگر با نیت خیر آغاز شده باشد،  فرد را از درون می فشرد، فرو می پاشد، و به بردگی می گیرد، و سرانجام، هنگامی  که این آفت در میان آدمیان همه گیر شد، کل جامعه را به انقیاد می کشد و نابود می کند.»

دین مداران با تعبیرهای این چنینی از اتئیسم، که آن را شرّ  و قوّه ای مخرب می شمرد، در طول تاریخ  مجازات های گوناگونی را برای اتئیست ها وضع کرده اند. افلاطون در تلاش برای تأسیس دولت آرمانی، مجازات ارتکاب کفر را برای بار نخست پنج سال زندان و برای بار دوم مرگ تعیین کرد. عیسی، که به عنوان  سمبل عشق و شفقت عرضه می شود،  تهدید می کرد که کافران در «کوره ی آتشی» افکنده خواهند شد که در آن » آدمیان می گریند و دندان به هم می سایند» به مانند » انبوه دانه هایی که در آتش بریان می شوند…» (انجیل متی، 13، 40-42). توماس آکویناس،  الاهیدان بزرگ قرون وسطا، فکر می کرد که «گناه کفر بزرگ تر از هر گناهی است که از سستی اخلاق ناشی می شود»، و توصیه می کرد که ملحد پس از سومین بار ارتکاب الحاد » توسط مرگ از عرصه ی گیتی محو شود».

اگرچه امروزه اتئیست ها نسبتاً در ایالات متحده آزادند، کوشش برای احقاق حقوق قانونی اتئیسم، نبردی دشوار و پیوسته شده است. برای مثال، تا همین اوایل قرن بیستم، بسیاری از ایالات اجازه نمی دادند که اتئیست ها در دادگاه شهادت دهند. در نتیجه یک اتئیست نمی توانست هنگام دفاع از خود در برابر اتهامات مدنی و جنائی نقش مؤثری داشته باشد. استدلال پشت این منع شهادت آن بود که می گفتند چون اتئیست  به پاداش و جزای پس از مرگ اعتقاد ندارد، اجباری اخلاقی ندارد که در دادگاه حقیقت را بگوید. در سال 1871، دیوان عالی ایالت تِنِسی این حکم جالب توجه را صادر کرد:

شخصی که جسورانه اعلام می کند که به خدا اعتقاد ندارد،  چنان بی پروا و چنان فاقد مسئولیت اخلاقی می باشد که، اندک کسانی استماع یا قبول سخن او را در محاکم یک کشور مسیحی می پذیرند.

این همان کلیشه ی اَتئیست، به عنوان شخصی فاقد احساس مسئولیت، و بی اخلاق است. کلیشه ای که در زمانه ی ما هم شیوع بسیار دارد. اتئیسم را متهم می کنند که چیزی جز نفی گرایی نیست: ویران می کند، اما باز نمی سازد. اتئیست ضد اخلاقیات است، و کشمکش میان ایمان به خدا و بیخدایی، کشمکش میان خیر و شر است. اگر چنین باشد، اتئیسم پدیده ی شومی در ابعاد جهانی است. اِی. ئی تیلور این رعب و وحشت بسیاری از خداباوران چنین بیان می کند:

… حتی در انتزاعی ترین تأملات روشنفکری مان نیز نمی توانیم از رویارویی با این پرسش بگریزیم که آیا می توان خدا را از جهان طبیعی یا اخلاقی حذف کرد بی آنکه  هر دوی این عوالم دچار کابوسی پریشان نشوند؟

این تصویر از جهان بی خدا، تنها یکی از تصاویر بسیار است.  اتئیسم چنان با اسطوره ها و بدفهمی ها آمیخته شده که بسیاری از به اصطلاح ناقدان آن کاملاً ره به خطا می برند. برخی از ناقدان دیندار اتئیسم ترجیح می دهند که به ایده های نامطبوع یادآور آن حمله کنند و مستقیماً به چالش هایی نپردازند که پیش روی تئیسم [=خداباوری] قرار دارد. درحقیقت، کم نیستند کتاب هایی که قرار است ردّیه هایی بر اتئیسم باشند، اما کل محتوایشان عاری  از هرگونه اشاره ای به مسائل اصلی پیش روی خداباوری است. این کتاب ها معمولاً به نقد شخصیت های اتئیست (مانند نیچه، مارکس، کامو و سارتر) می پردازند، و مؤلف دین مدار با نقد نظرات این افراد، دل خوش می کند که اتئیسم را مغلوب کرده است. اما این مؤلفان اغلب حتی اشاره ای هم به خود اتئیسم نمی کنند.

ارائه ی دیدگاه اتئیستی، کوششی است دشوار و طاقت فرسا. اتئیست باید از موانع بیم و ظنّ  پیش رویش درگذرد، و مخاطب را متقاعد سازد که اتئیسم یک رویکرد منحط نیست، بلکه گامی است به پیش. برای این کار اغلب لازم است که اتئیسم موضعی تدافعی اتخاذ کند و به توضیح این مطلب بپردازد که چرا اتئیسم به نتایج مصیبت بار منجر نمی شود. از او انتظار می رود که به پرسش هایی از این قبیل  پاسخ دهد:

بدون خدا، از اخلاق چه باقی می ماند؟ بدون خدا، آیا زندگانی انسان هدفی دارد؟ اگر به خدا معتقد نباشیم، چطور می توانیم به چیزی یقین داشته باشیم؟ اگر خدا وجود نداشته باشد، در برابر سختی ها و ناملایمات به کی می توانیم متوسل شویم؟ اگر پس از مرگ حیاتی نباشد، چه کسی نیکی را پاداش و بدی را جزا می دهد؟ بدون خدا، چگونه می توانیم در برابر یورش کمونیسم بیخدا مقابله کنیم؟ اگر خدا وجود نداشته باشد، چه بر سر ارج و کرامت انسان می آید؟ بدون خدا، انسان چگونه می تواند به سعادت دست یابد؟

این پرسش ها و دیگر سئوالات مشابه اینها نشانگر قوّت پیوند میان دین و ارزش ها در اذهان بسیاری از مردم هستند. در نتیجه، پرسش از وجود خدا صرفاً یک سئوال فلسفی نیست –  چون فکر می کنند که اتئیسم یورشی به این ارزش هاست، معنایی برایش متصور می شوند که ورای معنای حقیقی آن است –  دفاع از دینداری اغلب آکنده از غلیان احساسات است، و اتئیسم خود را اخلاقاً محکوم می یابد. انگار که آدمی است منحرف، و شوربخت. و به انواع و اقسام مجازات ها  تهدید می شود. در همین حین،  در می یابد که  استدلال هایش به نفع اتئیسم ضعیف اند و مؤمنان عامی – که باورشان به خدا بر اساس عواطف بوده و نه دلایل بخردانه – در برابر استدلال های علیه خدا بی تفاوت اند ، هرقدر هم که این استدلال ها دقیق و قاطع باشند. اتئیست بودن همتی عالی می طلبد: وقتی که قرار بر انتخاب میان آسودگی دین و درستی اتئیسم باشد، بسیاری بی درنگ دومی را فدای اولی می کنند. از چشم انداز آنان، موضوع خدا بسیار مهم تر از بودن یا نبودن اوست.

با این وصف برای اتئیست چه می ماند؟ آیا باید اتئیسم را به عنوان یک شیوه ی زیست جایگزینِ دین مطرح کند؟ زیستنی که سرشار از ارزش های منحصر به فرد است؟ آیا اتئیسم جایگزینی برای دین است؟  آیا اتئیسم می تواند نیازهای اخلاقی و عاطفی مردم را ارضا کند؟ آیا اتئیست باید در برابر هرگونه اتهام بی اخلاقی و بدبینی، از خود دفاع کند؟ آیا اتئیسم هیچ ارزش مثبتی هم مطرح می کند؟ این پرسش ها آن قدر که به نظر می رسند پیچیده نیستند. اتئیسم یک دیدگاه سرراست و قابل دفاع است، و به راحتی می توان حدود و صغور ادعاهای آن را تعیین کرد. برای فهم نگرش اتئیستی اما،  باید دیوار اسطوره ای را که اتئیسم را احاطه کرده فرو بریزیم – به  این امید که هراس ها و پیش داوری ها در مورد اتئیسم نیز به همراه آن فرو ریزد. برای نیل به این هدف، باید تعیین کنیم که اتئیسم چه هست، و چه نیست.

2. معنای اتئیسم

«تئیسم» به عنوان «باور به وجود خدا یا خدایان» تعریف می شود. واژه ی “theism” گاهی برای اطلاق به  باور به قسم خاصی از خدا – خدایِ شخصیِ ادیان توحیدی –  به کار می رود. اما در سراسر این کتاب، «تئیسم» برای نامیدن باور به هر نوع خدا یا خدایان استعمال می شود. پیشوند “a”  به معنای «فاقد» است،  پس معنای تحت اللفظی  واژه ی “a-theism” ،  «فاقد تئیسم» یا فاقد باور به وجود خدا یا خدایان است. بنابراین، اتئیسم، فقدان باور تئیستی است. کسی را که به وجود خدا یا هر موجود ماوراءطبیعی باور ندارد اتئیست می خوانند.

گاهی اتئیسم را چنین تعریف می کنند: «باور به اینکه هیچ قسم خدایی وجود ندارد»، یا اینکه خدا نمی تواند وجود داشته باشد. با اینکه اینها هم مقولاتی از اتئیسم هستند، اما کل معنای آن را پوشش نمی دهند – و با توجه به سرشت اصلی اتئیسم، تاحدی گمراه کننده اند. اتئیسم، اساساً  یک باور نیست، بلکه فقدان یک باور است. یک اتئیست در وحله ی نخست کسی نیست که باور دارد که خدا وجود ندارد؛ بلکه کسی است که باور ندارد کهخدا وجود دارد.

با تعریف فوق، دامنه ی معنایی اتئیسم گسترده تر از آن چیزی می شود که معمولاً از آن مراد می کنند. پل ادواردز دو تا از رایج ترین کاربرد های واژه ی اتئیسم را چنین توضیح می دهد:

معنای نخست، معنای متعارفی است که مطابق آن شخصی را اتئیست می خوانند. اگر کسی بگوید که خدایی نیست، و این اظهار به این معنا گرفته شود که «خدا هست»، گزاره ای کاذب است. معنای دوم، و گسترده تر اتئیسم آن است که کسی  باور به وجود خدا را منکر باشد، فارغ از اینکه این انکار مبتنی بر کاذب دانستن  باور به خدا باشد یا خیر.

هر دوی این معانی، اقسام مهمی از اتئیسم هستند، اما هیچ یک حق مطلب را در مورد اتئیسم ادا نمی کند. «اتئیسم» یک واژه ی سلبی است، واژه ایست برای نفی، و حاکی از خلاف تئیست بودن است. اگر عبارت «باور- به- خدا» را جایگزین تئیسم بگیریم،  می بینیم که نفی آن «عدم- باور- به- خدا» یا به بیان دیگر «اتئیسم» می شود. این واژه تنها بیان دیگری از «فاقد تئیسم»، یا فاقد باور به وجود خداست.

«تئیسم» و»اتئیسم» واژگانی توصیفی اند: نشانگر باور یا عدم باور به خدا هستند. اگر شخصی را  تئیست بخوانند، برایمان مشخص می شود که به خدا باور دارد، نه اینکه چرا به خدا باور دارد. اگر کسی را اتئیست بخوانند،  برایمان مشخص می شود که به خدا باور ندارد، نه اینکه چرا به خدا باور ندارد.

دلایل باور نداشتن به وجود خدا بسیار اند: ممکن است فرد هرگز با مفهوم خدا مواجه نشده باشد، یا ایده ی وجود موجودی ماوراءطبیعی را یاوه بیانگارد، یا فکر کند که هیچ شاهدی برای باور به وجود خدا نیست. اما فارغ از همه ی این دلایل، اگر کسی به وجود خدا باور نداشته باشد، اتئیست است، یعنی، باور تئیستی ندارد.

با این رویکرد، تئیسم و اتئیسم همه ی موارد ممکن در مورد باور به وجود خدا را پوشش می دهند: یا فرد تئیست است یا اتئیست؛ هیچ گزینه ی دیگری در میان نیست. یا شخص گزاره ی «خدا هست» را درست می داند، یا غلط. یا فرد به وجود موجودی ماوراءطبیعی باور دارد یا  ندارد. هیچ شق ثالثی در میان نیست. در اینجا پرسش اگنوستیسیم (لاادری گری) رخ می نماید، که به طور سنتی به عنوان گزینه ی سوم در میان تئیسم و اتئیسم مطرح می شود.

3. اگنوستیسیم

واژه ی «اگنوستیک» در سال 1869 توسط توماس هاکسلی ابداع شد. او چنین گزارش می دهد که «هنگامی که به بلوغ فکری رسیدم،  از خودم می پرسیدم که آیا من تئیست هستم، اتئیست ام، یا پان تئیست [= همه خداانگار]… دریافتم که هرچه بیشتر می آموزم و می اندیشم،  آمادگی ام برای پاسخ دادن به این سئوال کمتر می شود.» به گفته ی هاکسلی، طرفداران این آموزه ها، به رغم تفاوت های آشکارشان، در یک فرض اشتراک دارند، فرضی که او با موافق نیست:

آنها کاملاً مطمئن اند که به یک «گنوسیس» [= شناخت] یقینی دست یافته اند، و کم و بیش با موفقیت مشکل هستی را حل کرده اند؛ درحالی که من کاملاً مطمئن بودم که چنین یقینی ندارم، و قویّاً متقاعد شده بودم که این مسئله لاینحل است.

هنگامی که هاکسلی به انجمن متافیزیکی [انگلستان] پیوست، دریافت که هر یک از باورهای مختلفی که در آنجا عرضه می شود نامی دارد: «اغلب همکارانم ملقب به یک جور ‘ایست’ بودند.» هاکسلی نامی برای عدم اطمینان خودش نمی یافت، و «عاری از قبای لقبی بودم که مرا بپوشاند.» به روباهی بی دم میماند – پس با «اگنوستیک» خواندن خود، برای خودش دُمی دست و پا کرد. به نظر می رسد که در اصل هاکسلی این عبارت را به عنوان یک جور شوخی مطرح کرده باشد. او نام یک فرقه ی مذهبی قدیمی به نام  “Gnostics” را عاریت گرفته است. گنوستیک ها  کسانی بودند که معروف به عقیده ی امکان کسب معرفت به ماوراءطبیعت بدون توجیه عقلانی بودند. پس هاکسلی خود را “a-gnostic” نامیده است. یعنی کسی که معتقد است حتی اگر ماوراءطبیعت وجود داشته باشد، ورای حیطه ی معرفت بشری قرار می گیرد. نمی توانیم بگوییم که آیا وجود دارد یا نه، پس باید داوری خود را معلق سازیم.

از زمان هاکسلی به بعد، «اگنوستیسیم» با توجه به ریشه ی لغوی اش، که از پیشوند نفی “a” و بن واژه ی یونانی gnosis (به معنای «شناختن») ساخته شده، کاربردهای  گوناگونی یافته است. امروزه در معنای عام، به کسی اگنوستیک می گویند که تأکید می کند یک حیطه قابل شناخت نیست. اگنوستیک شخصی است که می گوید چیزی ذاتاً  برای آدمیان غیرقابل دانستن است. هنگامی که این واژه را در حیطه ی باورهای تئیستی به کار می برند، اگنوستیک به کسی اطلاق می شود که می گوید  برخی از ویژگی های ماوراءطبیعت برای همیشه بر فهم آدمیان پوشیده خواهند ماند.

اگر  واژه ی اگنوستیسیسم را به درستی ملاحظه کنیم، می بینیم که شق ثالثی برای تئیسم و اتئیسم نیست زیرا معطوف به جنبه ی دیگری از باورهای دینی است. تئیسم و اتئیسم راجع داشتن یا نداشتن باور به وجود خداست، اما اگنوستیسیم راجع به ناممکنی معرفت به خدا یا هستی ماوراءطبیعی است.

واژه ی اگنوستیک به خودی خود نشانگر باور یا عدم باور به خدا نیست. اگنوستیسیم هم می تواند تئیستی باشد و هم اتئیستی.

یک تئیست اگنوستیک به وجود خدا باور دارد، اما همچنین باور دارد که معرفت به سرشت خدا ممکن  نیست. ابن میمون،  فیلسوف یهودی قرون وسطا نمونه ای از طرفداران این نگرش است. او به وجود خدا باور داشت، اما صفات ایجابی به این خدا نسبت نمی داد، چون معتقد بود که این صفات ایجابی موجب تکثّر ذات باری می شود – روندی که به نظر او به شرک می انجامد. طبق باور دینداران اگنوستیک، می توانیم بگوییم که خدا وجود دارد، اما نمی توانیم بگوییم که خدا چیست، چون سرشت ماوراءطبیعت را نمی توان شناخت.

اتئیست اگنوستیک هم، مانند پسرعموی تئیست اش، بر آن است که هر گونه قلمرو ماوراءطبیعت ذاتاً برای انسان ها قابل شناخت نیست، اما این اگنوستیک داوری خود را یک گام عقب تر می برد. برای اتئیست اگنوستیک، نه تنها سرشت  موجودات ماوراءطبیعی ناشناختنی است، بلکه وجود موجودات ماوراءطبیعی نیز قابل دانستن نیست. مانمی توانیم چیزی از ناشناختنی بدانیم؛ بنابراین، این اگنوستیک نتیجه می گیرد که، ما نمی توانیم معرفتی به وجود خدا داشته باشیم. از آنجا که این گروه از اگنوستیک ها باور تئیستی را نمی پذیرند، از اتئیست ها محسوب می شوند.

دفاع های گوناگونی از دیدگاه اتئیسم اگنوستیک شده است، اما منشاء اغلب آنها تجربه گرایی سخت است؛ یعنی این آموزه که انسان باید همه ی معرفت اش را از طریق تجربه ی حسّی حاصل کند. از آنجا که یک موجود ماوراءطبیعی ورای حیطه ی تجارب حسّی قرار می گیرد، ما نه می توانیم وجود خدا را تأیید کنیم و نه تکذیب؛ زیرا هردوی این حالات، از نظر اتئیست اگنوستیک، مستلزم فراتر رفتن از مرزهای فهم بشری است. چنین اگنوستیکی با اینکه امکان نظری وجود ماوراءطبیعی را می پذیرد، اما باور دارد که این مسئله باید نهایتاً غیریقینی و بدون تصمیم گیری قاطع باقی بماند. به این ترتیب، پاسخ اتئیست اگنوستیک به پرسش «آیا خدا وجود دارد؟» این است که «نمی دانم» یا به بیان مشخص تر «نمی توانم بدانم».

روشن نیست که این توضیح، بیان دقیقی از موضع توماس هاکسلی باشد. گاهی به نظر می رسد که او می گوید که گرچه وجود ماوراءطبیعت ممکن است، اما چنان وجودی شناختنی نیست. در جای دیگر اما، می نویسد که «من چندان برای هر چیز «ناشناختنی» اهمیتی قائل نیستم.» و هنگام خلاصه کردن مبانی اگنوستیسیم، هاکسلی به هیچ چیز ناشناختنی یا «لاینحل» ی اشاره نمی کند.

… درست نیست آدم بگوید که در مورد صحت عینی گزاره ای یقین دارد، مگر اینکه بتواند شواهدی فراهم آورد که به طور منطقی  یقین اش را توجیه کنند. این همان نکته ایست که اگنوستیسیم بر آن تأکید دارد؛ و به نظر من، این تنها چیزی است که برای اگنوستیسیم اساسی است… کاربرد این اصل،  منجر به نفی یا تعلیق داوری در مورد گزاره هایی می شود که «گنوستیک» های کلیسایی معاصر، آنها را سراسر یقینی می پندارند.

این قطعه حاکی از آن است که به نظر هاکسلی شواهد کافی برای توجیه باور به خدا وجود ندارد، پس فرد باید داوری خود را در این مورد به حالت تعلیق در آورد. در پاسخ به اینکه آیا اصولاً نمی توان دانست خدا وجود دارد، یا اینکه در حال حاضر شواهد کافی وجود ندارد، او می نویسد:

چیزی که مطمئنم این است که بسیاری موضوعات هستند که من از آنها هیچ نمی دانم؛ و فکر می کنم آنها موضوعاتی باشند که از قوّه ی من خارج اند. اما اینکه آیا  دیگران می توانند این موضوعات را بفهمند یا نه، خود یکی از همان چیزهایی است که فراسوی معرفت من قرار دارند، اگرچه می توانم نظراتی مؤکدی در مورد امکان چنین مواردی داشته باشم.

هاکسلی مایل نیست که بگوید ماوراءطبیعت مطلقاً ناشناختنی است، و در عوض می خواهد بگوید که، تا آنجا که می داند، شناخت ماوراءطبیعت ورای فهم بشری قرار دارد. این بدان معنا نیست که به نظر او شناختنی بودن ماوراءطبیعت خود موضوعی است که دانستنی نیست.

به خاطر این ابهام در موضع اگنوستیک کلاسیک، واژه ی «اگنوستیک» به طرق مختلفی به کار رفته است. اغلب آن را برای توصیف کسانی به کار می برند که وجود یا عدم وجود خدا را نه تأیید می کنند و نه رد، و از آنجا که اغلب اتئیسم را به معنای انکار صریح تئیسم به کار می برند، اگنوستیسیسم به عنوان گزینه ی سومی مطرح شده است.  یک توضیح متعارف اگنوستیسیم، در دائرة المعارف کاتولیک، از این قرار است:

شخص اگنوستیک، اتئیست نیست. اتئیست کسی است که منکر وجود خداست؛ اگنوستیک بر جهل خود به وجود خدا تأکید دارد. در نظر اگنوستیک خدا می تواند موجود باشد، اما عقل نه می تواند وجود او را اثبات کند و نه انکار.

توجه کنید که اگنوستیسیم تنها هنگامی به عنوان گزینه ی سوم مطرح می شود که اتئیسم به معنای محدود خود، یعنی انکار تئیسم، تعریف شود. اما دیدیم که اتئیسم، در معنای وسیع خود، اساساً به دیدگاهی گفته می شود که فاقد باور به خدا است و لزوماً مستلزم انکار وجود خدا نیست. هرکس که، به هر دلیلی،  به خدا باور نداشته باشد، فاقد باور تئیستی است و لذا اتئیست محسوب می شود.

با اینکه اگنوستیکی مانند هاکسلی می تواند از اعلام درست یا غلط بودن تئیسم سر باز زند – و به این ترتیب داوری خود را معلّق کند – فاقد باور  به وجود خدا است. (اگر باور داشت، تئیست می بود.) اما چون چنین اگنوستیکی نمی پذیرد که وجود خدا درست باشد، فاقد باور تئیستی است، و لذا اتئیست محسوب می شود – و اگنوستیسیم هاکسلی قسمی از اتئیسم است.

پس، چنان که پیش تر اشاره شد، اگنوستیسیم یک موضع مستقل یا میانی بین تئیسم و اتئیسم نیست، زیرا مطابق معیارهای متفاوتی طبقه بندی می شود. تقسیم بندی تئیسم و اتئیسم میان کسانی است که به خدا باور دارند و کسانی چنین باوری ندارند. تقسیم بندی اگنوستیسیم میان کسانی است که معتقدند عقل نمی تواند به قلمرو ماوراءطبیعت نفوذ کند و کسانی که مدافع توانایی عقل برای تأیید  یا انکار درستی باور تئیستی هستند.

مخالفت با تئیستِ اگنوستیک،  نه تنها از سوی اتئیست ها، بلکه از از جانب تئیست هایی هم هست که باور دارند که آدمی می تواند سرشت خدا را (دست کم تا حدودی)  دریابد.  به همین ترتیب، مخالفت با اتئیست اگنوستیک هم از جانب اتئیست هایی است که امکان نظری وجود ماوراءطبیعت را نمی پذیرند، و هم از جانب کسانی که می گویند عقل به خوبی می تواند نشان دهد که تئیسم غلط یا مهمل است.

هم مؤمنان و هم ملحدان موضع اگنوستیک را مورد انتقادهای سخت قرار داده اند. انتقاداتی که بعداً بدان ها می پردازیم. هدف ما در اینجا روشن کردن رابطه ی اگنوستیسیم با تئیسم و اتئیسم است، تا از سوءتعبیرهای آتی اجتناب شود. اغلب اگنوستیسیم مفرّ کسانی است که می خواهند از برچسب اتئیسم بگریزند. اگنوستیسیسم به خاطر ابهام اش، به عنوان یک شکل روشنفکرانه ی مخالفت با دین، جایگاهی  محترمانه کسب کرده است. با این حال، در بسیاری موارد، واژه ی «اگنوستیک» سوءتعبیر شده است.

اگنوستیسیم یک موضع معتبر فلسفی است (گرچه به نظر من خطاست)، اما شقی ثالث، یا منزلی میانی مابین تئیسم و اتئیسم نیست. برعکس، روایتی از هر دو موضع تئیسم و اتئیسم است. کسی که خود را اگنوستیک می خواند، باید همچنان روشن کند که آیا به خدا باور دارد یا نه – وبه این ترتیب، خود را تئیست یا اتئیست محسوب کند. اما اگنوستیک چنین نمی کند. اگنوستیسیم گریزگاهی نیست که معمولاً می پندارند.

4.  اقسام اتئیسم

واژه ی «اتئیسم» تا کنون برای اطلاق به هرگونه عدم باور به خدا یا خدایان به کار رفته است. اکنون می کوشیم تحلیل مختصری از اقسام مختلف آن ارائه دهیم.

اتئیسم را می توان به دو مقوله ی کلی تقسیم بندی کرد: ضمنی و صریح. (الف) اتئیسم ضمنی فقدان باور تئیستی است بدون اینکه این باور آگاهانه انکار شود. (ب) اتئیسم صریح، فقدان باور تئیستی همراه با انکار آگاهانه ی آن است.

(الف) اتئیست ضمنی شخصی است که به خدا باور ندارد، اما صراحتاً درستی تئیسم را نفی یا انکار نمی کند. اصلا لازم نیست که اتئیست ضمنی با ایده ی خدا آشنایی داشته باشد.

برای مثال، شخصی که هیچ  آشنایی با باور تئیستی ندارد، نه به خدا اعتقاد ندارد و نه منکر وجود چنان موجودی می شود. انکار مستلزم چیزی است که انکار شود، و کسی نمی تواند بدون اینکه اول بداند تئیسم چیست، آن را انکار کند. انسان با دانش ذاتی به ماوراءطبیعت زاده نمی شود؛ پس نمی تواند صحت آن را تصدیق یا انکار کند – یا حتی داوری اش را «معلّق» کند،  مگر اینکه با این آموزه آشنا شده باشد یا خود به آن اندیشیده باشد.

چنین شخصی برای طبقه بندی های کلاسیک مشکل ساز می شود. او به خدا اعتقاد ندارد، پس نمی تواند تئیست باشد. منکر وجود خدا هم نیست، پس، مطابق معنایی که معمولاً از اتئیسم مراد می کنند، او را اتئیست هم نمی توان خواند. همچنین او نمی گوید که وجود ماوراءطبیعت ناشناختنی یا نادانستنی است، پس اگنوستیک هم نیست. به این ترتیب،  برچسب های کلاسیک قادر به طبقه بندی چنین شخصی نیستند، و این نشان می دهد که طبقه بندی کلاسیک فاقد جامعیت است.

مطابق تعریفی از اتئیسم که دراین فصل ارائه کردیم، کسی که با تئیسم آشنایی ندارد،  اتئیست محسوب می شود چون فاقد باور به خدا است. این مقوله همچنین شامل کودکانی هم می شود که قابلیت مفهومی برای فهم این قبیل مسائل را دارند، اما هنوز با دیدگاه تئیستی آشنا نشده اند. این که چنین کودکی به خدا باور ندارد، او را در زمره ی اتئیست ها قرار می دهد. چون این نمونه های فقدان دین از انکار آگاهانه ناشی نشده اند، در مقوله ی  اتئیسم ضمنی می گنجند.

در اینجا می توان ایراد گرفت که چرا واژه ی «اتئیسم» چنان تعریف شده که کودکان بی اطلاع را نیز در بر می گیرد. بی شک برخی دینداران این اتهام را مطرح می کنند که با این تعریف دلبخواه، اتئیسم به پیروزی بی ارزشی دست می یابد. برای پاسخ به این ایراد، باید توجه کنیم که تعریف اتئیسم به معنای فقدان باور به خدا یا خدایان، دلبخواهی نیست. اگرچه این معنا وسیع تر از چیزی است که معمولاً به اتئیسم نسبت می دهند، اما توجیه آن در معنای «تئیسم» و پیشوند «a» است. همچنین، همان طور که پیش تر محاجه شد، این تعریف از اتئیسم این مزیت را دارد که نشانگر برنهاده ی [= تز] اتئیسم است، به نحوی که «تئیسم» و «اتئیسم» همه ی امکانات باور و عدم باور به خدا را در بر گیرند.

با وارسی دقیق تر، معلوم می شود که ایراد به اتئیست خواندن کودک بی اطلاع، ناشی  از این پیش فرض است که اتئیسم مستلزم قسمی زوال اخلاقی است که کودک از آن بری می باشد. چه قدر گستاخانه است که من کودک معصوم را اتئیست بخوانم! مسلماً درست نیست که کودکان را چنین تحقیر کنم.

اگر دینداران از دلالت های اخلاقی اتئیست خواندن کودک معصوم رنجیده خاطر می شوند، خطا در آن دلالت های اخلاقی است و نه در این تعریف از اتئیسم.  اتئیست خواندن کودک گام عمده ای در جهت پاک کردن انگ بی اخلاقی است که به اتئیسم می زنند، زیرا تئیست ها را وا می دارد که یا از کلیشه هایشان درمورد اتئیسم دست بردارند و یا آن کلیشه ها را به حیطه هایی بکشانند که آشکارا مهمل است. اگر مؤمنی نپذیرفت که از اسطوره های محبوبش دست بردارد، اگر همچنان هر غیرمؤمنی را بی اخلاق خواند، باید همین انگ را به کودکان معصوم نیز بزند. و به این ترتیب، اگر پیرو متعصب کالوین نباشد،  به اینجا می رسد که بفهمد نکوهش اخلاقی اتئیسم، یاوه است.

مقوله ی اتئیسم ضمنی، شامل کسانی هم می شود که با باور تئیستی آشنایی دارند، و با آن موافق نیستند، اما صریحاً باور به خدا را منکر نمی شوند. چنین شخصی با نپذیرفتن باور تئیستی، می تواند بی تصمیم یا بی تفاوت باشد، اما از آنجا  که این شخص فاقد باور به خداست، او نیز اتئیست ضمنی محسوب می شود.

اغلب تئیست هایی که می خواهند اتئیسم را یک باور ایجابی نشان دهند و نه فقدان یک باور، برای تسهیل کارشان، توجهی به  اتئیست های ضمنی ندارند. اگرچه این تمایز میان اتئیسم ضمنی و صریح ممکن است خیلی ظریف نماید، اما پیامدهای مهمی دربر دارد.

اگر کسی باوری ایجابی داشته باشد (یعنی، تأکید کند که باوری درست است)، ناچار است که شواهدی به نفع آن ارائه دهد. زحمت اثبات همواره با مدعی درستی یک مدعاست. اگر شواهدی در کار نباشد، اگر مبنای کافی برای پذیرش گزاره ای فراهم نباشد، نباید آن را باور کرد. تئیستی که مدعی  وجود خداست، باید شواهدی بر این مدعا فراهم کند؛ اگر از پس چنین وظیفه ای بر نیاید، ادعایش را نباید صادق انگاشت.

برخی مؤمنان می کوشند تا با نهادن بار مسئولیت شاهد آوردن بر گرده ی اتئیست ها، از آن شانه خالی کنند. می گویند اتئیسم، که آن را  عنوان باور رقیب تئیسم عنوان می کنند، نمی تواند نشان دهد که خدایی وجود ندارد. بنابراین، مدعی می شوند که اتئیسم هم بهتر از تئیسم از کار درنمی آید. این استدلال مطلوب اگنوستیک هایی هم هست، که توجیه شان برای ردّ تئیسم و اتئیسم این است که هیچ کدام نمی توانند شواهدی بر درستی مدعای خود ارائه دهند.

هنگامی که اتئیسم را فقدان تئیسم بدانیم، مانور فوق الذکر شکست می خورد. تنها  باورهای ایجابی نیازمند اثبات هستند. مؤمنان برای اینکه بتوانند از اتئیسم اثبات بطلبند، باید آن را یک باور ایجابی جلوه دهند که نیازمند اثبات است. هنگامی که اتئیست را کسی بدانیم که فاقد باور به خداست، روشن می شود که او مجبور نیست که هیچ چیز را «اثبات» کند. اتئیست، بما هو اتئیست، به هیچ چیزی که نیازمند اثبات باشد باور ندارد؛ لقب «اتئیست» به ما نمی گوید که او چه چیزی را صادق می داند، بلکه می گوید که او چه چیزی را صادق نمی داند. اگر دیگران از او می خواهند که وجود خدا را بپذیرد، بر عهده ی آنان است که درستی تئیسم را برایش ثابت کنند – اما لازم نیست که اتئیست هم به همین سیاق درستی اتئیسم را برای ایشان ثابت کند.

فرق نهادن میان اتئیسم و باورهای بسیاری که یک اتئیست می تواند داشته باشد، بسیار مهم است. اتئیست باورهایی ایجابی هم دارد، اما مفهوم اتئیسم شامل آن باورهای دیگر نمی شود. اتئیسم تنها به مؤلفه ی عدم باور به خدا اطلاق می شود، و از آنجا که این مؤلفه هیچ محتوایی ندارد، هیچ باور ایجابی ای در کار نیست، و نمی توان از آن طلب اثبات کرد.

اتئیسم ضرورتاً محصول نهایی یک زنجیره ی استدلالی نیست. واژه ی «اتئیست» به ما می گوید که فرد به خدا اعتقاد ندارد، اما نمی گوید چرا اعتقاد ندارد. دلیل این بی اعتقادی هرچه که باشد،  اگر کسی به خدا باور نداشته باشد، اتئیست محسوب می شود.

تئیسم را باید آموخت و پذیرفت. اگر فرد هرگز آن را نیاموخته باشد، نمی تواند آن را بپذیرد – و چنین شخصی اتئیست ضمنی می ماند.  اما اگر کسی تئیسم را بیاموزد، اما منکر درستی آن شود، اتئیست صریح خوانده می شود – که  این مطلب ما را به قسم دوم اتئیسم می رساند.

(ب) اتئیست صریح کسی است که خدا را آگاهانه انکار می کند. لازمه ی این انکار آگاهانه ی تئیسم، آشنایی با باور تئیستی است  و گاهی آنتی-تئیسم [= ضدّ-خداباوری]  خوانده می شود.

انگیزه های بسیاری برای اتئیست صریح شدن وجود دارد. برخی از این  انگیزه ها عقلانی اند و برخی نیستند. انگیزه ی اتئیسم صریح شدن می تواند عوامل روانشناختی باشد. ممکن است کسی به این خاطر به خدا بی اعتقاد باشد که از والدین دیندارش متنفر بوده است، یا همسرش کشیش ناحیه را به او ترجیح داده، یا، در سطحی پیشرفته تر، ممکن است شخص احساس کند که زندگی حقیر و بی فایده است، و خدا در چنین جهان تراژیکی هیچ جایی ندارد. انگیزه هایی از این قبیل می توانند از نظر روانشناسی  جالب باشند، اما دخلی به فلسفه ندارند. این انگیزه ها، پایه هایی عقلانی برای اتئیست بودن فراهم نمی آورند، و ما در اینجا آنها را بررسی نخواهیم کرد.

مهم ترین قسم اتئیسم، اتئیسم صریح با گرایش فلسفی است. از دیدگاه این اتئیسم، باور به خدا غیرعقلانی است و به همین خاطر باید آن را منکر شد. از آنجا که این روایت از اتئیسم صریح، بر پایه ی نقد باورهای تئیستی است، بهتر است آن را اتئیسم انتقادی بخوانیم.

اتئیسم انتقادی همچنین فرض های قوی تری دارد، مانند اینکه «خدا وجود ندارد»، یا «وجود خدا ناممکن است.» این اظهارات اغلب درباره ی مفاهیم مشخصی از خدا، مثلاً خدای مسیحیت، مطرح می شود. اتئیسم انتقادی این مفاهیم را پوچ یا متناقض می خواند. همان طور که می توان گفت که «دایره ی مربع» وجود ندارد و ممکن نیست وجود داشته باشد، می توان گفت که اگر خدا مفهومی متناقض باشد، دیگر امکان ندارد وجود داشته باشد.

سرانجام، اتئیست انتقادیی هم هست که از بحث در مورد وجود یا عدم وجود خدا اجتناب می کند، زیرا باور دارد که مفهوم «خدا» قابل فهم نیست. مانند «دیو»، که تا ندانیم چیست، نمی توانیم عاقلانه در مورد وجود آن بحث کنیم.  اگر هیچ توصیف قابل فهمی درکار نباشد، بحث متوقف می شود. به همین ترتیب، اگر هیچ توصیف قابل فهمی از «خدا» در میان نباشد،  باید بحث و جدل را متوقف کرد. به این ترتیب، این  گروه از اتئیست های انتقادی می گوید، «واژه ی  خدا هیچ معنایی برای من ندارد، پس من در مورد این که آیا خدا وجود دارد یا نه، هیچ نظری  ندارم.»

همه ی این اقسام اتئیسم انتقادی در یک مطلب مهم اشتراک دارند: اینکه اساساً نفی گرا هستند. اتئیست بماهو اتئیست، چه صریح باشد و چه ضمنی، هیچ اظهار نظر ایجابی ای نمی کند؛ هیچ ادعایی برای اثبات چیزی ندارد. اگر فقدان باور حاصل ناآشنایی باشد، این بی اعتقادی ضمنی است. اگر فقدان باور ناشی از تأمل انتقادی باشد، بی اعتقادی صریح است. در هر دو حالت، فقدان باور تئیستی هسته ی اتئیسم است. دیدگاه های اتئیستی مختلف تنها از جهت تفاوت علل بی باوری به خدا با هم فرق دارند.

این کتاب از چشم انداز اتئیسم انتقادی نگاشته شده است. برنهاده ی [= تز] اصلی آن این است که باور به خدا نه تنها کاملاً ناموجه است، بلکه دلایل بسیاری برای عدم باور به خدا وجود دارد.  اگر بتوان تئیسم را از طریق فکری شکست داد، زمینه ی باور به خدا فرو می ریزد، و فرد عقلاً مجبور می شود که به خدا باور نداشته باشد – یا به بیان دیگر، وادار به پذیرش اتئیسم می شود.

این کتاب نقد تئیسم به علاوه ی دفاع از اتئیسم نیست: نقد تئیسم خود دفاع از اتئیسم است. اتئیسم فقدان باور به خدا، به علاوه ی داشتن باورهایی ایجابی نیست: اتئیسم فقدان باور به خداست. اگر بتوانیم نشان دهیم که باور به خدا توجیهی ندارد،  چون این باور کاذب یا مهمل است، آنگاه همزمان اعتبار اتئیسم را ثابت کرده ایم. به همین خاطر است که اثبات اتئیسم، ردیّه ای بر خدا است.

5. ژاک ماریتَن و افترا به اتئیسم

تقسیم بندی که در بالا از اتئیسم دیدیم، ساده و بی طرفانه است. این تقسیم بندی با توسل به مضامین اخلاقی به پیش داوری له یا علیه آن نمی پردازد. به نحو مشابه، می توانیم اقسام تئیسم را هم تقسیم بندی کنیم، مثلاً توحید و چندخدایی، بدون اینکه به آنها بار اخلاقی بدهیم. اما، متأسفانه، هنگامی که بحث بر سر نگرشی باشد که شخص شدیداً با آن ضدیّت دارد، گاهی عینیت فدای پیشداوری و عاطفه گرایی می شود. این پدیده هیچ جا بارزتر از نوشته های ژاک ماریتَن،فیلسوف برجسته ی کاتولیک، نیست.

ژاک ماریتَن در کتابش با عنوان گسترده ی عقل، بیش از یک دوجین صفحه را به انواع اتئیسم اختصاص می دهد، و از آنجا که طبقه بندی او وسیعاً مورد استفاده ی دیگر منابع مسیحی (مانند دائرة المعارف کاتولیک) قرار گرفته، وارسی رویکرد او آموزنده است.  ماریتَن نمونه ی خوبی است از برخوردهای غیرمنصفانه ی که الاهیون و فیلسوفان دین مدار با اتئیسم دارند. اگرچه ماریتَن ظاهراً کوشیده است که طبقه بندی منصفانه و بی طرفانه ای از اتئیسم ارائه دهد، طبقه بندی او نشانگر نفرت شخصی اش از اتئیسم است. ماریتَن تحت عنوان طبقه بندی، با نسبت دادن فرومایگی اخلاقی و روانشناختی به اتئیست ها می کوشد  تا حد امکان علیه آنها پرونده سازی کند.

آنچه را که ماریتَن «اتئیسم عملی» می خواند ملاحظه کنید: در طبقه بندی او، اتئیست های عملی «معتقدند که به خدا باور دارند (و … چه بسا در مغز شان چنین باوری داشته باشند)  اما … در واقع با اعمال شان منکر وجود او می شوند.»

اینکه بگوییم مردم «در مغزشان» به خدا باور دارند، طریق گمراه کننده ای برای پذیرش این است که، در حقیقت، آنها وجود ماوراءطبیعت را می پذیرند. با هر تعبیر عاقلانه ای از تئیسم، چنین کسانی تئیست های درست و حسابی محسوب می شوند. می توانیم  بگوییم که آنان تئیست های ریاکاری هستند، ممکن است خود را مسیحی بخوانند اما عملاً به اخلاقیات مسیحی پایبند نباشند – اما چنین افرادی حقیقتاً «در مغزشان»  (یعنی: به عنوان یک موضوع فکری)  به خدا اعتقاد دارند، پس تئیست هستند، فارغ از اینکه اعمال یا باورهای اخلاقی شان چه باشد.

اما ایده ی وجود مسیحیان ریاکار، احساسات ماریتَن را جریحه دار می کند. باور به خدا اخلاقاً خوب است، پس  حتماً تئیستی که استانداردهای اخلاقی معینی را برآورده نکند واقعاً به خدا معتقد نیست. در مورد اینکه چگونه شخص می تواند اتئیست شود، مارتن پاسخ ساده ای می دهد: اگر کسی به قدر کافی بی اخلاق یا ریاکار باشد، مستحق آن است که اتئیست خوانده شود. به این ترتیب، ماریتَن تحت لوای طبقه بندی،  با راندن افراد نامطلوب به اردوگاه اتئیسم، تئیسم محبوبش را تطهیر می کند. زیرا برای  پذیرش انحراف در رفتار  اتئیست ها هیچ مشکلی ندارد. بالآخره، از یک آدم بیخدا چه انتظار دیگری می توان داشت؟

ماریتَن محکومان را به دلیل بی اخلاقی، ریاکاری و دیگر صفات مذموم، «اتئیست عملی» ملقّب می کند. کسانی که به نظر او در هر حال باید اتئیست محسوب شوند. با تعریف ماریتَن، اتئیسم عملی یک زباله دانی مفهومی برای صفاتی است که تئیست ها نمی پسندند؛ اما در حقیقت، این مفهوم پردازی از اتئیسم، یک میل شخصی است که در جامه ی یک مقوله ی فلسفی پوشانده شده است. ماریتنهر چیزی را که  انحراف بداند، «اتئیسم عملی» می خواند.

از دید ماریتَن، یک صورت عمده ی دیگر اتئیسم، «اتئیسم مطلق» است. اتئیست های مطلق «حقیقتاً منکر خدایی هستند که مؤمنان می پرستند… و معتقدند که باید همه ی ارزش هایی را که به نظرشان به خدا مربوط می شود در خود نابود سازند.»

ما پیش تر شمّه ای از اتئیسم مطلق را در تعریف ماریتَن از اتئیسم عملی ملاحظه کردیم. اتئیسم مطلق هم مستلزم قسمی تمایزنهی اخلاقی است. اتئیست مطلق ارزش هایش را دگرگون می کند و درصدد نابود کردن هر چیزی است که او را به یاد خدا اندازد. و چه چیزی ما را به یاد خدا می اندازد؟ اگر حرف ماریتَن را بپذیریم، خدا یادآور هر آن چیزی است که خوب و شایسته است – پس رسیدن به این نتیجه شگفت آور نیست که اتئیسم مطلق، اعلام جنگی می شود علیه خیر و نیکی. به این ترتیب ماریتن نتیجه می گیرد که «اتئیسم مطلق به هیچ روی صرفاً فقدان باور به خدا نیست. بلکه انکار خدا، و جنگ علیه خداست. چالشی است بر ضد خدا. و هنگامی که غلبه یابد، رفتار انسان را از درون دگرگون می کند، به انسان صلابتی بی عاطفه می دهد، انگار که روح آدمی از ماده ی مرده انباشته، و بافت های زنده اش به سنگ بدل گشته باشد.»

از نظر ماریتَن، اتئیسم «عملی» و «مطلق» مقولاتی جامع محسوب می شوند (او قسم سومی به نام «شِبه-اتئیسم» را هم منظور می کند اما با این توضیح که اهمیت چندانی ندارد به کنار می نهد)، لذا یک اتئیسم بالقوه یا باید خود را ریاکار محسوب کند یا کسی که مدام درحال نابود کردن ارزش هاست، و بدین ترتیب خود را مملو از «ماده ی مرده» می کند. البته این آلترناتیو، نه جذاب است و نه دقیق، اما ابزاری به دست ماریتَن می دهد که کمر به نابودی اتئیسم ببندد، بدون اینکه دغدغه ی امور دنیوی بی ارزشی مانند انصاف، دقّت، صداقت روشنفکرانه یا استدلال عقلانی را داشته باشد.

6. اتئیسم چه نیست؟

بسیاری از اسطوره ها درباره ی اتئیسم، مانند آنچه که ماریتَن پیش نهاده، ویژگی هایی به اتئیسم نسبت می  دهند که ربطی به آن ندارند. به همین خاطر، بسیار مهم است که بدانیم اتئیسم چه نیست.

(الف) اغلب می اندیشند که اتئیسم «مستلزم داشتن چیزی است که شیوه ی زیستن خوانده می شود.» یک دیندار می گوید که اتئیسم «نمی تواند صرفاً با نفی جزمیات دینی خشنود شود؛ بلکه باید تصور خود از زندگانی را نیز ایجاد و واقعیتی مثبت را بیان کند.»

هنگامی که تئیست ها اتئیسم را به عنوان یک شیوه ی زیستن مطرح می کنند، همواره آن را زیستنی شرّ یا نامطلوب تصویر می کنند. برعکس، هنگامی که اتئیست ها شیوه ی زندگی مطلوب خود را تشریح می کنند، آن را سودمند تصویر می کنند و نه مضرّ. جوزف لوئیس، یک اتئیست برحسته ی آمریکایی، از سنت آزاداندیشان، می نویسد که اتئیسم » از هر نظام اخلاقی که من تاکنون توانسته ام بشناسم برتر است. اتئیسم ما را مهیای روبرو شدن با زندگی، با همه ی تلخی ها و شیرینی هایش می کند.»  به نظر لوئیس، » اتئیسم یک فلسفه ی دلیر و نیرومند است.»

اتئیسم را یک شیوه ی زندگی دانستن، غلط و گمراه کننده است، چه آن شیوه مفید باشد و چه مضرّ. درست همان طور که فقدان باور به پریان مستلزم داشتن یک نظام زندگانی یا یک دسته اصول نیست، فقدان باور به خدا هم مستلزم داشتن یک نظام فلسفی خاص نیست.  از صِرف این حقیقت که شخصی اتئیست است، نمی توان  استنباط کرد که آن شخص هیچ باور ایجابی خاصی داشته باشد. باورهای ایجابی شخص کاملاً متمایز از موضوع اتئیسم هستند. با اینکه شخص می تواند با آغاز از یک موضع فلسفی پایه، اتئیسم را نتیجه بگیرد، این روند را نمی توان معکوس کرد. نمی توان از اتئیسم شروع کرد و به یک باور فلسفی پایه رسید، زیرا اتئیسم می تواند در نظام های فلسفی بسیار متفاوت و ناهمسازی درج شده باشد ( و چنین شده است).

(ب) عنوان اتئیست نشانگر مخالفت فرد با تئیسم است. این عنوان به منزله ی موافقت با دیگر اتئیست ها، یا تأیید نظرات آنان نیست.

پیوند دادن اتئیست ها با یک دسته باورها، به ویژه  باورهای اخلاقی و سیاسی، به تئیست ها امکان می دهد که اتئیست ها را یک کاسه کنند، و حاصل این می شود که انگار معتقدات یک اتئیست با دیگر اتئیست ها هیچ فرقی دارد. و در اینجا با اتهام بسیار رایج «جُرم توسط تداعی» مواجه می شویم. از آنجا که کمونیست ها مشهور به اتئیسم هستند، برخی اتئیست ها محاجه می کنند که باید میان اتئیست ها و کمونیسم ارتباطی  باشد. نکته در اینجاست که کمونیسم به نوعی پیامد منطقی اتئیسم محسوب می شود، لذا اتئیست مجبور می شود در برابر این اتهام که یک کمونیست نهانی است از خودش دفاع کند.

امروزه دیگر اتهام نابخردانه و بسیار غیرمنصفانه ی پیوند دادن اتئیسم با کمونیسم چندان اقبالی نمی یابد و   دیگر به ندرت کسی جز سیاستمداران محافظه کار  این وصله را به کسی می چسباند. اما گاهی فیلسوفان دینی در تلاش برای بی اعتبار کردن اتئیسم، در اصل همین شیوه را به کار می گیرند. الاهیون عالی مقام، گاهی اتئیسم را با اگزیستانسیالیسم – که تعبیری بدبینانه از وجود طرح می کند – مرتبط می کنند و آنگاه به این نتیجه می رسند که اتئیسم به دیدگاه بدبینانه ای درباره ی جهان منجر می شود. انگار بهترین شیوه ی متقاعد کردن مردم به اینکه اتئیست نشوند، این است که آنان را از اتئیسم بترسانیم.

با اینکه برخی اتئیست ها کمونیست هستند، و برخی هم اگزیستانسیالیست اند، اما این حقیقت هیچ دخلی به اتئیسم یا دیگر اتئیست ها ندارد. ممکن است که یک مسیحی هم، مانند یک اتئیست، به وجود پریان معتقد نباشد – اما این فقدان این باور هیچ وجه مشترک دیگری میان این دو ایجاد نمی کند. در مورد اتئیسم نیز به همین ترتیب است.

درست همانطور که ممکن است که یک تئیست با تئیست دیگر اختلاف نظرهای عمده ای داشته باشد، اتئیست ها هم می توانند بر سر مسائل اساسی با هم اختلاف نظر داشته باشند. یک اتئیست می تواند کاپیتالیست باشد یا کمونیست، عینیت گرای اخلاقی باشد یا ذهنیت گرا، تولید کننده باشد یا انگل، آدم شریفی باشد یا دزد، دارای سلامت روانی باشد یا روان نژند.  تنها چیزی که با اتئیسم ناسازگار است، تئیسم است.

(ج) بسیاری از دینداران، در بحث با اتئیست ها از یک رویه ی عام تبعیت می کنند: اگر همه ی کوشش ها به بن بست رسید، به روانکاوی بپرداز. اگر نتوانستی اتئیست را در قلمرو فکر شکست دهی، روان درمانگر او بشو. با او ابراز همدلی کن، او را از عقده های نهانی اش مطلع کن. عقده هایی که باعث شده اند که خدا را انکار کند. و، مهم تر از همه، به او اطمینان بده که سعادت و خرسندی در کلیسای محل در انتظار اوست.

فیلسوفی از «میل طبیعی بشر به خدا» سخن می گوید. میلی که «اگر ارضا نشود، به نومیدی محض می انجامد.» فیلسوف دیگر اصرار دارد که  اگر مردم تصمیم نگرفتند به خدا ایمان بیاورند، «هر قدر که هوشمند باشند، همان قدر اندوهگین می شوند»، زیرا جهانی بی خدا «به طرز شگرفی فاقد شادیاست.» یک الاهیدان آنقدر پیش می رود که می گوید «انسانِ بیخدا» مستلزم تناقض است.

سَنت جان چریسوستوم  لب مطلب این سنت دور و دراز را در این حکم خلاصه می کند که: «انسان بودن، از خدا خائف بودن است»… خدا، کسی که مؤلف کتاب طبیعت است، جزئی از سرشت آدمی است. بنابراین، می توان گفت  کسی که از خدا نمی ترسد فاقد نوعی وجود است، و سرشت او به نوعی انسانی نیست. از سوی دیگر او انسان است. مشکل در اینجاست.

 

به این ترتیب، اتئیست بودن فوراً بدل می شود به دون انسان بودن – دشنامی بر عرصه ی گیتی بودن، یک پارادوکس متحرک بودن، یا یک مشکل روانشناختی. به قول یک تئیست «بی اعتقادی خللی در بالندگی است.» یک روانشناس تأکید می کند که سلامت روانی «مستلزم داشتن روابط حسنه با خود، با دیگران، و با خداست» – دیدگاهی که به نظر تامس ساتس «همه ی اتئیست ها را شسته رفته در طبقه ی بیماران روانی می نشاند.»

این الگوی غریب برای پیوند دادن خدا و سعادت از این قرار است: هر انسانی بنا به سرشت خود میل به خیر دارد، که موضوع سعادت است. خدا خیر مطلق، و خودبسنده است. بنابراین، هرکسی بنا به سرشت خود میل به خدا دارد، خدایی که جزئی از سرشت انسانی اوست. سعادت منتزع از خدا یک تناقض لغوی است.

از این استدلال مشکوک،  این نتیجه هم حاصل می شود که اتئیست با تعارضات درونی طاقت فرسا دست به گریبان است. او میل به سعادت دارد اما،  با انکار خدا، خود سعادت را نفی می کند. اتئیسم به قسمی با خود، با سرشت خود، در جنگ است – و این وضع او را روان نژند می کند، اگر اسکیزوفرنیک نشود.

این روانشناسی الاهیاتی، فرویدیسم کله پا شده است. در حالی که دینداران از کوشش روانشناسان برای فروکاستن تئیسم به انگیزه های روانی آزرده شده اند، در اعمال همین راهکار برای برتری جستن بر اتئیست ها درنگ نمی کنند. هنگامی که یک تئیست اظهار کند که به وجود ماوراء طبیعت باور دارد، این سخن عیناً از او پذیرفته می شود. اما اگر یک اتئیست اظهار کند که به خدا باور ندارد، اغلب با چنین واکنشی مواجه می شود که: «اوه، جدی که نمی گی!» یا: «متأسفم که اینقدر ناراحت هستی.» یا: «امیدوارم نگرش منفی ات به زندگی تغییر کند.»

همچنین اتئیست درمی یابد که این عدم باورش را به سن اش مربوط می کنند. اگر اتئیست جوان باشد، بی باوری اش را به طغیان جوانی  و ناپختگی او نسبت می دهند – «مرحله» ای که امید می رود به زودی سپری شود. اگر اتئیست میانسال باشد، ریشه ی بی باوری اش را در ناکامی های زندگی روزمره ، تلخی شکست ها، یا بیگانگی از خود و مردم می جویند. اگر اتئیست مسن باشد،  بی باوری  اتئیست با توهم زدگی، کلبی مسلکی و تنهایی، که گاهی همدم سال های آخر عمر است، توضیح داده می شود.

برخلاف آنچه که بسیاری از تئیست ها دوست دارند بیاندیشند، اتئیسم نوعی طغیان عصبی یا بیماری روانی نیست. دینداران نمی توانند با محصور کردن  اتئیست ها در یک آسایشگاه روانی دربسته، شرّ آنها را از جهان کم کنند. برچسب مشکل روانی زدن به اتئیسم ، شانه ی ضعف است، تلاش مضحکی است برای گریز از پرسش های بنیادی در مورد صحت و سقم باور. آیا تئیسم درست است؟ چه دلایلی برای باور به خدا وجود دارد؟این ها پرسش های مهمی هستند که اگر تئیست بخواهد به چالش با اتئیسم بپردازد باید به آنها پاسخ  دهد.

به علاوه، در اینکه سعادت و شادکامی را انگیزه ی باور به خدا می دانند، بی صداقتی عظیمی نهفته است. تئیست هایی که سعادت را پاداش باور به خدا می دانند، به طرز زننده ای به  عقلانیت و پی جویی حقیقت دهن کجی می کنند. حتی اگر تئیسم به سعادت هم منجر می شد (که چنین نمی شود)، آن سعادت شاهدی بر درستی آن نمی بود. بنابراین، روانشناختی کردن اتئیسم،  ربطی به موضوع درستی تئیسم یا اتئیسم ندارد. تئیستی که می کوشد با قرار دادن حقیقت در ذیل عواطف، اتئیسم را شکست دهد، ره به جایی نمی برد، بلکه فقط نشان می دهد که عقل آدمی را خوار می شمرد.

7. اهمیت اتئیسم

می توان ایراد گرفت که ما اتئیسم را به چیز بی مایه ای فروکاسته ایم. در رویکرد ما اتئیسم باوری ایجابی نیست و هیچ اصول سازنده ای  مطرح نمی کند، پس چه ارزشی دارد؟ اگر اتئیسم را بتوان با عدم باور به پریان مقایسه کرد، اهمیت آن در چیست؟ چرا کل یک کتاب را به موضوعی بیهوده اختصاص داده ایم؟

اهمیت اتئیسم به خاطر اهمیت تئیسم است. موضوع خدا، موضوعی پَرت و انتزاعی نیست که تأثیر ناچیزی در زندگی آدمیان داشته باشد. بر عکس، خدا هسته ی ادیان غربی است – به ویژه ادیان سنت یهودی- مسیحی – و شامل نظامی از آموزه هاست که به هر شاخه ی مهمی از فلسفه ارتباط می یابند.

اگر کسی، مثل من، باور داشته باشد که تئیسم نه تنها غلط است، بلکه برای بشر مهلک هم هست، آنگاه گزینش میان تئیسم و اتئیسم اهمیتی شگرف می یابد. اگر تئیسم را صرفاً یک ایده ی انتزاعی بدانیم، می توان آن را بدون بحث و جدل کنار نهاد. اما هنگامی که آن را  زمینه ی مناسب اش بررسی کنیم – درچارچوب مضامین تاریخی، فرهنگی، فلسفی و روانشناختی آن – پرسش از باور به خدا از مهترین موضوعات زمانه ی ما می شود.

اگر هزاران سال پیش، یک فرقه ی پَری- پرست تشکیل شده بود که آموزها و  دینی برمبنای باور به پریان ایجاد می کرد – و اگر این آموزه ها سبب ضایعات گسترده می شدند – آنگاه نام این کتاب می توانست ردّیه ای بر پریانباشد. از نظر تاریخی اما، خدا جاذبه ای بیش از پریان یافته است، پس ما امروزه در عوض ردّ پریان، از ردّیه ای بر خدا بحث می کنیم.

اگرچه اتئیسم ویژگی سلبی دارد، لزوماً مخرّب نیست. هنگامی که اتئیسم برای محو خرافات و اثرات مخرب آن به کار می رود، رویکردی نیکخواه و سازنده می یابد. هوا را پاکیزه می کند، چنان که بود، و در را به روی اصولی مثبت و فلسفه هایی می گشاید که برپایه ی توانایی اندیشه و فهم بشری باشند و نه خرافات.

یک اثر مخرّب دین این است که مفاهیمی حیاتی، مانند اخلاق، سعادت و عشق را بر پایه ی قلمرو ماوراءطبیعتی قرار می دهد که برای ذهن و معرفت بشری دسترسی ناپذیر هستند. اخلاقیات و دین چنان در هم تنیده شده اند که بسیاری از مردم نمی توانند اخلاق طلاق گرفته از خدا را، حتی اصولاً، تصور کنند – و این وضع به این تصور می انجامد که اتئیسم نابودگر اخلاق است.

اتئیسم اما، نابودگر اخلاق نیست؛ نابودگر اخلاقیات ماوراءطبیعی است. به همین ترتیب، ائیسم مخرّب سعادت و عشق هم نیست؛ مخرّب این ایده است که سعادت و عشق حقیقی را تنها در جهان دیگر می توان بدست آورد. اتئیسم این ایده ها را به زمین باز می گرداند، و در دسترس ذهن آدمی می گذارد. آن چه انسان پس از این می تواند بکند، به انتخاب خودش بستگی دارد. اگر کسی بدبینی و نهلیسم را جایگزین آنها کند، مسئولیت این انتخاب بر عهده ی خود اوست، نه اتئیسم.

اتئیسم با طرد هرگونه رجوع به ماوراءطبیعت – که در مورد معرفت آدمی، به معنای امور ناشناختنی است – می خواهد با عقل و فهم انسانی به مسائل بپردازد؛ مسائل بشری را نمی توان به خدایی مرموز وانهاد.

اگر اتئیسم درست باشد، انسان تنهاست. خدایی نیست که به فکر بشر باشد، مراقب اش باشد، و سعادتش را تضمین کند. رسیدن به این اهداف تنها در حیطه ی اختیار خود بشر است. خودش باید به فکر خودش باشد. اگر می خواهد موفق شود، باید کار کند. اگر می خواهد کامیاب باشد، باید برای حصول کامیابی بکوشد. به نظر برخی، جهان بی خدا منظره ی هولناکی است؛ بعضی هم آن را بسیار شاداب می یابند، چالشی طربناک. اینکه شخص چگونه به اتئیسم واکنش نشان می دهد تنها به خودش بستگی دارد – و به میزان خواست او برای پذیرش مسئولیت کنش ها و گزینش هایش.

منبع سایت سکولاریسم برای ایران

سفسطه چیست؟

واژه سفسطه ارتباط ریشه ای با سوفسطائی (Sophistēs) دارد که خود از ریشه سوفوس (Sophos) مشتق شده است که در زبان یونانی به معنی خرد، دانایی و فرزانگی است. سوفسطائی که معرب سوفیست است نیز کسی است که با دانش و خرد و فرزانگی سر و کار دارد یا بعبارت دیگر سوفیسطائی اسم فاعلی است از همان بن سوفوس. سوفسطائی از نظر لغوی همان معنی را میدهد که از واژه فیلسوف اراده میشود یعنی کسی که به مباحث عقلی میپردازد و تفلسف (Philosophize، فلسفه ورزی)  میکند، اما چرا امروزه سوفسطائی یا سوفیست بودن را با فیلسوف بودن یکی نمیدانند؟ این مسئله علتی تاریخی دارد که پیش از طرح آن شایسته است اندکی پیرامون اینکه سوفسطائیان چه کسانی بودند توضیح داده شود.

سوفسطائیان جماعتی بودند که در زمان سقراط  و پیش از او در یونان امروزی زندگی میکردند و ادعای دانایی میکردند. کسانی که خود را سوفیست مینامیدند در فنون مناظره و جدل و سخنوری مهارت داشتند و توان اینرا داشتند که طرف مقابل خود را در مباحث ساکت کنند و به قول معروف سر جایش بنشانند. حال در این راه لازم نبود که به حقیقت چنگ بزنند بلکه صرفاً میتوانستند با حربه های مختلف از جمله حملات شخصی، استفاده از ابزارهای روانی، فریاد زدن، استفاده از واژگان زیبا و قلمبه سلمبه و عوام پسند در هر بحث حتی اگر دانشی نسبت به آن نداشتند پیروز شوند. این افراد را همین امروز نیز میتوان دید، کسانی که علاقه ای به حقیقت ندارند و سعی نمیکنند که از حقیقت دفاع کنند بلکه با هر انگیزه ای سعی میکنند با هر ابزاری که میتوانند از آن دفاع کنند و مخالفان را با استدلالنما های خود شکست دهند.

کار این افراد در یونان باستان بالا گرفته بود بطوری که مدرسه هایی را نیز جهت آموزش این شیوه های جدل و سخنوری به علاقه مندان باز میکردند و مورد احترام مردم نیز قرار میگرفتند و از راه آموزش مهارتهایشان یا استفاده از آنها برای رسیدن به یک هدف از مشتریان پول دریافت میکردند. بعدها فعالیت سوفسطائیان به دادگاه ها هم کشیده شد و گفته میشود که وکالت از آنجا شروع شد که یونانیان باستان دریافتند که میتوانند مقداری پول به سوفسطائیان بدهند و ایشان را به دادگاه بیاورند تا از آنها دفاع کنند و در متهم کردن یا رفع اتهام بواسطه مهارت سوفسطائیان در سخنوری و قانع کردن عوام پیروز شوند. اگر دقت شود معمولاً کار وکلا این است که پولی بگیرند و از موکل خود دفاع کنند و به این کاری ندارند که موکلشان محق است یا نه بلکه تنها هدفشان این است که از موضع موکلشان دفاع کنند.

یک وکیل موظف است و حاضر است از موکل خود دفاع کند حتی اگر بداند موکلش گناهکار است  و این درست در مقابل کار فلاسفه است که میخواهند از حقیقت دفاع کنند و به حقیقت برسند نه از مواضعی که از پیش درست پنداشته میشوند. سوفسطائیان گاه کار را تا جایی پیش میبردند که منکر وجود حقیقت میشدند و میگفتند حقیقت مطلقی وجود ندارد. همین تفاوت در میان فلاسفه و متکلمین در تاریخ تفکر اسلامی نیز وجود دارد، فلاسفه به دنبال یافتن حقایق با استفاده از ادله و برهان بودند و متکلمین به دنبال اثبات دین با استفاده از همان ابزارها.

در همین دوران بود که سقراط پا به عرصه حیات میگذارد. سقراط مردی کوتاه قد و کچل و شکم گنده بود که نمیتوانست یک سوفسطائی خوب باشد، روشن است که سوفسطائی چون کارش متقاعد کردن مخاطب است نه کشف حقیقت، برای انجام کارش نیاز به ظاهری زیبا نیز دارد و سقراط فاقد چنین ظاهری بود. کار سقراط پس از تحصیلات نخستینش که گاه آنرا به دموکرتیوس نسبت میدهند این بود که در کوچه بازارهای یونان باستان راه میرفت و با مردم سخن میگفت و از آنها در مورد آنچه که آنرا درست میپنداشتند و ادعای تبحر و ورزیدگی در آن میکردند پرسش میکرد و آنها را به فکر فرو میبرد و به آنها نشان میداد که آنها آنچه را که مدعی دانستنش هستند در واقع نمیدانند.

دانش به نادانی خود یک دانش است و برای دانستن ضروریست! کتابهایی که افلاطون در مورد سقراط و زندگی اش نوشته است سرشار از شرح گفتگوهای سقراط است با مردم و سوفسطائیان. سقراط باعث میشد که مردم به نادانی خود پی ببرند و از همین رو مردم پس از مدتی سقراط را به دلیل فرزانگی اش سوفیست خطاب میکردند ولی سقراط در مقابل میگفت که من سوفیست (کسی که کارش با فرزانگی و خردورزی در ارتباط است) نیستم بلکه یک فیلسوف (کسی که به فرزانگی و خرد علاقه دارد) هستم. برای درک بهتر این سخن فرض کنید عده ای خود را ورزشکار بدانند و بتوانند وزنه 200 کیلویی را روی سر ببرند، ولی در این میان کسی بیاید و وزنه ای 400 کیلویی را روی سر ببرد و بگوید که من ورزشکار نیستم بلکه ورزش دوست هستم! میتوان تصور کرد که پس از چنین اتفاقی دیگر کسی خود را ورزشکار نخواهد نامید و ورزشکار بودن بیشتر شبیه یک دشنام خواهد شد. سقراط دقیقاً چنین بلایی را بر سر سوفسطائیان آورد،  تواضع سقراط و ادب و واقع بینی او که علی رغم توانایی و دانش خود که میتوانست سوفسطائیان را در بحث ها و مناظره ها شکست دهد و نادانیشان را به آنها اثبات کند ولی با اینحال خود را یک سوفیست نمیدانست بلکه خود را تنها دوست دار خرد میدانست سبب شد که سوفسطائی بودن در طول تاریخ باری منفی پیدا کند و واژه فیلسوف بجای سوفیست استفاده شود.

این تقبیح و تکریه تا جایی ادامه یافت که امروزه و در قرون پس از حیات سقراط  وقتی کسی را سفسطه گر یا سوفسطائی مینامند دیگر منظورشان کسی که فرزانه و اهل خرد است نیست بلکه شخص لفّاظی است که در سخنوری و فنون مناظره مهارت دارد و از واژگان و اسلوب فلسفی و منطقی برای دفاع از یاوه هایی که به هر دلیل به دفاع از آنها مجاب است به کرات سوء استفاده میکند و در اینکار اشتهار دارد و وقتی گفته میشود سخنی یا استدلالی سفسطه آمیز است منظور این است که این سخن علی رغم ظاهرش که سعی شده است شبیه استدلالها و سخنان فلسفی باشد و سیاقی علمی دارد عاری از ارزش حقیقی است و سخنی باطل و در یک واژه «استدلالنما» است.

هر استدلالی را میتوان بصورت چند گزاره که برخی از آنها فرضهای اولیه هستند و یکی از آنها نتیجه یا حکم است و سایر گزاره هایی که نشان میدهند از آن فرضهای اولیه میتوان به این حکم یا نتیجه آخری رسید فرمولیزه یا مرتب کرد. حال پس از مرتب کردن هر استدلال، برای اینکه آن استدلال درست باشد باید مقید به سه شرط زیر باشد:

  1. از الگوی منطقی یا قیاس منطقی درستی پیروی کند (1)
  2. فرضهای درستی داشته باشد
  3. فرضها با هم ارتباط معنایی داشته باشند.

معمولاً بیشتر سخنانی که سفسطه نامیده میشوند «مغلطه» هستند و سخنان سفسطه کنندگان پر از مغالطات منطقی است، به غیر از فرضهای غلط که یک استدلال را باطل، ضعیف و یا فاسد میسازد، کاستیهای یک استدلال را مغلطه گویند یا به عبارت دیگر به دسته ای از استدلالهای غیر منطقی که کاستی ای بجز مورد شرط 2 در بالا داشته باشند را مغالطه آمیز میگویند. مغلطه ها را میتوان به دو گروه رسمی و غیر رسمی دسته بندی کرد:

  • مغلطه های رسمی آن دسته از مغلطه ها هستند که شناخت آنها با نگاه کردن به ساختار منطقیشان میسر است
  • مغلطه های غیر رسمی آن دسته از مغلطه هایی هستند که با نگاه کردن به محتویاتشان و نه ساختارشان میسر است

.  بنابر این هر حرف غیر منطقی ای را نمیتوان مغلطه نامید، بعنوان مثال اگر فرضهای غلطی در یک استدلال دیده شود نمیتوان آنرا مغلطه نامید اما اگر از الگوی منطقی مشخصی پیروی نکند و یا از الگوی مشخصی از مغلطه های رسمی پیروی کند میتوان آنرا مغلطه نامید، بنابر این هر استدلال نادرستی یک مغلطه نیست ولی هر مغلطه ای یک استدلال نادرست است.

مغلطه های رسمی همچون الگوهای منطقی کاملا شناخته شده هستند و آنها را میتوان تقریباً در هر کتابی که در مورد منطق کلاسیک یا منطق صوری نوشته شده است پیدا کرد، این کتابها معمولا بخشی از مطالب خود را به بررسی انواع مغلطه اختصاص میدهند 2.

از آنجا که تارنمای زندیق به رد اسلام میپردازد بخشی از سخنان سفسطه آمیز بسیار رایج در میان مسلمانان را در بخش سفسطه ها جمع آوری و تشریح و رد کرده است.

منابع و توضیحات:

1) الگوهای منطقی یا قیاسهای منطقی را میتوانید در این فایل بیابید. (به زبان انگلیسی)

2) بخش مغالطات منطقی تارنمای زندیق بخشی را به شرح و بررسی مغالطات اختصاص دارد

مهابنگ – بیگ بنگ چیست؟

نوشته : آرش بیخدا

تئوری بیگ بنگ چیره ترین تئوری علمی ای است که در مورد منشاً کائنات وجود دارد. تئوری بیگ بنگ میگوید کائنات چیزی بین 10 تا 20 میلیارد سال قبل (دانشمندان هنوز در حال تلاش برای یافتن این زمان با دقت بیشتر هستند) توسط یک انفجار کیهانی که باعث پرتاب شدن ذرات به جهات مختلف شد بوجود آمد.

یک روحانی بلژیکی به نام جورج لماتره (Georges Lema?re) در سال 1927 برای اولین بار پیشنهاد کرد که کائنات از انفجار اتمهای اولیه پدید آمده است. ادعای وی وقتی جدی تر گرفته شد که ستاره شناسان توانستند خطوط قرمزی در سحاب هایی که در فاصله بسیار زیادی از زمین قرار دارند مشاهده کنند. سالها بعد ادوین هابل (Edwin Hubble) با مشاهده اینکه فاصله بین کهکشانها بصورت متناسب با فاصله ای که از یکدیگر دارند در حال زیاد شدن است  به قوام تئوری لماتره افزود و آنرا بطور جدی تر مطرح کرد.

بیگ بنگ سر انجام وقتی بصورت بسیار جدی تر مطرح شد که توانست جواب قانع کننده ای برای اینکه چرا اجرام آسمانی در حال دور شدن از ما هستند بدهد. این تئوری همچنین وجود تشعشات کیهانی (cosmic background radiation)  را که در واقع همان نورهایی است که از این انفجار بزرگ باقیمانده توجیه میکند. تئوری بیگ بنگ وقتی که این تشعشات در سال 1964 توسط رابرت ویلسون (Robert Wilson) و آرنو پنزیاس (Arno Penzias and Robert Wilson) کشف شدند و این دو دانشمند بخاطر این کشف خود جایزه نوبل را بردند از طرف جامعه علمی جهان تایید شد.

به دلیل تازه بودن فن آوری فضاپیمایی، کیهان شناسی در دوران های سنتی خود به عنوان علمی که فقط جنبه تئوری برای تئوریهای خود دارد به تمسخر گرفته میشد اما دستاوردهای اخیر بشری اجازه آزمایش های دقیق روی تئوریهای مختلف کیهانشناسی و فیزیکی را به دانشمندان این رشته میدهند. سازمان ناسا در سال 1990 سفینه ای با نام مستعار (COBE)  تخفیف یافته از (Cosmic Background Explorer) را به فضا پرتاب کرد تا با اندازه گیری تشعشاتی که از آنها یاد شد تئوری بیگ بنگ را آزمایش کند و ناسا اعلام کرد که تئوری بیگ بنگ سخت ترین آزمایش های ممکن را با موفقیت رد کرده است. این سفینه طیف نوری این تشعشات را با دقت بسیار زیاد مورد بررسی قرار داد و صحت تئوری بیگ بنگ را چنان تایید کرد که دانشمندان حتی از دقت این اطلاعات میتوانند مانند سرعت نور شروع به واحد گذاری در اندازه گیریهای دیگر کنند. منبع +

تصویری از COBE

همانطور که بطور مختصر اشاره شد برای تئوری بیگ بنگ علاوه بر مشاهدات و آزمایش ها دو استدلال اساسی وجود دارد.

  • مشاهده امواج مایکرویو که به سراسر کائنات سرایت کرده اند و از وقتی که کائنات رو به سردی رفت تا وقتی که کاملا شفاف بود در حال سیر در فضا بوده اند.
  • فاصله بین کهکشان ها در فضا در حال افزایش است و این نشان میدهد که این کهکشان ها در لحظه ای قبل تر از حال، فاصله کمتری نسبت به یکدیگر داشته اند، و در نتیجه اگر زمان را به عقب برگردانیم، این کهکشانها به هم نزدیک و نزدیکتر میشوند تا جایی که به یک نقطه میرسند و اگر زمان را به حال خود رها کنیم حالت انفجار (BANG) بزرگ (BIG) را خواهیم دید.

شایان ذکر است در سالهای اخیر عده ای ادعا کرده اند که سرعت این دور شدن بین کهکشان ها در حال افزایش است و این نشان میدهد که دلیل این گسترده شدن نمیتواند یک انفجار باشد، اما این افراد هنوز نتوانسته اند با ارائه اسناد و مدارک و دلایل کافی علمی تئوری بیگ بنگ را بطور جدی زیر سوال ببرند.

بیگ بنگ بعنوان ابتدای کائنات شناخته میشود، تمام کائنات شامل انرژیها و مواد آن در یک ذره کوچکتر از هسته یک اتم گنجانده شده بوده است به زمانی که کائنات در این حالت بوده است زمان یگانگی میگویند. بیگ بنگ علاوه بر ابتدای کائنات، بعنوان ابتدای زمان و فضا در تعریف فیزیکی آن مطرح است. بعد از یک انفجار بزرگ که باعث تریلیونها درجه حرارت شد موادی که بی نهایت چگال بودند (جرم بالا و حجم کم داشتند) در کسر بسیار کوچکی از یک ثانیه در جهات مختلف به اطراف پاشیده شدند.

این مواد بسیار چگال بودند و بصورت سنگهای آسمانی بسیار داغ به اطراف پرتاب شدند. این انفجار ناگهانی باعث بوجود آمدن تمام نمونه های درون اتمی (فوتون ها، الکترون ها، هسته ها و…) شدند که باعث ایجاد ماده و انرژی و زمان و فضا شد و این اتفاق برابر با زمانی بود که ساعت کائنات شروع به کار کرد.

اتفاقاتی که بعد از بیگ بنگ افتاد و زمان دقیق آنها همچون زمان بوجود آمدن عناصر شیمیایی، تشعشعات مایکروویوی که راجع به آنها سخت گفتیم و.. همه بصورت زیر مرتب میشوند.

بلافاصله بعد از بیگ بنگ اندازه کائنات از اندازه هسته یک اتم به چیزی در حدود 10 به توان 35 متر افزایش پیدا میکند. به این اتفاق «Inflationary Epoch» گفته میشود. این حجم حاصله از بیگ بنگ بصورت کاملا قرینه از طرفین دیده میشود.

از 10 به توان -35 ثانیه تا 10 به توان -43 ثانیه ثانیه پس از بیگ بنگ که به «Plank Epoch» معروف است

در این بازه زمانی حرارت ذرات حدود 10 به توان 32 تا 10 به توان 27 درجه کالوین تخمین زده میشود.

از 10 به توان -35 تا 10 به توان -12  ثانیه پس از بیگ بنگ که به «Grand Unification Epoch » معروف است

در این بازه زمانی حرارت ذرات حدود 10 به توان 27  تا 10 به توان 15 درجه کالوین تخمین زده میشود. ذرات شروع به سرد شدن میکنند.

از 10 به توان -12 تا 10 به توان -6 ثانیه پس از بیگ بنگ که به «Electroweak Epoch» معروف است.

در این بازه زمانی حرارت ذرات حدود 10 به توان 15  تا 10 به توان 13 درجه کالوین تخمین زده میشود. ذرات شروع به سرد شدن میکنند و کائنات شکل میگیرد

3 ثانیه بعد از بیگ بنگ، عناصر اولیه شروع به شکل گیری میکنند. اولین چیزی که پدید می آید هسته هیدروژن است. بعد از پدید آمدن هسته های هیدروژن باهم پیوند خردند و هلیوم پدید آوردند. به این پدیده «Nucleosynthesis» گفته میشود.

10,000 سال بعد از بیگ بنگ دوران تشعشعات مایکروویو که از آنها یاد شد. بیشتر کائنات در این زمان همچنان بصورت امواج (نوعی از انرژی) بود. این امواج شامل امواج اشعه ایکس و رادیویی و فرابنفش میشدند

300,000 سال بعد از بیگ بنگ دوران چیرگی ماده بر انرژی (از لحاظ تکثر). در این دوران امواج به طول موجهای بیشتری رسیدند (هرچه طول موج بیشتر باشد مقدار انرژی یک موج کمتر است) و دما حدود 10 هزار درجه کلوین بود. اتمهای لیتیوم در این دوران در حال شکل گیری بودند و الکترونهایی که با هسته های هیدروژن و هلیوم پیوند خوردند نمونه های اتمی پایداری را تشکیل داده بودند.

300 میلیون سال بعد از بیگ بنگ ستاره ها و کهکشانها شروع به شکل گرفتن میکنند. کائنات تا این زمان بصورت یک ابر بسیار بزرگ از گاز بود تا اینکه در این دوران قسمتهای نامتوازن این ابر بزرگ از گاز شروع به جذب  مواد بیشتر کرد و این امر باعث شد این بسته های گازی چگال و چگالتر از گذشته شوند. سر انجام ستاره ها شروع به انفجار کردند (به پایان رسیدن عمر یک ستاره و پایان آنرا سوپرنوا مینامند Supernova پدیده بسیار جالب دیگریست که توضیح آن خارج از این نوشتار است.) و تولد ستاره های جدید شد که مجموعه کثیری از این ستاره ها ایجاد کهکشانها را باعث شد.

وضعیت کائنات بعد از بیگ بنگ

دماهای مختلف بعد از بیگ بنگ

برای بزرگتر شدن این تصویر روی آن کلیک کنید

پدید آمدن این کهکشانهای اولیه حدود 12 تا 15 سال قبل از پدید آمدن منظومه شمسی و کهکشان راه شیری ما بود. کائنات از آن دوران تابحال در حال ایجاد کردن کهکشانها و ستاره ها همچون ستاره ما (خورشید) است.

باید توجه داشت که بیپ بنگ ابتدای وجود کائنات است، نه ابتدای هستی! بحث در مورد اینکه قبل از بیگ بنگ چه اتفاقی افتاده و سوال بسیار رایجی که خداپرستان مطرح میکنند مبنی بر اینکه آن ذره اولیه را چه کسی (!) آنجا قرار داده و یا رد برهان کشکی اثبات وجود خدا از طریق بیگ بنگ را میتوانید در نوشتار های زیر بیابید.

دلیل بیگ بنگ چه بوده است؟ اولین موجود رو کی آفرید؟ چرا یک چیز نمیتواند از ناچیز بوجود بیاید؟

پس دنیا وانسان را که بوجود آورده است؟

رد برهان بیگ بنگ

بعضی از افراد هنگام شنیدن یک تئوری میگویند این که هنوز اثبات نشده است! این افراد که اصولا اطلاعات چندانی راجع به چیستی و چگونگی مفاهیم علمی ندارند، نمیدانند تئوری یعنی چه، در مورد علم و تئوری و… میتوانید در نوشته ای با فرنام علم چیست؟ اطلاعات بیشتری بیابید.

در مقام مقایسه بیگ بنگ و آنچه قرآن در باره پدید آمدن کائنات میگوید و ادعای پوچ مسلمانان مبنی بر اینکه به بیگ بنگ در قرآن اشاره شده است (!) نوشتاری توسط دکتر میرزا روشنگر با فرنام قرآن و پیدایش جهان و همچنین نوشته ای با فرنام بر رسی آفرینش جهان هستی درکلام الله دروغی بزرگتر از جهان هستی توسط آله دال فک  توصیه میشود.

پیامبر چیست؟

یکی از اندیشمندان میگوید «پیامبران اشخاصی هستند که از طرف خدا دروغ میگویند.»

پیامبر اصولا یک پدیده سامی و یهودی است، در هیچ کجای جهان کسی پیدا نمیشد که بگوید یک پیامبر است. پدیده وحی گرفتن یک قضیه مربوط به فرهنگ مردمان سامی است. زرتشتیان زرتشت را یک آموزگار میدانند نه یک پیامبر یا شخصی که از طرف خدا برای وی پیغامهایی ارسال میشده است تا وی آنها را یادداشت کند و به مردم بدهد. بودائیان اصولا یکسره خدا را انکار میکنند و به بیخدایی اعتقاد دارند آنها نیز بودا را یک آموزگار و یک انسان شایسته میدانند که سرزمین خود را در جهت کسب تعالی و انسانیت والاتر ترک کرد. در میان قبایل آفریقایی هیچکس ادعای اینکه از طرف خدا به وی وحی میشود و وی یک پیامبر است نکرده است، بوده اند کسانیکه ادعا کرده اند خود خدا هستند و یا جانشین و یا خدمتگذار خدایانی هستند و آنها را بر روی زمین نمایندگی میکنند (مثل سید علی خامنه ای) اما هرگز کسی در میان این مردمان نیز ادعا نکرده است که از طرف خدا پیغام میگیرد و خدا وی را انتخاب کرده است تا مردم را به سوی او هدایت کند. در میان قبایل سرخپوست های دنیای قدیم نیز چنین پدیده ای هرگز اتفاق نمی افتاد.

پیامبران را میتوان به دو دسته تقسیم کرد

  • پیامبران تخیلی (پیامبرانی که اصولا وجود نداشته اند)
  • پیامبران واقعی (پیامبرانی که واقعا وجود داشته اند)

پیامبران تخیلی، افرادی هستند که تاریخ و علم حکم به عدم وجود آنها میکند. مانند آدم و حوا، نوح، یونس، سلیمان، خضر و حتی عیسی (البته چنانکه گفته خواهد شد مسیحیان هرگز به عیسی نمیگویند پیامبر!) که بسیاری از تاریخ دانان حتی در وجود چنین شخصی بسیار تردید دارند. این دسته از پیامبران اصولا موجودات افسانه ای هستند که یهودیان آنها را از آثار ادبی ملل مختلف بازنویسی کرده اند و اسامی را با اسامی یهودی تعویض کرده اند و خدایان را با خدای یهودی عوض کرده اند و نسخه جدیدی از این داستانها را به شکلی که گویا این افراد واقعا وجود داشته اند بازپردازی کرده اند.

مثلا نوح یک شخصیت تخیلی است که از افسانه های گیلگمش از آثار ملل ساکن بین النهرین  کپی برداری شده است، شرح ماجرا را میتوانید در نوشتاری با فرنام «طوفان نوح، بیشتر شوخی تا جدی!» بخوانید.

یا آدم و حوا از افسانه و اسطوره های زرتشتی «مشیه و مشیانه» کپی برداری شده اند و در ادبیات یهودی جا افتاده اند. منبع +

اگر یهودیان همچنان میخواستند پروژه تبدیل اساطیر به داستنهای پیامبری را ادامه بدهند احتمالا در دوران حاضر از داستانهایی مثل پینوکیو (پیامبری که چوبی بود و به لطف خدا آدم شد) و یا رابین هود (پیامبری که از پولدارها میدزدید  و به فقرا کمک میکرد) میپرداختند.

البته شایان ذکر است گذشته از پیامبران، برخی از سایر موجودات خیالی مانند امام زمان، جبرئیل، فرشتگان، اجنه، شیطان و… نیز ریشه در اساطیر ملتهای باستانی دارند.

البته غیر واقعی بودن این پیامبران به این معنی نیست که هرگز وجود نداشته اند، بعضی از این پیامبران میتوانستند وجود داشته باشند اما بصورت آدمهای معمولی و امروز با مبالغات بسیاری که انجام شده تعریف دیگری از آنها به جای مانده، مثلا سلیمان میتوانسته است که وجود داشته باشد و یک سگ رام شده داشته باشد، اما مذهبیون اعتقاد دارند او بر تمام حیوانات و اجنه (!) فرمانروایی میکرده است، بطور مسلم چنین فردی با چنین تعریفی هرگز وجود نداشته است.

پیامبران واقعی، منظور از کلمه واقعی این نیست که این افراد واقعا پیامبر بوده اند بلکه  دسته دوم از پیامبران در واقع اشخاصی هستند که واقعا وجود داشته اند و تاریخ و علم وجود آنها را انکار نمیکند. مثلا موسی، محمد، باب و بهاالله، صبح ازل و…

همانطور که گفته شد پیامبر اصولا پدیده ای یهودی است و در تمام ادیان فقط یهودیان به این اعتقاد دارند که خداوند انسانهایی را انتخاب میکند و به آنها به اشکالی پیغام میفرستد تا کارهایی را انجام دهند. بازی پیامبری به این شکل بود که هر از چند گاهی یک یهودی اعلام میکرد که پیامبر است و وحی بر وی نازل میشود و عده ای را دور خود جمع میکرد و تعلیماتی میداد و معمولا توسط بقیه یهودیان برای حفظ دین مبین یهودیت (!) از بین میرفت، برای همین است که مسلمانان گاهی یهودیان را پیامبر کش میخوانند. این بازی در میان یهودیان بسیار مشهور بود و بخصوص در دورانی که عیسی ظهور میکند (اگر فرض کنیم چنین اتفاقی افتاده و تفسیر مسیحیان از تاریخ را قبول کنیم) اوج دوران پیامبر بازی بوده است! در هر گوشه و کناری شخصی داعیه پیامبری را میکرده است و افرادی را به سبکی و به نوعی به تقلید و اطاعت از خود و قبول تعاریف جدید از خدای خود دعوت و یا مجبور میکرده است.

این فرم از خدابازی بعدها در میان ملتهای مختلف نیز رواج یافت چنان که در ایران هر از چندگاهی یک شخصی پرچم سبز اسلام را به دست میگرفت و شروع به کشتن مخالفان خود با اتهام بابی بودن و بهایی بودن و مفسد بودن میکرد،در مورد این سیاه کاری ها و جنایات در کتاب ممنوع سه مکتوب از میرزا آقاخان کرمانی به تفصیل سخن رانده شده است.

تمام فرقه های مسیحیت به غیر از فرقه های بسیار اندکی معتقدند که خداوند با دیدن این وضعیت پیامبر بازی پسر خود را روی زمین میفرستد تا کاسه و کوزه این افراد را جمع کند. قرآن مسیح را یک پیامبر میخواند و میگوید کسانی که بگویند مسیح پسر خداست مشرک هستند (سوره توبه آیه 28) و البته به مسلمانان دستور میدهد که با آنها کارزار کنید تا به شما جزیه بدهند و خوار گردند (سوره توبه آیه 29). اگر با انصاف به این ادعای مسیحیان نگاه کنید خواهید دید که در کتاب انجیل (عهد جدید کتب مقدس) که کتاب مقدس آنان است نیز در مورد این قضیه زیاد صحبت شده است و تفاسیر متعدد و جدیدی از مسیحیت امروز مسیحیت را نه یک دین بلکه یک ضد دین و عیسی مسیح را لطف خداوند برای تمام کردن و نابود کرده دین بازی و پیامبر بازی میدانند. در انجیل به وضوح اشاره شده است که عیسی میگوید بعد از من پیامبری نخواهد آمد! مسلمانان میگویند این نشان از تحریف کتاب مسیحیان دارد و سایر ادعاهای مسخره و بچه گانه ای که همه ادیان سامی و بهائیت در دفاع از کتابهای مسخره دینی خود دارند در بین مسیحیان و مسلمانان نیز رواج دارد.

اما چرا محمد با پسر خدا بودن عیسی مخالفت میکند و وی را پیامبر میخواند؟ بسیاری از افراد هستند که اسلام را نسخه دیگری از یهودیت میدانند. مسیحیت یکنوع تعدیل در قوانین یهودیت است، یهودیان زنان بدکاره را سنگسار میکردند و این از قوانین آنها بود (هرچند نزدیک 2000 سال است که سر عقل آمده اند و اینکار را نمیکنند) و عیسی آنها را از این کار منع کرد. خوردن خوشت خوک توسط یهودیان تقبیح میشود اما عیسی خوردن آنرا آزاد میکند، چهره خداوند تورات بسیار خون آشام و خشن و غیر انسانی است و چهره خداوند انجیل بسیار آرام و زیبا. اما محمد باز همان تعاریف یهودی را در دین اسلام بازمیگرداند، بازهم خداوند چهره ای خشن و ضد بشری پیدا میکند، بازهم سنگسار باز هم حرمت برای خوک و…

محمد بسیاری از سنت های یهودی را وارد اسلام میکند اما از سنت های مسیحی چیزی وارد اسلام نمیکند، دلیلش هم بسیار روشن است، چون دسترسی بیشتری به یهودیان داشته است و یهودیان مدینه چون منتظر منجی برای حل اختلافات خود بودند ابتدا بسیار روابط نزدیکی با محمد ایجاد کردند چون فکر میکردند که یکی دیگر از پیامبران یهودی است در حالی که محمد دسترسی به اطلاعات و رسوم مسیحیان نداشت مجبور بود تن به خواهشهای یهودیان در دهد و در مورد عیسی بینشی ضد مسیحی و کاملا یهودی پیش گیرد. بنابر این میبینیم که عیسی بعد از پدید آمدن اختلاف بین محمد و یهودیان بصورت کاملا یهودی در افکار محمد نقش میبندد و یک پیامبر خوانده میشود. شاید بتوان محمد را اولین پیامبر غیر یهودی خواند.

وی پیامبر بازی را که در بین خود اعراب نیز ریشه ای نداشت از یهودیان آموخت و به سبک آنان گفت که من ادامه دهنده تمامی پیامبران که از یهودیان بوده اند هستم.

در  قرآن کتاب قرآن با تورات یکسان معرفی شده است  ( القصص آیه 49 برای بحث مختصری در ا ین مورد مراجعه کنید به اگر میگویید قرآن نوشته بشر است سوره ای مثل قرآن بیاورید!) و همچنین از محمد خواسته شده است که «اگر شک داری در آنچه ما بر تو نازل کرده ایم از خوانندگان تورات بپرس!» (194 سوره یونس) مگر نه اینکه محمد ادعا میکند ادامه رو راه عیسی است؟ چرا نمیگوید از خوانندگان انجیل بپرس؟ چرا تکیه بر کتاب تورات میکند؟ اینها همه نشان میدهد که محمد حتی دسترسی به انجیل نداشته است و به قوام نظریه ای که بیان شد کمک میکند.

بعد از محمد که تنها پیامبر واقعی (با تعریفی که ارائه شد) غیر یهودی باب و بهاء الله هستند که بهائیان اعتقاد دارند روح القدس در وجود آنها وجود داشته و همچون سایر پیامبران، از طرف خدا وحی میگرفته اند. بهائیان ادعا میکنند باب همان امام زمان بوده است برای اطلاعات بیشتر در مورد بهاییت به کتاب » بهائییگری نوشته احمد کسروی» نوشته زنده یاد احمد کسروی مراجعه کنید.

بنابر این دیدی که مسلمانان نسبت به پیامبران دارند کاملا اشتباه است چون:

  • هیچ غیر یهودی ای قبل از محمد حتی ادعا نکرده که پیامبر است.
  • هیچ دینی غیر از یهودیت و مسیحیت و اسلام و بهائیت به موجودی به نام پیامبر اعتقاد ندارند.
  • بیشتر پیامبران اصولا وجود خارجی نداشته اند.

حقوق بشر چیست؟

ترجمه رسمی اطلاعیه جهانی حقوق بشر از تارنمای سازمان ملل متحد تقدیم میگردد.

اعلامیه جهانی حقوق بشر

مقدمه
از آنجا که شناسایی حیثیت ذاتی کلیه اعضای خانواده بشری و حقوق یکسان و انتقال نا پذیر آنان اساس آزادی ، عدالت و صلح را در جهان تشکیل می دهد.از آنجا که عدم شناسایی و تحقیر حقوق بشر منتهی به اعمال وحشیانه ای گردیده است که روح بشریت را به عصیان واداشته و ظهور دنیایی که در آن افراد بشر در بیان عقیده آزاد واز ترس و فقر فارغ باشد به عنوان بالاترین آمال بشر اعلام شده است ، از آنجا که اساسا حقوق انسانی را باید با اجرای قانون حمایت کرد تا بشر به عنوان آخرین علاج به قیام بر ضد ظلم و فشار مجبور نگردد. از آنجا که لازم است توسعه روابط دوستانه بین الملل را مورد تشویق قرار داد ،
ماده 1
تمام افراد بشر آزاد به دنیا می آیند و از لحاظ حیثیت و حقوق با هم برابرند . همه دارای عقل و وجدان می باشند و باید نسبت به یکدیگر با روح برادری رفتار کنند .

ماده 2
هر کس می تواند بدون هیچ گونه تمایز ، خصوصا از حیث نژاد ، رنگ ، جنس ، زبان ، مذهب ، عقیده سیاسی یا هر عقیده دیگر و همچنین ملیت ، وضع اجتماعی ، ثروت ، ولادت یا هر موقعیت دیگر ، از تمام حقوق و کلیه آزادی هایی که در اعلامیه حاضر ذکر شده است ، بهره مند گردد. به علاوه هیچ تبعیضی به عمل نخواهد آمد که مبتنی بر وضع سیاسی ، اداری و قضایی یا بین المللی کشور یا سرزمینی باشد که شخص به آن تعلق دارد . گواه این کشور مستقل ، تحت قیمومیت یا غیر خود مختار بوده یا حاکمیت آن به شکل محدودی شده باشد.

ماده 3
هر کس حق زندگی ، آزادی و امنیت شخصی دارد .

ماده 4
احدی را نمی توان در بردگی نگه داشت و داد و ستد بردگان به هر شکلی که باشد ممنوع است.

ماده 5
احدی را نمی توان تحت شکنجه یا مجازات یا رفتاری قرار داد که ظالمانه و یا بر خلاف انسانیت و شئون بشری یا موهن باشد.

ماده 6
هر کس حق دارد که شخصیت حقوق او در همه جا به عنوان یک انسان در مقابل قانون شناخته شود.

ماده 7
همه در برابر قانون ، مساوی هستند و حق دارند بدون تبعیض و بالسویه از حمایت قانون برخوردار شوند.همه حق دارند در مقابل هر تبعیضی که ناقض اعلامیه حاضر باشد و بر علیه هر تحریکی که برای چنین تبعیضی به عمل آید به طور تساوی از حمایت قانون بهره مند شوند.

ماده 8
در برابری اعمالی که حقوق اساسی فرد را مورد تجاوز قرار بدهد و آن حقوق به وسیله قانون اساسی یا قانون دیگری برای او شناخته شده باشد ، هر کس حق رجوع به محاکم ملی صالحه دارد .

ماده 9
احدی نمی تواند خود سرانه توقیف ، حبس یا تبعید بشود.

ماده 10
هر کس با مساوات کامل حق دارد که دعوایش به وسیله دادگاه مساوی و بی طرفی ، منصفانه و علنا رسیدگی بشود و چنین دادگاهی درباره حقوق و الزامات او یا هر اتهام جزایی که به او توجه پیدا کرده باشند، اتخاذ تصمیم بنماید.

ماده 11
1- هر کس به بزه کاری متهم شده باشد بی گناه محسوب خواهد شد تا وقتی که در جریان یک دعوای عمومی که در آن کلیه تضمین های لازم برای دفاع از تامین شده باشد ، تقصیر او قانونا محرز گردد.2- هیچ کس برای انجام یا عدم انجام عملی که در موقع ارتکاب ، آن عمل به موجب حقوق ملی یا بین المللی جرم شناخته نمی شده است محکوم نخواهد شد . به همین طریق هیچ مجازاتی شدیدتر از آنچه که در موقع ارتکاب جرم بدان تعلق می گرفت درباره احدی اعمال نخواهد شد.

ماده 12
احدی در زندگی خصوصی ، امور خانوادگی ، اقامتگاه یا مکاتبات خود نباید مورد مداخله های خود سرانه واقع شود و شرافت و اسم و رسمش نباید مورد حمله قرار گیرد . هر کس حق دارد که در مقابل این گونه مداخلات و حملات ، مورد حمایت قانون قرار گیرد.

ماده 13
1- هر کس حق دارد که در داخل هر کشوری آزادانه عبور و مرور کند و محل اقامت خود را انتخاب نماید.2- هر کس حق دارد هر کشوری و از جمله کشور خود را ترک کند یا به کشور خود باز گردد.

ماده 14
1- هر کس حق دارد در برابر تعقیب ، شکنجه و آزار ، پناهگاهی جستجو کند و در کشورهای دیگر پناه اختیار کند.2- در موردی که تعقیب واقعا مبتنی به جرم عمومی و غیر سیاسی و رفتارهایی مخالف با اصول و مقاصد ملل متحد باشد ، نمی توان از این حق استفاده نمود.

ماده 15
1- هر کس حق دارد ، که دارای تابعیت باشد.2- احدی را تمی توان خود سرانه از تابعیت خود یا از حق تغییر تابعیت محروم کرد.

ماده 16
1- هر زن و مرد بالغی حق دارند بدون هیچ محدودیت از نظر نژاد ، ملیت ، تابعیت یا مذهب با هم دیگر زناشویی و هنگام انحلال آن ، زن و شوهر در کلیه امور مربوط به ازدواج دارای حقوق مساوی می باشند.2- ازدواج باید با رضایت کامل و آزادانه زن ومرد واقع شود.3- خانواده رکن طبیعی و اساسی اجتماع است و حق دارد از حمایت جامعه و دولت بهره مند شود.

ماده 17
1- هر شخص ، منفردا یا به طور اجتماعی حق مالکیت دارد.2- احدی را تمی توان خود سرانه از حق مالکیت محروم نمود.

ماده 18
هر کس حق دارد که از آزادی فکر ، وجدان و مذهب بهره مند شود .این حق متضمن آزادی تغییر مذهب یا عقیده و ایمان می باشد و نیز شامل تعلیمات مذهبی و اجرای مراسم دینی است . هرکس می تواند از این حقوق یا مجتمعاً به طور خصوصی یا به طور عمومی بر خوردار باشد.

ماده 19
هر کس حق آزادی عقیده وبیان دارد و حق مزبورشامل آن است که از داشتن عقاید خود بیم و اضطرابی نداشته باشد و در کسب اطلاعات و افکار و در اخذ و انتشار آن ، به تمام وسایل ممکن و بدون ملاحضات مرزی، آزاد باشد.

ماده 20
1- هرکس حق دارد آزادانه مجامع و جمعیت های مسالمت آ میز تشکیل دهد.2- هیچ کس را تمی توان مجبور به شرکت در اجتماعی کرد.

ماده 21
1- هر کس حق دارد که در اداره امور عمومی کشور خود ، خواه مستقیما و خواه با وساطت نمایندگانی که آزادانه انتخاب شده باشد شرکت جوید.2- هر کس حق دارد با تساوی شرایط ، به مشاغل عمومی کشور خود نایل آید.3- اساس و منشا قدرت حکومت ، اراده مردم است . این اراده باید به وسیله انتخاباتی ابراز گردد که از روی صداقت و به طور ادواری ، صورت پذیرد .انتخابات باید عمومی و با رعایت مساوات باشد و با رای مخفی یا طریقهای نظیر آن انجام گیرد که آزادی رای تامین نماید.

ماده 22
هر کس به عنوان عضو اجتماع حق امنیت اجتماعی دارد و مجاز است به وسیله مساعی ملی و همکاری بین المللی ، حقوق اقتصادی ، اجتماعی و فرهنگی خود را که لازمه مقام و نمو آزادانه شخصیت اوست با رعایت تشکیلات و منابع هر کشور به دست آورد.

ماده 23
1- هر کس حق دارد کار کند. کار خود را آزادانه انتخاب نماید ، شرایط منصفانه و رضایتبخشی برای کار خواستار باشد و در مقابل بیکاری مورد حمایت قرار گیرد.2- همه حق دارند که بدون هیچ تبعیضی در مقابل کار مساوی ، اجرت مساوی دریافت دارند.3- هر کس که کار میکند به مزد منصفانه و رضایت بخشی ذیحق می شود که زندگی او و خانواده اش را موافق شئون انسانی تامین کند و آن را در صورت لزوم با هر نوع وسایل دیگر حمایت اجتماعی، تکمیل نماید.4- هر کس حق دارد که برای دفاع از منافع خود با دیگران اتحادیه تشکیل دهد و در اتحادیه ها نیز شرکت کند.

ماده 24
هر کس حق استراحت و فراغت و تفریح دارد و به خصوص به محدودیت معقول ساعات کار و مرخصی های ادواری ، با اخذ حقوق ذیحق می باشد.

ماده 25
1- هرکس حق دارد که سطح زندگی او ، سلامتی و رفاه خود و خانواده اش را از حیث خوراک ومسکن ومراقبتهای طبی و خدمات لازم اجتماعی تامین کند و همچنین حق دارد که در مواقع بیکاری ، بیماری ، نقص اعضا ، بیوگی ، پیری یا در تمام موارد دیگری که به علل خارج از اراده انسان ، وسایل امرار معاش از بین رفته باشد از شرایط آبرومندانه زندگی برخوردار شود.2- مادران وکودکان حق دارند که از کمک و مراقبت مخصوصی بهره مند شوند . کودکان چه براثر ازدواج و چه بدون ازدواج به دنیا آمده باشند ، حق دارند که همه از یک نوع حمایت اجتماعی برخوردار شوند.

ماده 26
1- هر کس حق دارد که از آموزش و پرورش بهره مند شود . آموزش و پرورش لااقل تا حدودی که مربوط به تعلیمات ابتدایی و اساسی است باید مجانی باشد . آموزش ابتدایی اجباری است . آموزش حرفه ای باید عمومیت پیدا کند و آموزش عالی باید با شرایط تساوی کامل ، به روی همه باز باشد تا همه ، بنا به استعداد خود بتواند از آن بهره مند گردند.2- آموزش و پرورش باید به طوری هدایت شود که شخصیت انسانی هر کس را به حد اکمل رشد آن برساند و احترام حقوق و آزادی های بشری را تقویت کند . آموزش و پرورش باید حسن تفاهم ، گذشت و احترام عقاید مخالف و دوستی بین تمام ملل و جمعیت های نژادی یا مذهبی و همچنین توسعه فعالیت های ملل متحد را در راه حفظ صلح ، تسهیل نماید.3- پدر و مادر در انتخاب نوع آموزش و پرورش فرزندان خود نسبت به دیگران اولویت دارند.

ماده 27
1- هر کس حق دارد در زندگی فرهنگی اجتماع شرکت کند ، از فنون و هنرها متمتع گردد و در پیشرفت علمی و فوائد آن سهیم باشد.2- هر کس حق دارد از حمایت منافع معنوی و مادی آثارعلمی ، فرهنگی یا هنری خود برخوردار شود.

ماده 28
هر کس حق دارد برقراری نظمی را بخواهد که از لحاظ اجتماع و بین المللی ، حقوق و آزادی هایی راکه در این اعلامیه ذکر گردیده ، تامین کند و آنها را به مورد عمل بگذارد.

ماده 29
1- هرکس در مقابل آن جامعه ای وظیفه دارد که رشد آزاد کامل شخصیت او را میسر سازد.2- هر کس در اجرای حقوق و استفاده از آزادی های خود ، فقط تابع محدودیت هایی است که به وسیله قانون ، منحصرا به منظور تامین شناسایی و مراعات حقوق و آزادی های دیگران و برای مقتضیات صحیح اخلاقی و نظم عمومی و رفاه همگانی ، در شرایط یک جامعه دموکراتیک وضع گردیده است.3- این حقوق و آزادی ها ، در هیچ موردی نمی تواند بر خلاف مقاصد و اصول ملل متحد اجرا گردد.

ماده 30
هیچ یک از مقررات اعلامیه حاضر نباید طوری تفسیر شود که متضمن حقی برای دولتی یا جمعیتی یا فردی باشد که به موجب آن بتواند هر یک از حقوق و آزادی های مندرج در اعلامیه را ازبین ببرد ویا در آن راه فعالیتی بنماید

کپی شده از:

http://www.unhchr.ch/udhr/lang/prs.htm

برای سنجش سازگاری اسلام با حقوق بشر از فصل هفتم کتاب اسلام و مسلمانی نوشته ابن وراق به برگردانی دکتر مسعود انصاری مراجعه کنید.

تازی چیست؟

زندیق نام بخش قرآن را تازینامه، چهارده معصوم را چهارده تازی، و حمله اعراب به ایران را تازش خوانده است.

واژه «تازی»‌ همان «عرب»‌ است در پارسی و استفاده از آن نژادپرستانه نیست. مگر اینکه فردوسی، ناصر خسرو، مختاری، خاقانی، نظامی را همگی جملگی نژاد پرست بدانیم.

از فرهنگ دهخدا:

تازی. (ص نسبی، اِ) عربی باشد. (برهان ) (آنندراج ) (انجمن آرا) (شرفنامه ٔ منیری ). عرب، کسی که درعربستان میماند. (فرهنگ نظام ). وجه اشتقاق : فرزانه بهرام بن فرزانه فرهاد تاز، نام یکی از پسران سیامک بوده و تازیان از نسل اویند و از بعضی تواریخ نیز چنین معلوم میشود که تاز پسرزاده ٔ سیامک بن میشی بن کیومرث بوده و پدر جمله ٔ عرب است و نسب تمام عرب به تاز میرسد چنانکه نسب همه ٔ عجم به هوشنگ شاه میرسد. (آنندراج ) (انجمن آرا)… و در سراج اللغات نوشته که تازیبمعنی عربی و این منسوب به تاز است چون لفظ تاز بمعنی تازنده نیز آمده و در اوائل اسلام عربان تاخت و تاراج بسیار در ایران کرده اند،بدین جهت نسبت به تاز کرده. (غیاث اللغات ). بعضی حدس زده اند که تازیاصلاً بمعنی چادرنشین است، از کلمه ٔ تاژ و تاز بمعنی چادر و خیمه و یاء نسبت، و همیشه آن را مقابل دهقان آرند. پس دهقان بمعنی روستانشین و تازی بمعنی چادرنشین است، طوائف چادرنشین که ییلاق و قشلاق کنند، مقابل دهقان که ساکن و تخته قاپو باشد. طبق این حدس کلمه ٔ مورد بحث بار اول بمعنی مطلق چادرنشین بوده است و سپس بمعنی خاص تری فقط بر عرب اطلاق شده است. مردم چین عرب را تاش نامند و این تاش مأخوذ ازکلمه ٔ فارسی تاژی یا تازیست که بمعنی چادرنشین است و این نشان میدهد که مردم چین در اول عرب را بتوسط ایرانیان دریانورد و تجار برّی ایران شناخته اند. مرحوم بهار در سبک شناسی آرد: ایرانیان از قدیم بمردم اجنبی «تاچیک » یا «تاژیک » می گفته اند، چنانکه یونانیان «بربر» و اعراب «اعجمی » یا «عجم » گویند. این لفظ در زبان دری تازه، «تازی » تلفظ شد و رفته رفته خاص اعراب گردید، ولی در توران و ماوراءالنهر لهجه ٔ قدیم باقی و به اجانب «تاچیک » میگفتند و بعد از اختلاط ترکان آلتایی با فارسی زبانان آن سامان، لفظ «تاچیک » بهمان معنی داخل زبان ترکی شد و فارسی زبانان را «تاجیک » خواندند و این کلمه بر فارسیان اطلاق گردید و ترک و تاجیک گفته شد. (سبک شناسی ج 3 ص 50 حاشیه ٔ 1). تازی یعنی عرب و گویا آن شکل فارسی کلمه ٔ طائی یعنی منسوب به قبیله ٔ طی باشد و بموجب شهرت این قبیله از بابت تسمیه ٔ کل به اسم جزء، طایی به تمام عرب گفته شده (در تاریخ نظایر این زیاد است ). ما ایرانیان تمام یونان را بنام یک قبیله آن ملت (یونیام ) نام نهادیم و کلمه ٔ پارسه هم وقتی نام یک قسمت و یک طایفه ٔ ایران بوده و بعد از طرف یونانیها و عرب بتمام ایران اطلاق شد یعنی یونانی «پرسیا» و عرب «فرس » گفت. یونان را رومیها بنام یک قبیله ٔ یونان که بین آنها معروف بوده «گیرسیا» نام دادند. (لغات شاهنامه تألیف رضازاده ٔ شفق ).
دکتر محمّد معین در حاشیه ٔ برهان آرد: از تاز+ ی (نسبت ) در پهلوی تاژیک . ایرانیان قبیله ٔ طی از قبایل یمن را که با آنان تماس بیشتر داشتند (در عهد انوشیروان، یمن مستعمره ٔ ایران شد) «تاژ» و منسوب بدان را «تاژیک » می گفتند و سپس این اطلاق را بهمه ٔ عرب تعمیم دادند، چنانکه یونانیان و رومیان «پرسیا» (پارس ) و عرب «فرس »را بهمه ٔ ایرانیان اطلاق کردند و ایرانیان «یونان » را بنام قبیله ٔ «یون » در آسیای صغیر، بهمه ٔ قوم هلاس اطلاق کردند – انتهی. رجوع به تاجیک و تاز و تازک و تاژ و تازیک شود. جمع تازی، «تازیان » آید : واندر وی (شهر هری ) تازیانند بسیار. (حدود العالم ).
صدواندساله یکی مرد غرچه
چرا شصت وسه زیست این مرد تازی.

ابوطیب مصعبی (از تاریخ بیهقی ).

مر آن خانه را داشتندی چنان
که مر مکه را تازیان این زمان.

دقیقی.

وزان پس چو آگاهی آمد ز راه
ز نعمان تازی و فرزند شاه.

فردوسی.

چنان بد که از تازیان صدهزار
نبرده سواران نیزه گذار.

فردوسی.

فریدون فرخ که او از جهان
بدی دور کرد آشکار و نهان
ز بد دست ضحاک تازی ببست
بمردی ز چنگ زمانه نجست.

فردوسی.

که خضرا نهادند نامش ردان
همان تازیان نامور بخردان.

فردوسی.

ز تازی و هندی و ایرانیان
ببستند پیشش کمر برمیان.

فردوسی.

سر مرد تازی بدام آورید
چنان شد که فرمان او برگزید.

فردوسی.

سواران تازی سوی نیمروز
گسی کرد و خود رفت گیتی فروز.

فردوسی.

دو تازی دو دهقان ز تخم کیان
که بستند بر دایگانی میان.

فردوسی.

ز دهقان و تازی و پرمایگان
توانگرگزید و گران مایگان.

فردوسی.

نباشند یاور ترا تازیان
چو از تو نیابند سود و زیان.

فردوسی.

برفتند نعمان و منذر بهم
همه تازیان یمن بیش و کم.

فردوسی.

ببخشد بهای سر تازیان
که بر گنج او زین نیاید زیان.

فردوسی.

از آنجا به کرخ اندر آمد سپاه
هم از پارسی هم ز تازی براه.

فردوسی.

سپهدار تازی سر راستان
بگوید بدین بر یکی داستان.

فردوسی.

که جز مرگ را کس ز مادر نزاد
ز دهقان و تازی و رومی نژاد.

فردوسی.

بدان ای سر مایه ٔ تازیان
کز اختربوی جاودان بی زیان.

فردوسی.

که مستحق تراز او ملک را و شاهی را
ز جمله ٔ همه شاهان تازی و دهقان.

فرخی.

نهاد خوب و ره مردمی از او گیرند
ستودگان و بزرگان تازی و دهقان.

فرخی.

هرکس به عید خویش کند شادی
چه عبری و چه تازی و چه دهقان.

فرخی.

گویی که بیکباره دل خلق ربوده ست
از تازی و از دهقان وز ترک و ز دیلم.

فرخی.

ز عنبر بر مهش چنبر، ز سنبل بر گلش چوگان
دلش چون قبله ٔ تازی رخش چون قبله ٔ دهقان.

قطران.

چنو گردنکشی گردون برون نارد بصد دوران
نه از رومی نه از تازی نه از توران نه از ایران.

قطران.

بدو گفت تازی جوان عرب
ز کنعان همی رانده ام روز و شب.

شمسی (یوسف و زلیخا).

سواران تازنده را نیک بنگر
درین پهن میدان ز تازی و دهقان.

ناصرخسرو (دیوان ص 318).

چه چیز است این و پیدایی چه چیز است آن و پنهانی
چه گفته ست اندرین تازی چه گفته ست اندرین دهقان.

ناصرخسرو.

جهان را دیده ای و آزمودی
شنیدی گفته ٔ تازی و دهقان.

ناصرخسرو (دیوان ص 313).

چون بازنجویی که اندرین باب
تازیت چه گفت و چه گفت دهقان.

ناصرخسرو (دیوان ص 331).

مأمون آن کز ملوک دولت اسلام
هرگز چون او ندید تازی و دهقان.

ابوحنیفه ٔ اسکافی.

گهی فرستد خلعت بقبله ٔ تازی
گهی بسوزد بت را بقبله ٔ دهقان.

مختاری.

برمک مردی بود از فرزندان وزرای ملوک اکاسره مردی بزرگوار بوده و از آداب تازی و پارسی بهره داشت. (تاریخ بخارا).
ای ز تیغ تو در سرافرازی
ملک ترکی و ملت تازی.

انوری (از آنندراج ).

خانه خدایش خداست لاجرمش نام هست
شاه مربعنشین تازی رومی خطاب.

خاقانی.

دید مرا گرفته لب آتش فارسی ز تب
نطق من آب تازیان برده به نکته ٔ دری.

خاقانی.

ریاضت تو چنان باد ملک ترکی را
که هم عنان برود با شریعت تازی.

ظهیر (از شرفنامه ٔ منیری ).

موی بمویت ز حبش تا طراز
تازی و ترک آمده در ترکتاز.

نظامی.

که سعدی راه و رسم عشقبازی
چنان داند که در بغداد تازی.

سعدی (گلستان ).

|| زبان تازی. زبان عربی. (برهان ) (غیاث اللغات ) :
نبشتن یکی نه که نزدیک سی
چه رومی چه تازی و چه پارسی.

فردوسی.

اگر پهلوانی ندانی زبان
بتازی تو اروند را دجله خوان.
فردوسی (از لغت فرس چ اقبال ص 87).
زبانها نه تازی و نه خسروی
نه رومی نه ترکی و نه پهلوی.

فردوسی.

«اما صحا» به تازیست و من همی
بپارسی کنم اما صحای او.

منوچهری.

بر او خواند شعری به الفاظ تازی
بشیرین معانی و شیرین زبانی.

منوچهری.

… و چون به شهر نزدیک رسید حاجبی و بوالحسن کرخی ندیم و مظفر حاکم ندیم که سخن تازی نیکو گفتندی…پذیره شدند و رسول را به اکرامی بزرگ در شهر آوردند. (تاریخ بیهقی چ ادیب ص 288). خواجه ٔ بزرگ فصلی سخن گفت بتازی سخت نیکو در این معنی. (تاریخ بیهقی چ ادیب ص 291). نسخت بیعت و سوگندنامه را استادم بپارسی کرده بود، ترجمه ای راست چون دیبا و روی همه ٔ شرایط را نگاه داشته، به رسول عرضه کرد و تازی بدو داد تا می نگریست… پس دوات خاصه پیش آوردند و در زیر آن بخط خویش تازی و فارسی عهدنامچه که از بغداد آورده بودند… نبشت. (تاریخ بیهقی چ ادیب ص 295 و چ فیاض ص 292). بونصر از صف بیرون آمد و بتازی رسول را بگفت تا برپای خاست و آن منشور در دیبای سیاه پیچیده پیش امیربرد. (تاریخ بیهقی ایضاً ص 377). و متنبّی در مدح وی بر چه جمله سخن گفته است که تا در جهان سخن تازیست ،آن مدروس نگردد و هر روز تازه تر است. (تاریخ بیهقی ایضاً ص 391). ایستادم دو نسخت کرد این دو نامه را چنانکه وی توانستی یکی بتازی سوی خلیفه و یکی بپارسی به قدرخان. (تاریخ بیهقی ). خواستم که اهل عراق… را از آن نصیبی باشد و بلغت تازی که زبان ایشان است، ترجمه کرده آید. (تاریخ بیهقی ).
همی نازی بمجلسها که من تازی نکو دانم
ز بهر علم قرآن شد عزیز ای بی خرد تازی.

ناصرخسرو.

و بتازی بانگ آن را ضریرالماء گویند. (فارسنامه ٔ ابن البلخی ص 144). ابن المقفع آن را از زبان پهلوی بلغت تازی ترجمه کرد. (کلیله و دمنه ). و هرکه بی وقوف در کاری شروع نماید همچنان باشد که گویند مردی می خواست که تازی آموزد… (کلیله و دمنه ). او را گفت از جهت من از لغت تازی چیزی بر آن بنویس. (کلیله و دمنه ).
بربط اعجمی صفت هشت زبانش در دهان
از سر زخمه ترجمان کرده بتازی و دری.

خاقانی.

از دو دیوانم بتازی و دری
یک هجا و فحش هرگز کس ندید.

خاقانی.

چون بتازی و دری یاد افاضل گذرد
نام خویش افسر دیوان به خراسان یابم.

خاقانی.

کمال و دانش او کور دید وکر بشنید
بنظم و نثرچه در پارسی چه در تازی.

ظهیر.

و آن کتاب از تازی بفارسی نقل کردم.(ترجمه ٔ تاریخ یمینی ).
تازی و پارسی و یونانی
یاد دادش مغ دبستانی.

نظامی.

زان سخنها که تازی است و دری
در سواد بخاری و طبری.

نظامی.

– امثال :
فارسی گو گرچه تازی خوشتر است .
من از بغداد می آیم تو تازی میگویی .
تازی زبان ؛ لسان عربی. (آنندراج ) :
یکی ترک تازی زبان آمدستم
بمهمان پی عشرت و زیج و بازی.

سوزنی.

به سیم و به می کرد خواهم من امشب
بر آن ترک تازی زبان ترکتازی.

سوزنی.

تازی زبان شدن ؛ افصاح. (تاج المصادر بیهقی ). عروبیة. (تاج المصادر بیهقی ).
تازی کردن سخن پارسی ؛ اعراب. (تاج المصادر بیهقی ).
تازی گوی ؛ متکلم بزبان عربی. عرب.
|| (من باب ذکر حال و اراده ٔ محل ) عربستان :
سپه کشیده چه از تازی و چه از بلغار
چه ازبرانه چه از اوزگند و از فاراب.

عنصری.

رجوع به تازیان شود. || و از اسب تازی اسب عربی مراد است. (برهان ). و اسب عربی را نیز اسب تازی گویند و اسب تازی لاغرتر از اسب ترکی است. (آنندراج ) (انجمن آرا). و اسب معروف. (شرفنامه ٔ منیری ). بمعنی اسب تازی. (غیاث اللغات ). گاه از «تازی » مطلق همین معنی مراد است :
همان گاو دوشان بفرمانبری
همان تازی اسبان همچون پری.

فردوسی.

از اسبان تازی به زرین ستام
ورا بود بیور که بردند نام.

فردوسی.

ورا دید بر تازئی چون هزبر
همی تاخت در دشت برسان ببر.

فردوسی.

تبیره سیه کرده و روی پیل
پراکنده بر تازی اسبانش نیل.

فردوسی.

ز اسبان تازی به زین پلنگ
ز برگستوانها و خفتان جنگ.

فردوسی.

فروماند اسبان تازی ز تگ
توگفتی در اسبان نجنبید رگ.

فردوسی.

به اسب تازی هرگز چگونه ماند خر؟

عنصری.

اگر بیند، خداوند دویست تازی خیاره از اسبان قوی بدهد، تا کار نیک برود. (تاریخ بیهقی چ ادیب ص 636).
بسست این که گفتمْت کافزون نخواهد
چو تازی بود اسب، یک تازیانه.

ناصرخسرو.

چه تازی خر به پیش تازی اسبان
گرفتاری بجهل اندر گرفتار.

ناصرخسرو.

ای گشته سوار جلدبر تازی
خر پیش سوار علم چون تازی ؟

ناصرخسرو.

در هر زمین که راه نوردی هوای آن
از سم ّ تازیان تو مشکین غبار باد.

مسعودسعد.

روز هیجا که مرکبان گردند
زیر پای مبارزان تازی.

انوری (از آنندراج ).

صریر خامه ٔ مصری میانه ٔ توقیع
صهیل ابرش تازی میانه ٔ هیجا.

خاقانی.

تازیانش کابل و بلغار دارند آبخور
گرد پی زان سوی نیل و عسقلان افشانده اند.

خاقانی.

از سر تیغش چو داغ تازیان
ران شیران را نشان ملک باد.

خاقانی.

صهیل تازیان آتشین جوش
زمین را ریخته سیماب در گوش.

نظامی.

بنعل تازیان کوه پیکر
کنند آن کوه را چون کان گوهر.

نظامی.

وز بختی و تازی تکاور
چندانک نداشت خلق باور.

نظامی.

تازی اسبان پارسی پرورد
همه دریاگذار و کوه نورد.

نظامی.

خرامان گشته بر تازی سمندی
مسلسل کرده گیسو چون کمندی.

نظامی.

برق کردار بر براق نشست
تازیش زیر و تازیانه بدست.

نظامی.

روزی بپای مرکب تازی درافتمش
گر کبر و ناز بازنپیچد عنان دوست.

سعدی.

چو آب میرود این پارسی بقوت طبع
نه مرکبی است که از وی سبق برد تازی.

سعدی.

گفتم عنان مرکب تازی بگیرمش
لیکن وصول نیست بگرد سمند او.

سعدی.

به اسبان تازی و مردان مرد
برآر از نهاد بداندیش گرد.

(بوستان ).

اسب تازی اگر ضعیف بود
همچنان از طویله ٔ خر به.

(گلستان ).

نخواهد اسب تازی تازیانه.

شبستری.

– امثال :
به تازی میگویدبگیر به آهو میگوید بدو.
تازی خوب وقت شکار بازیش می گیرد.
تازی را بزور بشکار نتوان برد.
صد من گوشت شکار به یک ناز تازی نمی ارزد.
تازی سوار؛ سوار اسب تازی. یکه تاز. چابک سوار :
خر خود را چنان چابک نبینم
که با تازی سواری برنشینم.

نظامی.

تازی فرس ؛ اسب تازی :
گر لاشه خر من افتد از پای
تازی فرس تو باد برجای.

نظامی.

تازی نژاد ؛ از نژاد عرب :
حبّذا اسبی محجّل مرکبی تازی نژاد
نعل او پروین نشان و سم ّ او خاراشکن.

منوچهری.

من از حاتم آن اسب تازی نژاد
بخواهم گر او مکرمت کرد و داد.

سعدی (بوستان ).

– نوعی از بهترین اقسام سگ شکاری . سگ تازی. و تازی سگ، نوعی از سگ شکاری باشد. (برهان ). و نوعی از سگ شکاری را که نسبت به سگان دیگر لاغرتر است، نیز تازی گویند. (آنندراج ) (انجمن آرا). و بمعنی سگ شکاری. (غیاث اللغات ).یک قسم سگ شکاری که لاغر و پاهای دراز دارد، تازی نامیده میشود، گویا نسل سگ مذکور از عربستان آمده، تازینامیده شد یا از جهت زیاد دویدن و تاختن تازی نامیده شده. (فرهنگ نظام ) :
چوکعبه است بزمش که خاقانی آنجا
سگ تازی پارسی خوان نماید.

خاقانی.

بنده خاقانی سگ تازی است بر درگاه او
بخ بخ آن تازی سگی کش پارسی خوان دیده اند.

خاقانی.

عوّا ز سماک هیچ شمشیر
تازی سگ خویش رانده بر شیر.

نظامی.

چند برانی چو سگ از در مرا
من سگ کوی تو ولی تازیم.

حافظ حلوایی.

|| (فعل ) بمعنی تاخت آری هم است. (برهان ). تاخت کنی. (شرفنامه ٔ منیری ) :
چه تازی خر به پیش تازی اسبان
گرفتاری بجهل اندر گرفتار.

ناصرخسرو.

ای گشته سوار جلد بر تازی
خر پیش سوار علم چون تازی ؟

ناصرخسرو.

تازی. (اِخ ) بقول ابن بطوطه شهری به مراکش بمشرق فاس.


تأزی. [ ت َ ءَزْ زی ] (ع مص ) تأزی عنه ؛ بازگشت از وی. (منتهی الارب ). نَکَص َ. (اقرب الموارد) (قطر المحیط). || تأزی القدح ؛ رسیدن تیر در شکارو جنبیدن در آن. || ازاء (مصب آب در حوض )برای حوض ساختن. (از اقرب الموارد) (منتهی الارب ) (ناظم الاطباء) (از قطر المحیط). رجوع به تأزیة شود.

آتئیسم، بیخدایی، یا الحاد چیست؟

شخصی که به آتئیسم اعتقاد دارد آتئیست نامیده میشود، آتیئست را به فارسی بیخدا، خداناباور، ملحد، منکر و … ترجمه کرده اند.

آتئیست کسی است که اعتقاد دارند خداوند وجود ندارد. برای اینکه اثبات کنیم چیزی وجود دارد باید:

  1. اگر دلیل یا دلایلی برای وجود آن چیز وجود دارد  آنها را باید رد کرد و اشکالهای آنها را نشان داد
  2. دلیلی را برای عدم وجود آن چیز استدلال و  اثبات کرد

به همین ترتیب آتئیست ها نیز برای اثبات دکترینشان باید:

  1. تمام براهین و دلایلی را که برای اثبات وجود خدا آورده میشود رد کنند (که ما اینکار را در بخش سفسطه انجام میدهیم)
  2. دلایلی برای اثبات عدم وجود پدیده ای به نام خدا بیاورند

اصولا انعکاس اعتقاد به خداوند در افکار را میتوان به سه دسته اساسی تقسیم کرد

  1. تیست ها (Theists) کسانیکه اعتقاد دارند خدا وجود دارد، و میتوان وجود وی را اثبات کرد.
  2. آتئیست ها (Atheists) کسانیکه اعتقاد دارند خدا وجود ندارد و عدم وجود وی را میتوان اثبات کرد.
  3. اگناستیک (Agnostics) کسانیکه اعتقاد دارند خدا را نمیتوان اثبات کرد، این دسته میتوانند به وجود خدا اعتقاد داشته یا نداشته باشند.

همچنین مراجعه کنید به:

تکامل چیست؟

نوشته آرش بیخدا

پیشگفتار:

تکامل یک مبحث بسیار گسترده و بزرگ در رشته زیست شناسی است و نوشتن در ارتباط با آن در تارنمایی که ارتباطی با رشته های علمی ندارد بسیار دشوار است، زیرا از طرفی مطالب نباید بسیار عمیق و پیچیده و فنی باشند، و از طرف دیگر نباید بسیار سطحی باشند. هدف از نوشتن این نوشتار بیشتر یک مقدمه است برای آشنایی با تئوری تکامل و رفع شدن سوء تفاهماتی که دین خویان در مورد تکامل ایجاد کرده اند، و همچنین بررسی کوتاهی از درگیری های موجود میان دین و بویژه اسلام با تئوری تکامل است، نه شرح و توضیح علمی و کامل نظریه تکامل. علاقه مندان میتوانند برای مطالعه بیشتر در مورد تکامل به بخش زیست شناسی کتابخانه دانشگاه های شهری که در آن زندگی میکنند مراجعه کنند. توصیه میکنم علاوه بر کتابهایی در مورد تکامل، بدنبال کتابهایی در مورد داستان آدم و حوا و خلقت انسان نیز بگردید. مطمئناً اگر کتابی در این زمینه پیدا کنید در بخش افسانه ها و داستانهای ننه قمر خواهد بود نه در بخش بیولوژی. آخرین بار که من برای مطالعه در مورد تکامل به کتابخانه رفتم دست خالی برگشتم زیرا انبوه کتابهای نوشته شده در مورد هر بخش کوچکی از تکامل، انتخاب یک کتاب را برای من بسیار دشوار کرده بود و من فرصت جستجوی طولانی را نداشتم.

در این نوشتار ابتدا تاریخچه کوتاهی از تکامل و نقش داروین در تئوری تکامل را بیان خواهم کرد و سپس به تعریف تکامل خواهم پرداخت، بعد از آن تکامل را از نگر رابطه آن با وجود خدا و دین بررسی خواهم کرد و اندکی به برخوردهای میان دین خویان و تکامل خواهم پرداخت و بعد هم چند شبهه عوامانه بسیار رایج از تکامل را مطرح کرده و پاسخ خواهم داد.

تاریخچه مختصری از تکامل و نقش داروین در تکامل:

تکامل یعنی اینکه انسانها از نسل میمون ها هستند. این ابتدائی ترین و خام ترین برداشتی است که ممکن است شخصی از تکامل داشته باشد و متاسفانه تنها اطلاعی که بسیاری از دین خویان از تکامل دارند همین است، که یک آدمی به نام داروین پیدا شده است و ثابت کرده است انسانها قبلاً میمون بوده اند. متاسفانه این برداشت نابخردانه تنها بین دین خویان و خرد باختگان که انتظاری بیش از این هم از آنها نمیرود رایج نیست، بلکه کسانی که بیخدا هستند نیز برخی اوقات چنین نظراتی را اعلام میکنند.

دوست کمونیست و کردی برای من تعریف میکرد که برای «هدایت» رهبر یکی از احزاب کردستان با او جلسه ای گذاشته بودند و میخواستند به او اثبات کنند که «انسانها از نسل میمون هستند»، او به آنها با درشتی برخورد کرده بود و گفته بود نه! کرد ها از نسل شیرند.

در بیان تاریخچه مختصری از تکامل باید گفت که داروین نخستین کسی نیست که تکامل را کشف کرد، هزاران سال پیش از داروین تئوری تکامل در افسانه ها و اسطوره های برخی از ملت ها وجود داشته است، مثلا هندو ها معتقد بوده اند حیات از آب شروع شده است و اولین موجودات ابتدا در آب شکل گرفتند و بعد به سایر موجودات تبدیل شدند. بعدها دانشمندان و فلاسفه ای مثل تالس تکامل را بصورت فرضیه های طبیعی برای توضیح علمی حیات مطرح کردند اما بررسی علمی و دقیق تکامل در دوران اخیر شکل گرفته است. پیش از داروین چند دانشمند دیگر مانند لامارک شخصی که زیست شناسی را به معنی امروزی اش بنا نهاد نیز در مورد تکامل مطالعاتی داشتند و نظریاتی را نیز ارائه داده بودند.  تفاوت اصلی میان نظریه تکامل لامارک با نظریه داروین در این بود که داروین تکامل را امری گروهی و مربوط به گونه های جانوری میداند ولی لامارک آنرا امری انفرادی میدانسته است، اما با این وجود، این داروین است که  پدر تکامل خوانده میشود زیرا درک مدرن ما از تکامل به تئوری گزینش طبیعی بر میگردد که چارلز داروین و آلفرد راسل والاس آنرا در سال 1858 در کتاب «مشاء انواع یا ریشه گونه ها» (Origin of species) مطرح کردند.

تعریف گزینش طبیعی:

بر اساس نظریه گزینش طبیعی، طبیعت موجوداتی که ویژگیهای مساعد برای نجات یافتن و ادامه حیات و تکثیر شدن را دارند را حفظ میکند و موجوداتی که این ویژگی ها و صفات را نداشته باشند تدریجا منقرض میشوند.

گزینش طبیعی در قیاس با گزینش مصنوعی نامگذاری شده است که در آن انسانها گونه خاصی از جانداران را که مورد نظر آنها است انتخاب میکنند و آنها را تکثیر میکنند، مثلا کشاورزان گندم را گزینش کرده و به تکثیر آن کمک میکنند و یا دامداران گاو را گزیده و با پرورش دادن آن به ادامه حیات و تکثیر آن یاری میرسانند، داروین معتقد بود طبیعت نیز چنین میکند، و موجوداتی که بتوانند خود را با شرایط زیستی همساز کنند احتمال ادامه یافتن حیاتشان از باقی جانداران بیشتر خواهد شد و برعکس، یعنی طبیعت نیز بصورت استعاره ای همچون آن کشاورز که گزینش مصنوعی میکند، موجوداتی را انتخاب میکند و باعث گسترش آنها میشود. مفهوم گزینش طبیعی همان تولید مثل افراقی است، یعنی بعضی از اعضای یک گونه بیش از سایر اعضا تولید مثل میکنند و در نتیجه میزان بیشتری از ژن آنها به نسل بعدی انتقال می یابد. گزینش طبیعی از مرکزی ترین یا شاید هم مرکزی ترین نکاتی است که بیولوژی امروزه بر روی آن تمرکز دارد.

داروین با بررسی آناتومی استخوان بدن جانورانی که جمع آوری کرده بود به این نتیجه رسید که شباهت بسیار زیادی در طرز شکل گیری این ساختمان استخوانها وجود دارد و در مورد انسان اعلام کرد که آناتومی بدن انسان با آناتومی بدن بوزینه (و نه میمون، ساختمان بدن میمون و گوریل و شامپانزه و بوزینه علی رغم تشابه ظاهری بسیار متفاوت است) بسیار شبیه است و نتیجه گرفت که انسان و بوزینه از یک تیره و از یک منشع تکاملی هستند (نه اینکه انسان قبلا بوزینه بوده است)، یعنی به تعبیری پسر عموهای یکدیگر هستند. نکته جالب این است که کلمه اورانگوتان که ریشه مالزیایی دارد به معنی «مرد جنگلی» است. داروین حدود 20 سال از انتشار تئوری خود، خودداری کرد و بعد از تحقیقات بسیار آنرا انتشار داد. خود کتاب داروین از آثار بسیار جالب علمی است، خواندن کتاب او به همه کسانی که علاقه مند به چنین موضوعاتی هستند توصیه میشود.

تکامل امروز با آنچه داروین کشف کرده بود بسیار متفاوت است و مانند هر موضوع دیگری دستخوش تغییرات گسترده شده است و خود تکامل یافته است. بنابر این داروین نخستین کاشف تکامل نیست، بلکه از کسانی است که بیشترین خدمت را به بیولوژی در این زمینه کرده است، داروین مبتکر نظریه گزینش طبیعی است و نظریه او از نظریاتی است که انقلابی را در دنیای علم راه انداختند.

تکامل چیست:

اگر  تاریخ زمین را بصورت یک تقویم 30 روزه از ابتدای بوجود آمدن زمین تا به امروز تصور کنیم. هر روز آن 150 میلیون سال خواهد بود. خواهیم دید که اولین سیستمهای زنده در روز  4ام این تقویم که برابر خواهد بود با تقریبا 4 میلیارد سال پیش بوجود آمدند. اولین سیستمهای زنده در واقع بسیار زود بدنیا آمدند. قدیمیترین فسیلهایی که یافت شده است در حدود 3.1 میلیارد سال پیش (27 امین روز) بوجود آمدند. بر اساس این تقویم اولین انسانهای واقعی چیزی حدود 10 دقیقه آخر این تقویم به دنیا آمدند و تاریخ ثبت شده بشری که به دوران سومری ها باز میگردد حدود 30 ثانیه آخری این تقویم را اشغال میکند. به این تقویم، تقویم زمین شناسی گفته میشود که نمونه ای بسیار مختصر از آن در زیر آمده است. علامت سوال به این معنی است که در دقت این روز در زمین شناسی تردید وجود دارد.

 تقویم زمین شناسی Geological Calander.منبع این اطلاعات یکی از کتابهای دانشگاهی رشته بیولوژی با مشخصات زیر است:

Life on Earth (Second Edition)Authors: Willson, Eisner, Briggs, Dickerson, Metzenberg, O’Brien, Susman, Boggs.
دوران ARCHEOZIC
دوران PROTEROZOIC
دوران PALEOZOIC
دوران MESOZOIC
دوران CENOZOIC
1 2
3 4اولین نظام زنده؟ 5 6 7اولین سلول؟ 8باکتری 9سرخسهای سبز و آبی
10قدیمیترین فسیلها(FIG TREE CHERT) 11 12 13 14 15 16
17 18 19 20 21 22 23
24اولین سلولهای EUCARYOTIC 25اولین حیوانات 26 27حیات آبزی(فسیلهای فراوان یافت شده است) 28اولین گیاهان روی خشکیاولین مهره داراناولین حیوانات روی خشکیاولین دوزیستان 29جنگلهای زغالی انبوهحشرات 30دایناسورها و اولین پرنده هااولین گیاهان گلدار
اولین پستانداران  و چیرگی خزندگان چیرگی پستانداران


حال

همانطور که در این تقویم نیز مشخص است، گونه های مختلف جانوری همگی به یکباره پا به زمین نگذاشته اند، بلکه به تدریج گونه های جدیدی در روی زمین بوجود آمده اند. وجود تک سلولی ها بر روی سیاره ای با شرایط مساعد برای حیات همچون زمین کافی است تا به بوجود آمدن پر سلولی ها، نرم تنان، بی مهرگان، دو زیستان، پستانداران و در نهایت انسان بیانجامد. این تقویم تنها موجوداتی که پا به روی زمین گذاشته اند را نشان میدهد، جالب است بدانید دانشمندان معتقدند تعداد گونه های جانوری که هم اکنون بر روی زمین وجود دارند کمتر از یک دهم 1% تمام گونه های جانوری است که تابحال روی زمین زیسته اند.  باید توجه داشت که تئوری تکامل به نحوه پیدایش حیات و تک سلولی های نخستین ارتباط چندانی ندارد، بلکه به چگونگی ادامه حیات ارتباط دارد، برای توضیح چگونگی شکل گیری حیات تئوریهای دیگری همچون آزمایش میلر یولر مورد بررسی قرار گرفته اند. حال تکامل نظریه ای است که میتواند به ما در فهم اینکه چگونه گونه های جانوری جدید بر روی زمین پدیدار میشود و برخی جانداران نیز از روی زمین محو میشوند کمک میکند.

تعریف تکامل:

تکامل در بیولوژی، به پروسه ای اطلاق میشود که بر اساس آن، جمعیت گونه ها با ویژگیهای برتر وراثتی افزایش می یابند و از نسلی به نسل بعدی منتقل میشوند. در طول زمان این ویژگیها به گونه جانوری کمک میکنند که به تعداد بیشتری نسبت به گونه های رقیب تکثیر بیابند و در جمعیت بر آنها تسلط بیابند. اتفاق افتادن این پروسه در مدت های طولانی میتواند پدید آمدن موجودات جدید را توضیح دهد.

بر اساس تئوری تکامل موجودات جدید تر همگی اجداد مشترکی دارند، و برای نشان دادن این شراکت در اجداد، معمولا از درختواره های فیلوژنتیکی (Phylogenetic tree) استفاده میشود، بعنوان مثال درختواره زیر (برای بزرگ شدن روی آن کلیک کنید) ارتباط حیوانات با گیاهان و سایر موجودات را نشان میدهد.

منبع تصویر + (تارنمای دانشگاه ایالت فلوریدا)

فسیلهای باقیمانده از اجداد انسانها به خوبی نشان میدهد که ساختار بدن آنها با بدن انسانهای امروزی بسیار متفاوت هستند و اکتشافات در این مورد بسیار گسترده بوده است و شاید آخرین آنها کشف آدمها با ساختمان بدنی کوچکتر و جمجمه کوچکتر اشاره کرد که در اکتبر 2004 در جزیره فلورز یافت شد (منبع خبر +) اما امروز بالاخره با پیشرفت ژنتیک دیگر نیازی به پیدا کردن استخوان ها و فسیل ها برای اثبات تئوری تکامل وجود ندارد، پیشرفت علوم مارا برای بررسی تکامل از یافتن فسیل ها و باقیمانده های جانوران تقریباً بی نیاز میکنند، هرچند گنجینه بسیار غنی از فسیلها امروز از لحاظ شهودی نیز راه را برای مشاهده تکامل جانوران بسیار هموار میکند.

یافته ها در مورد فسیل ها بسیار پرارزش هستند اما باید توجه کرد که باقی ماندن یک جانور بصورت فسیلی امری بسیار نادر است چون معمولاً شرایط بسیار خاص و دقیقی باید شکل بگیرد که جانوری بصورت فسیل باقی بماند، مثلاً جسد آن جانور باید بر اثر اتفاقات خاصی در لجن مدفون شده باشد و هزاران عامل دیگر باید وجود داشته باشند که از جانوری فسیل باقی بماند. بنابر این ایرادی که برخی از دین خویان به تکامل وارد میکنند، مبنی بر اینکه فسیل های کافی برای اثبات تکامل یافته نشده است، حتی اگر چنین فرضی را درست فرض کنیم نیز ایرادی معتبر نخواهد بود.

همانطور که گفته شد توسعه و پیشرفت در ژنتیک درهای جدیدی را برای فهم تکامل باز کرده است، بگونه ای  که امروز مطالعات ژنتیکی پایه درک ما از تکامل هستند، یعنی بهترین توضیحات و توجیهات را برای بررسی موضوعات مختلف در ارتباط با تکامل را میتوان از دیدگاه ژنتیکی دریافت کرد. اطلاعات ژنتیکی که دستورالعمل های ساخت سلول هستند را امروز میتوان در هر موجودی مانند یک کتاب باز کرد و خواند. و همین تحقیقات ژنتیکی امروز نشان میدهد که 99% ژنهای انسان و بوزینه کاملا مشترک هستند و تفاوت بیولوژیکی میان انسانها و بوزینه ها در همان 1% است که باهم اختلاف دارند، بنابر این تحقیقات امروزی هم تئوری داروین را که با بررسی و مشاهده استخوانهای جانوران توسعه یافته بود، تایید میکنند. برای توضیح بیشتر در این مورد ابتدا باید اندکی با DNA آشنا شویم. در مورد DNA بطور مفصل در نوشته ای با فرنام (بنیاد و شالوده حیات، حیات چگونه آغاز میشود ؟) توضیحات کافی داده شده است و در اینجا تنها بطور مختصر در مورد آن توضیحاتی داده خواهد شد.

DNA یک مولکول بلند است که از زنجیره ای از واحدهای کوچکتر بیوپولیمر (واحدهای مرکبی که در سلول های زنده پیدا میشوند، مانند پروتئین ها، اسید نوکلئید ها و یا کربوهیدراتها ) تشکیل شده اند. اگر تمام DNA های انسان در کنار هم قرار گیرند و انتهایشان به ابتدای دیگری متصل شود رشته ای به طول تقریبی 175 سانتیمتر ضخامتی کمتر از یک میلیونیم سانتیمتر حاصل میشود. اگر ضخامت و طول این رشته را بصورت متناسب به ضخامت یک رشته سیم ویولون افزایش دهیم، طول رشته به حدود 9 مایل خواهد رسید. در درون سلول این مولکولهای بلند دو به دو با هم پیچ میخورند و یک RNA را تشکیل میدهند. این رشته ها بوسیله پیوند هایی شیمیایی ای متشکل از فسفر و نوعی قند که بین این دو رشته وجود دارد به هم پیوسته میشوند. این پیوندها در واقع از یک بدنه و یک پایه تشکیل شده اند،  دو نوع پایه در این پیوند ها وجود دارد که پورین و پریمیدین نامیده میشوند. هر کدام از این دو نوع پایه خود دو نوع دیگر دارند، این پایه ها با توجه به نوع مواد شیمیایی بکار رفته در آنها دسته بندی شده اند.

  • پورین ها (Purines) خود به  دو دسته دیگر تقسیم میشوند:

1. آدنین (Adenine) که با حرف A نمایش داده میشوند.

2. گانین  (Guanine) که با حرف G نمایش داده میشوند.

  • و پریمیدین ها (Pyrimidines) نیز خود به دو دسته دیگر تقسیم میشوند:

3. تیمین (Thymine) که با حرف T نمایش داده میشوند.

4. سیتوزین (Cytosine) که با حرف C نمایش داده میشوند.

بنابر این ما 4 نوع پایه داریم که اینها یک سیستم عددی مبنای 4 را برای تبادل اطلاعات بین مولکول ها بر عهده دارند.  بنابر این اطلاعات DNA یک موجود را میتوان همچون رشته ای از اطلاعات صفر و یک کامپیوتری (مبنای دو که تمام دستگاه های دیجیتال از آن استفاده میکنند) همچون کتابی خواند، با این تفاوت که الفبای  DNA تنها از 4 حرف تشکیل شده است. بعنوان مثال رشته زیر را میتوان حاوی اطلاعاتی دانست که از سلولی به سلول دیگر منتقل شده است.

ATAATTCGTTCAAGGGCTATATGCCGTTTAAAACGT

واحد های تولید کننده و نوع مواد تشکیل دهنده DNA تقریباً در تمامی موجودات روی کره زمین (به استثنای چند ویروس که مواد دیگری DNA آنها را تشکیل میدهند) مشترک و دقیقا شبیه یکدیگر هستند. این موضوع خود نشان میدهد که تمامی این DNA ها ریشه های مشترک دارند و از یک جا برخاسته اند و از DNA اولیه ای که شکل گرفته است مشتق شده اند. اما بطور مشخص و واضحی اطلاعات DNA یک انسان سیاه پوست با یک انسان سفید پوست تفاوت هایی دارد و میان DNA یک انسان با یک گیاه تفاوت های بسیار بیشتری وجود دارد و یا اطلاعات میان DNA یک انسان و یک بوزینه 99% مشابه یکدیگر است. و البته میان DNA افرادی که از یک خانواده هستند تفاوت اطلاعات بسیار ناچیز تر است از تفاوت DNA بین دو غریبه. میان DNA زن و مرد نیز تفاوت هایی وجود دارد.  تشابه میان اطلاعات ژنتیکی انسان و بوزینه نظریه داروین مبتنی بر ارتباط انسانها و بوزینه ها را که از روی مشاهده فیزیولوژیکی بدن بوزینه انجام گرفته بود تایید میکند. بطور کلی برای نشان دادن اینکه انسان چگونه تکامل یافته است، دو درختواره توصیه میشود، که هر دو آنها را میتوانید در زیر ببینید.

میمون اورانگوتان گوریل بوزینه انسان
میمون اورانگوتان گوریل بوزینه انسان

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

همانگونه که گفته شد تکامل ارتباط مستقیمی با ژنتیک دارد، DNA در واقع دستور العمل های مهندسی ای را داراست که دستور العمل ساخت سلول را به مهندس های موجودات زنده یعنی پروتئین ها منتقل میکند و پروتئین ها با دقت تمام این دستور العمل ها را پیاده میکنند و نتیجه یک سلول با فعالیت دقیقاً مشخص و با ظرافت تمام است. همانطور که نوشته های الفبای مبنای 32 زبان فارسی از نقطه ها و کلمات و فاصله ها تشکیل شده است، الفبای مبنای 4 ژنتیکی نیز از حالت مشابهی پیروی میکنند و الفبای خاص خود را دارند.

همانطور که گفته شد DNA ها خود نیز از پروتئین های کوچکتری که خود متشکل از آمینو اسید ها هستند ساخته شده اند و تعداد کل انواع آمینو اسید ها در سلولهای بدن 20 نوع است. در یک زبان مبنای 4 برای نامیدن هرکدام از این 20 نوع آمینو اسید تنها 3 حرف نیاز است و 64  (4 * 4 * 4) کلمه 3 حرفی مختلف را میتوان با ترکیب این الفبای چهار حرفی ژنتیکی تشکیل داد. اما در موجودات زنده تنها از 16 نوع کلمه سه حرفی متشکل از این حروف الفبای مبنای 4 استفاده میشود که به هر کدام اصطلاحا کودون (Codon) میگویند. شکل زیر این مفهوم را به تصویر کشیده است.

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

هر کدام از این کودون ها معنی مشخصی دارند و همه آنها امروز شناخته شده اند و معانی آنها نیز تفسیر شده است. بعضی از این کودون ها نقش آغاز و پایان یک پیغام ژنتیکی را بازی میکنند. شکل این پایه ها بگونه ای است که تنها میتوانند با پایه مشخصی توسط پیوند های هیدروژنی ترکیب شوند و ارتباط برقرار کنند، مثلا هروقت در یک شاخه A وجود داشته باشد، حتماً باید در طرف دیگر T وجود داشته باشد. پیوستن A با C مانند این است که کسی تلاش کند یک دوشاخه را به یک پریز که سه سوراخ دارد وصل کند، این اتفاق غیر ممکن نیست اما بسیار دشوار است و بسیار کم اتفاق می افتد.

A با T پیوند میخورد

C با G پیوند میخورد

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

این است که در واقع وقتی سلولی میخواهد تکثیر شود، در بین دو رشته ای که اطلاعات DNA آنرا تشکیل میدهند شکافی ایجاد میشود. چون A تنها با T و C تنها با G ارتباط برقرار میکند، این دو رشته از هم شکافته شده دقیقا اطلاعات مشترکی را حمل میکنند و مانند این است که قرینه یکدیگر باشند، بعد ازجدا شدن این دو شاخه وقتی DNA جدید درون فضایی پر از انواع و اقسام آمینو اسید ها قرار میگیرد به سرعت جفت های خود را جذب میکند، و دوباره به یک شکل نردبان پیچ خورده دو شاخه ای مانند آنچه قبلا در سلول قبلی بوده است تبدیل میشود و در این پروسه است که دستور العمل های ساخت سلول از سلولی به سلول دیگر منتقل میشوند. اطلاعات ترتیب یافته به سبک اطلاعات ژنتیکی در واقع حاوی تمام مشخصات موجود جدیدی است که باید شکل گیرد، این اطلاعات در میان تمام جانوران از والد به فرزند انتقال می یابند و در بدن فرزند دوباره شبیه سازی میشود.

حال بصورت تصادفی و بر اثر برخی علت های دیگر گاهی اوقات این اطلاعات ژنتیکی بواسطه یک جهش ژنتیکی تغییر پیدا میکنند. اگر جهش ژنتیکی وجود نداشته باشد تمامی موجودات دقیقاً شبیه یکدیگر خواهند بود. این تغییرات ژنتیکی یکی از عوامل تکامل هستند و عامل دیگر نیز شرایط زیستی در محیطی است که این جانداران در آن زندگی میکنند. تغییرات زیست محیطی باعث میشوند موجوداتی که سازگارتر با محیط هستند نجات پیدا کنند و موجوداتی که سازگاری با محیط ندارند نابود شوند. برای اینکه این مسئله بهتر درک شود به مثالی توجه کنید:

در جنوب غربی ایالات متحده امریکا زمینهای شنی وجود داشت که رنگ زرد داشتند، تا اینکه آتشفشانی فوران میکند و مواد مذاب روی سطح شن ها را فرا میگیرند، بعد از اینکه این مواد مذاب سرد میشوند سطح این زمین زرد رنگ به سنگهای تیره تبدیل میشود، موشهای زرد رنگی که رنگ زمین شنی پیش از فوران آتشفشان در آن زمین ها زندگی میکردند به این منطقه جدید باز میگردند، هر 1000 سال یکبار یک موش سیاه رنگ بر اساس تصادفات (جهش) ژنتیکی ایجاد میشود، اگر فرض کنیم در صورتی که سیاه بودن یک موش  یک صدم درصد احتمال بقای آن موش را نسبت به موشهای زرد بیشتر بکند، زیرا جغدهایی که در آن منطقه وجود دارند میتوانند موش های زرد رنگ را به دلیل اینکه نمیتوانند خود را بر روی سنگ های سیاه استتار کنند به سادگی شکار میکنند، در حالی که موش های سیاه میتوانند بسیار ساده تر خود را از دید شکارچیان پنهان کنند، در نتیجه جمعیت موشهای سیاه به تدریج بیشتر میشود و جمعیت موشهای زرد کمتر و کمتر میشود، بعد از حدود 1000 نسل از زاد و ولد این گونه جانوری جمعیت موشهای سیاه به نود و پنج درصد کل جمعیت موشها تبدیل میشود. در این مثال یک موش سیاه به دلیل تغییری که برای نجات در مورد او تحقق افتاده است پس از 1000 نسل به اکثریت آن گونه جانوری تبدیل میشود. حال اگر فرض کنیم آن امتیاز از یک صدم درصد به ده درصد تبدیل شود این وضعیت در 100 نسل تحقق خواهد یافت، و تحقیقات نشان داده است که این عدد حتی بیش از ده درصد است. در واقعیت این تغییر جمعیت و تکامل ممکن است در صد سال اتفاق بیافتد.

میبینیم که در مثال بالا که یک مورد کوچک از تکامل است، هر دو عامل، یعنی شانس و همچنین شرایط زیستی چگونه باعث تکامل یافتن این موجودات میشود. تغییرات متعدد به مرور زمان منجر به شکل گیری گونه های جدید بسیار متفاوت با گونه های پیشین میشود و تکامل همیشه ادامه پیدا میکند، در نتیجه همه جانداران در هر زمان و مکانی همواره در حال تکامل یافتن هستند.

تکامل و ارتباط آن با دین و خدا:

یکی از مسائلی که باعث میشود دین داران با این تئوری علمی در جنگ باشند این است که تکامل نشان میدهد انسانها از نگر بیولوژیکی آنچنان موجودات متفاوتی از سایر جانداران نیستند، اما  بر اساس باورهای دینی انسانها اشرف مخلوقات هستند و جهان برای انسانها آفریده شده است (به این دیدگاه انتروسنتریسم «Anthropocentrism» گفته میشود)، اما تئوری تکامل و سایر واقعیت های طبیعی نشان میدهند که اینگونه نیست و این انسان است که بگونه ای سازگار با طبیعت تکامل یافته است. دلیل دشمنی دین داران با کشف شدن اینکه زمین مرکز کائنات نیست نیز همین بود، باورهای دینی به آنها آموخته بود که زمین مهمترین عنصر تمام کائنات است (به این دیدگاه ژئوسنتریسم Geocentrism گفته میشود) و اگر اینچنین نبود از نظر آنها دیگر لابد انسان نیز مهمترین موجود نبود و اتفاقا بعدها هم همان تکامل نشان داد که اینگونه است و انسان نیز از لحاظ بیولوژیکی و طبیعی یک حیوان است. برخی از دین داران گمان میکنند این واقعیت توهین به بشر است که به او گفته شود تو نیز یک قسمتی از طبیعت هستی و صاحب طبیعت نیستی و ابر و باد و مه و خورشید برای تو در کار نیستند. حتی برخی از نادانترین دینگرایان این را اثباتی بر درستی دینشان قرار داده اند، یعنی مثلاً گفته اند تکامل باطل است زیرا انسان را پایین می آورد و دین درست است زیرا انسان را بالا میبرد، و این چیزی جز مغلطه توسل به نتیجه باور نیست، یعنی از روی خوبی و بدی نمیتوان درستی و یا نادرستی یک قضیه را اثبات کرد، این «استدلال» خداباوران به این معنی است که انگار هر نظریه ای که جایگاه بالاتری به انسان بدهد، آن قضیه درست تر است، اگر این قضیه نابخردانه درست باشد، میتوان گفت خدا نوکر و بنده انسان است، زیرا در این صورت انسان جایگاهش بسیار بالاتر خواهد بود، و دین داران با اینکه میگویند انسان بنده خدا است به بشر توهین میکنند، این دو «استدلال» به یک اندازه مضحک هستند.

دیگر مسئله ای که باعث دشمنی دینداران با تئوری تکامل شده است داستانها و اسطوره های خلقت مانند قصه آدم و حوا است که بنیادگرایان دینی برداشتی واقع انگارانه از آنها دارند، یعنی معتقدند واقعا چنین اتفاقهایی افتاده است و روشن است که این داستانها در صورت درست بودن تئوری تکامل تنها به قصه هایی تبدیل میشوند که واقعیت خارجی نداشته اند. در ادبیات تمام ملتها معمولا اسطوره های خلقت یافت میشوند، مثلا در اسطوره های ایرانی داستان مشیه و مشیانه وجود دارد. داستان آدم و حوا نیز تنها یک داستان محلی اینچنین در میان یهودیان بوده است که مسلمانان گمان میکنند چون در قرآن است باید حقیقت مطلق باشد. این دیدگاه از طرف دینداران مدرنتر مورد تایید است، مثلا پاپ ژان پل دوم اعلام کرده بود که داستان آدم و حوا میتواند تنها یک داستان آموزنده باشد، و تکامل ممکن است درست باشد، اگر تکامل درست باشد لزوماً لطمه ای به انجیل و تورات نمیخورد. اما مسیحیان و مسلمانان و یهودیان بنیادگرا با برداشتهای لیبرالتر از داستانهای دینی توافق ندارند در کنار تکامل سعی کرده اند تئوری (!) های دیگری همچون تنظیم هوشمند (Intelligent Design) و یا خلقت علمی (Creationist science) پدید آورده اند که این دیدگاه ها در مجامع علمی مورد قبول نبوده اند و در دادگاه های مختلف در کشورهای مختلف طرفداران تدریس این مفاهیم محکوم به دروغگویی و تلاش برای علمی جلوه دادن اباطیل دینیشان شده اند.

عده ای گمان میکنند تکامل ضد وجود خدا است و سازگاری با وجود خدا ندارد، برداشت این عده ناشی از درک ضعیف آنها از مسئله علیت است، این افراد گمان میکنند که اگر همه چیز در مورد حیات با تئوری ها و علتهای طبیعی قابل توضیح باشد دیگر نمیتوان برای خدا نقشی را در نظر گرفت، بعبارت دیگر این عده برای خدا بدنبال علت عرضی میگردند. بطور کلی نه تئوری تکامل نه هیچ تئوری علمی دیگری نمیتواند عدم وجود خدا را اثبات کند، اثبات عدم وجود خدا مسئله ای کاملاً فلسفی است نه علمی زیرا خداوند در صورتی که وجود داشته باشد میتواند علتی طولی باشد، در این مورد در نوشتاری با فرنام «خدای حفره ها چیست؟» توضیحات کامل آورده شده است، بنابر این تکامل به هیچ عنوان تئوری نیست که درستی آن عدم وجود خدا را اثبات کند و کمتر فیلسوف بیخدایی است که از تکامل بدین شکل سود جسته باشد، مگر آنکه در رد  برهان نظم از آن برای نشان دادن اینکه تئوری تکامل لزوماً نیازی به علت عرضی الهی ندارد استفاده کرده باشد، اما این ناسازگاری تنها بین خدای فلسفی (خداوند چیست؟) است که وجود ندارد، بین خدای دینی، مثلا خدای اسلام و تکامل ممکن است اختلاف نظر وجود داشته باشد، زیرا خدای اسلام گفته است که بشر بصورت خلقت آدم و حوا بوجود آمده است و آدم تکامل یافته نبوده بلکه از خاک پدید آمده است و این کاملا در تناقض با نظریه تکامل است. نتیجه آنکه استفاده از تئوری تکامل برای اثبات عدم وجود خدا بصورت عام آن جایز و درست نیست اما استفاده از این تئوری برای رد وجود خداهای خاصی مثل خدای اسلام ممکن است درست باشد و وحشت دین خویان از این تئوری نیز ممکن است دلیلی موجه داشته باشد.

اما از این گذشته تکامل بدون شک به گسترش بیخدایی کمک کرده است، در فلسفه روشی وجود دارد که معروف به «تیغ اوکام» (Occam’s Razor) است. بر اساس این روش وقتی توضیحات کافی برای توضیح یک قضیه وجود داشته باشد، توضیحات اضافی دیگر که در توضیح آن قضیه تغییری ایجاد نمیکنند اهمیتی پیدا نمیکنند و حتی نادیده گرفته میشوند، از این روش معمولا بیشتر در بررسی نظریه های طبیعی استفاده میشود. دلیل این نامگذاری نیز این است که این روش همچون یک تیغ توضیحات اضافی در مورد هر قضیه را میبرد و اوکام نیز نام منطق دان انگلیسی بوده است که این روش را معرفی کرده است. در بررسی مسئله روح مثالی را مطرح کردم که در اینجا نیز آنرا تکرار میکنم. تصور کنید عده ای به موجودی نامرئی و غیر مادی به نام «گوراگورا اعتقاد داشته باشند و ادعا کنند گوراگورا موجودی است که در هنگام عطسه کردن نزد انسانها می آید و انسانها را میبوسد. و بوسه او سبب عطسه انسانها میشود. هیچ کس نمیتواند گوراگورا را ببیند و یا او را لمس کند. حال آیا کسی میتواند اثبات کند که گوراگورا وجود ندارد؟ این باورمندان به گوراگورا ممکن است به شما بگویند هر گاه او شما را ببوسد شما عطسه کرده اید و هر گاه شما را نبوسد عطسه نخواهید کرد، و اگر شما این باور آنها را انکار کنید، آنها از شما خواهند پرسید، پس انسان برای چه عطسه میکند؟ اگر دلیلی علمی برای عطسه پیدا کنید و به آنها بگویید که عطسه کردن به این دلیل و به آن دلیل علمی است که اتفاق می افتد، ممکن است معتقدان به گوراگورا به شما بگویند «خوب ما نیز منکر این دلایل علمی نیستیم، اما گوراگورا هم همزمان با آن دلایل علمی شما را میبوسد، و اگر گوراگورا وجود نداشته باشد و شما را نبوسد شما هرگز عطسه نخواهید کرد.» حال برای دانشمندی که قضیه عطسه کردن را بررسی میکند، یافتن دلایل علمی عطسه کردن کافی هستند و او هیچ توضیح اضافی در مورد گوراگورا را نخواهد پذیرفت. ارتباط تکامل با خدا نیز بسیار مشابه با همین مثال است. اعتقاد به اینکه خدا باعث تکامل شده است همانقدر خردمندانه است که اعتقاد به اینکه گوراگرا باعث عطسه کردن میشود خردمندانه است. اما به نظر من هرگز نمیتوان از تکامل علیه وجود خدا بطور قطعی استفاده کرد.

برخی از خداباوران معتقدند تکامل نیز به دلیل پیچیدگی و نظمی که درون خود دارد نمیتواند بدون نظارت خدا ممکن باشد، این «استدلال» بسیار شبیه به برهان نظم است و در رد برهان نظم به اندازه کافی در دفاع از بطلان بودن این استدلال صحبت شده است.

شبهات رایج در مورد تکامل:

بعد از این توضیحات مختصر راجع به تکامل اکنون شایسته است به برخی از شبهات رایج که در مورد تکامل مطرح میشود و معمولا ناشی از سوء تفاهماتی است که در اذهان اشخاص پیش می آید بپردازیم. در این بخش به دو شبهه بسیار رایج در مورد تکامل خواهیم پرداخت.

تکامل هنوز اثبات نشده است و تنها یک نظریه است:

این اعتراض از رایج ترین اعتراضاتی است که عوام نسبت به تکامل مطرح میکنند. این افراد نمیدانند که در دنیای علم هیچ مفهومی بالاتر از تئوری نمیرود و تئوری بالاترین مرحله ایست که یک نظر علمی میتواند داشته باشد. بسیاری از سایر مفاهیم علمی همچون جاذبه نیوتون، سرعت نور، بیگ بنگ و غیره تماما تئوری هستند، اساساً هرچیز که بر مشاهده مبتنی باشد نمیتواند از مرحله تئوری بالاتر رود. در برخی از شاخه های علم (منظور از علم همان Science) است، مفاهیمی وجود دارند که مشتق شده از اصول قطعی ریاضیات هستند به آن دسته از مفاهیم قضیه یا تئورم (Theorem) گفته میشود مثلا روابط فیثاغورس و تالس دو نمونه از قضایا هستند، سایر چیز ها نمیتوانند چیزی جز تئوری باشند. پیرامون این مسئله در نوشتاری با فرنام علم چیست؟  توضیحات بیشتری آورده شده است.

نتیجه آنکه تئوری بودن تکامل نمیتواند از ارزش و درستی آن بکاهد و کسانی که این ایراد را وارد میکنند مفهوم کلمه «تئوری» را در فلسفه علم درک نمیکنند. از این گذشته هر تئوری برای توضیح یک واقعیت شکل میگیرد، مثلاً تئوری جاذبه نیوتون برای توضیح واقعیت جاذبه شکل گرفته است، دقیقاً همین ارتباط میان تئوری تکامل و خود تکامل بعنوان یک واقعیت وجود دارد.

تکامل تصادفی است و احتمال آن پایین است، پس محال است:

در پاسخ به این شبهه باید گفت نخست اینکه تکامل تماماً مبتنی بر تصادف نیست، شخصی که این اعتراض را مطرح میکند عامل دوم تکامل را که عاملی غیر تصادفی است را نادیده میگیرد، از این گذشته تئوری تکامل تماماً مبتنی بر تصادف نیست، بلکه عوامل جبری نیز در آن نقش بازی میکنند. بسیاری از بیولوژیست ها معتقدند دو عامل اساسی در تکامل نقش بازی میکنند،

  1. تغییراتی که بر اساس تحولات تصادفی ژنتیکی (جهش ژنتیکی) انجام میگیرند.
  2. تغییراتی که قدرت و احتمال نجات یافتن و تکثیر موجود را بالا میبرند، که عدم تحقق این تغییرات موجب حذف آن موجود توسط گزینش طبیعی میشود.

کسانی که این اعتراض را بیان میکنند درکی بسیار ضعیف از تئوری احتمالات دارند، اینکه احتمال وقوع یک اتفاق پایین باشد هرگز و هرگز به این معنی نیست که آن اتفاق محال است، لذا این اعتراض نیز از پایه غلط است. در این مورد در نوشتاری با فرنام «مگر میشود همه چیز بطور تصادفی بوجود آمده باشد؟» توضیحات کافی داده شده است.

نتیجه گیری:

باید روی این نکته تاکید کرد که تکامل باور دینی و داگمای بیخدایان نیست، بیخدایان وجود خدا را به این دلیل انکار و نفی نمیکنند که معتقد به تکامل هستند. اینکه بیشتر بیخدایان معتقد به تکامل هستند به این دلیل است که بیخدایان معمولا بیشتر از خداباوران علاقه به یافته های مستند علمی دارند و با تئوری های علمی خردگرایانه تر برخورد میکنند و معتقد به قصه های ننه قمر کتابهای دینی نیستند. هیچ نظریه دیگری در حال حاضر برای توضیح انواع گونه های جانوری وجود ندارد و اگر تکامل روزی رد شود و تئوری بهتری ارائه شود بدون شک بیخدایان خردگرا نیز این تئوری را کنار گذاشته و تئوری جدید را خواهند پذیرفت.

در پایان با معرفی چند لینک دانشگاهی برای آموختن بیشتر در مورد تکامل این نوشتار را به پایام میبرم.

کتاب داروین بصورت گفتاری +

دموکراسی چیست؟

در دست احداث

در سفرنامه ناصر خسرو (ناصر خسرو حدود 300 سال بعد از حمله اعراب به ایران به مسافرت میپردازد و مشاهدات وی که از شهرهای مختلف ایران و خاور میانه دیدن کرده است امروز به نام سفرنامه ناصر خسرو یکی از نوشته های ارزشمند تاریخی ایران است) میتوان به خوبی دید که حاکم هر شهری را با یک صفتی که در آن از کلمه الله استفاده میشود میخوانند و در تمام مساجد خطبه را به نام حاکم میخوانند. اصولا در گذشته حاکمان همواره باید آویزان دین و خداوند میشدند و دین همیشه یک پدیده سیاسی بوده است، ناپلئون میگوید بهترین وسیله برای اینکه فقیر ها پولدارها را نکشند دین است. اصولا خریت بشری هیچگاه تا وقتی که انگیزه های دینی باعث آن باشند بالا نمیرود، میتوان گفت میزان ایمان دینی و عقلانیت همیشه برابر هستند یعنی هرچقدر ایمان بیشتر است، عقل کمتر است و برعکس. حاکمان چگونه میتوانستند مردمی را قانع کنند که از آنها فرمان ببرند؟ همیشه با زور نمیشد چنین کاری کرد! باید انگیزه های تئوریک دیگری نیز ایجاد میشد. همین نیاز بود که باعث میشد دین همیشه در کنار حکومت قرار گیرد چرا که دین به بهترین نحو ممکن میتوانست افراد را قانع کند که مکلف به اطاعت از حاکم هستند و ذهن آنهارا مشغول به آسمان و بهشت و جهنم کند تا مردم کمتر به فکر دنیایشان باشند و بیشتر به فکر آخرت باشند تا حاکمان بتوانند از دنیا لذت ببرند و آنرا به کام خویش بگردانند و برای مردمان محکوم تصمیم بگیرند.

همانطور که گفته شد انگیزه های سیاسی دین آنقدر زیاد است که میتوان گفت دین اصولا برای تسخیر اهرمهای سیاسی پدید آمده است، خدا و پیامبر و اینها همه بهانه هستند، مسئله مهم این است که اگر بخواهید به خدا و پیامبر و… دست پیدا کنید باید در مسجد من نماز بخوانید، در کلیسای من دعا کنید، به زیارت خانه کعبه کشور من بیایید، و در نهایت از حکومت من دفاع کنید و حرف زیادی نزنید. مهم این است که یک شخصی این وسط واسطه بین ارتباط بنده و معبود میشود و همیشه آن شخص است که کل دین را تبلیغ میکند و سر و سینه برای دین میشکافد! اصولا اینکه یک شخصی ادعای دانستن از آنچه دیگران نمیتوانند بداند (دانایی از عالم غیب) بکند و خود را جدا از بقیه بداند و ادعا کند که دسترسی ویژه ای به حق و حقیقت دارد، مثلا مثل مقام معظم رهبری آیت الله خامنه ای نایب امام زمان است یا مثل فرعون خود با خدایان ارتباط دارد یا مثل محمد خود پیامبر خدایان است، بسیار در گذشته رایج بوده است و عمده حکومت های مطلقه بر این اساس شکل میگرفته است.

در حکومت مطلقه یک شخص یا یک لایه از اجتماع نسبت به بقیه به دلیل دسترسی داشتن به چیزهایی که بقیه به آن دسترسی ندارند، مانند فرزند پادشاهی بودن و یا همانگونه که ذکر شد امتیازات ویژه دینی داشتن از یک حقانیت و والایی ویژه برخوردار میشدند و حکومت ازآن آنها بشمار میرفت و بقیه مردم مکلف بودن از حکومت آنها دفاع کنند و رعیتی باشند. مردم را در این نوع تفکر به عوام و خواص تبدیل میشوند که هرکدام تکالیف ويژه خود را دارند. در این نوع حکومتها تمام اختیارات به یک نفر یا یک لایه از اجتماع (مثلا روحانیون) داده میشود و وقتی تمام اختیارات به یک شخص داده میشود، یک اختیار بزرگ از وی گرفته میشود، وقتی همه قدرت را به یک شخص بدهیم، یک قدرت بزرگ را از وی گرفته ایم، و آن قدرت عدالت کردن است. در این نوع حکومتها اندیشه مخالف حق حیات ندارد و بعنوان دشمن مردم (عبارتی که در دوران کمونیستی اتحاد جماهیر شوروی، کمونیست ها انتخاب کرده بودند) یا دشمن و محارب خدا (عبارتی که در نظام مقدس آقا امام زمان به کار میرود) شناخته میشوند. حکومتهای مطلقه نیز خود انواعی دارند، که بد ترین و ضد بشر ترین آنها حکومتهای ایدئولوگ است.

ایدئولوگ ها دروغ میگویند، این یک تجربه بزرگ تاریخی است که باید خوب می آموختیمش تا به دام امام زمان و نظامش نمی افتادیم، ایدئولوژی ها وقتی شکل میگیرند که جامعه نیاز به آنها داشته باشد، این ایدئولوژی ها پاسخ هایی را که جامعه میطلبد برای نیازهای جامعه در زمانی که در حال شکل گرفتن هستند دارند و پویا و بسیار زیبا هستند. در زمانی که هر ایدئولوژی ای شکل میگیرد به نوآوری ها لقب انقلابی و مبارز میدهد، به کمونیست های ایران در زمان شاه نگاه کنید، آنها به آخوندها میگفتند مبارز و آنها را همرزم خود حساب میکردند، اسلامگرایان نیز همینطور، آیت الله خمینی قبل از ورود به ایران اعتقاد داشت که «چپ ها در جمهوری اسلامی اجازه حیات دارند»، در این حالت ایدئولوژی را میتوان یک حرکت «Movement» نامید، اما وقتی که ایدئولوگ ها به قدرت میرسند همه چیز متفاوت میشود. دیگر از آن پویایی خبری نخواهد بود، چرا که ایدئولوگهای به قدرت رسیده دیگر تغییر و پویایی را بر نخواهند تافت، چون که قدرت خود را در خطر خواهند دید، در این حالت به تقویت قوای خود و بویژه قوای سرکوب خود خواهند پرداخت و تبدیل به یک موسسه «Institution» خواهند شد. دگر اندیشان و رفقای انقلابی قبلی اینبار «ضد انقلاب» خطاب خواهند گرفت و دشمن مردم و یا نظام خواهند شد، حضرت امام بعد از مدتی رفقای کمونیست را «چپ های آمریکایی» نامیدند و یکی یکی از خجالت آنها در آمدند و این رسم تمام حکومت های ایدئولوگ است. حکومتهای ایدئولوگ بعد از مدت کوتاهی به حکومت های تمامیت خواه «توتالیتر» تبدیل خواهند شد و دست به پاکسازی خواهند زد، فاجعه ملی تابستان شصت و هفت و قتل های زیادی که استالین انجام داد از این نوع هستند.

شایسته است حال که حرف از حکومتهای ایدئولوگ رسید به حضرت جورج اورول اشاره ای کنیم. جورج اورول خودش زمانی یک سوسیالیست بود و حتی با اینکه انگلیسی بود به اسپانیا رفت و با مبارزان سوسیالیست اسپانیا همرزمی مسلحانه کرد. وی دو کتاب به اسامی «قلعه حیوانات» و «1984» دارد که اولی به زیبایی و شایستگی تمام به شرح و بررسی یک انقلاب ایدئولوگ میپردازد و در دومی به شرح و بررسی زندگی در یک حکومت تمامیت خواه و ایدئولوگ میپردازد، هردو ا ین کتابها به فارسی ترجمه شده اند و درک بسیار جالبی از این مسئله مهم به خواننده میدهند، کمونیست ها از کتاب 1984 متفنر هستند و اعتقاد دارند جورج اورول از CIA پول گرفته و این کتاب رو نوشته، در کشورهای اروپای شرقی در زمان کمونیسم شوروی، داشتن این کتاب حدود 15 سال زندان داشت.  من با خواندن قلعه حیوانات به شدت متعجب شده بودم که چقدر این ماجرا شبیه انقلاب ایران است. اما وقتی در مورد 1984 شنیدم به کتابخانه رفتم و به جستجوی آن پرداختم، وقتی کتاب را یافتم آنرا باز کردم و در صفحه اول آن چهره درخشان حضرت امام آن نگار دلباخته (معمولا عکس حضرت امام را با زیر شلوار و دمپایی  و آفتابه به دست در صفحه اول کتابهای درسی میدیدم اما اینبار عکس ایشان نسبتاً خوشتیپ تر بود؛ چقدر این پیرمرد عارف ساده زیست…آنقدر که ما کافران کوردل هم شیفته این زندگی درویشانه میشویم!) پیر جماران را دیدم، مقدمه نویس کتاب (کتاب چاپ لندن بود) در همان صفحه اول نوشته بود که خواندن این کتاب شمارا شگفت زده خواهد کرد که چگونه جورج ا ورول چنین اثری را حدود 50 سال پیش نوشته و امروز ما میتوانیم صحت آنرا در مورد انقلاب ایران به خوبی ببینیم. زیاد از بحث این گفتار دور نشویم.

حکومت مطلقه بد دردیست، شاید حاکم مطلقه خودش حتی آدم بدی نباشد و خیر مردم و کشور و امام زمانش را بخواهد اما خود فرم حکومت دیکتاتوری به گونه ایست که پتانسیل فراوان به فساد دارد، تا حدی که بیگمان هر حکومت مطلقه ای هرچند ظاهری مدرن و آراسته داشته باشد اما باطنی بسیار زشت و خشن و ضد بشر دارد. اطراف حاکم مطلق را افرادی میگیرند که سازنده و نگارنده دنیایی هستند که حاکم مطلق آنرا دنیای واقعی بیرونی میداند. چاپلوسان و مداحان و فرومایگان (برادران بسیجی و سپاهی و…) که در شرایط آزاد وضعیت بسیار بدی خواهند داشت بهترین شرایط را در حکومتهای مطلقه خواهند داشت، گویند هرجا که آزادی مطرود است، مطرود آزاد است. شایستگان خانه نشین خواهند شد و انسانیت و تمام زیبایی های بشری رو به فنا خواهد رفت. نحوست حکومت مطلقه فقط مربوط به نحسی حاکم آن نیست، حکومت مطلقه اجتماع را نابود خواهد کرد و تاثیرات فوق العاده بدی بر اجتماع خواهد گذاشت که از زندگی عمومی تا خصوصی مردم را در بر خواهد گرفت. مردمی را لجوج و قانون گریز و مرموز و موزی و پرخاشگر خواهد کرد، خوی دیکتاتوری را به جوامع خرد تر و کوچکتر نیز رسوخ خواهد داد، در هر اجتماع کوچک ایرانی یک سید علی خامنه ای یا یک دائی جان ناپلئون و دیکتاتور وجود دارد، از کشور تا استان گرفته تا ادارات و مدارس و حتی بسیاری از خانواده ها. دموکراسی این زشتی و پلیدی را از میان خواهد برداشت، دموکراسی و آزادی همانند حمامی این چرکها و زشتی های فرهنگی را خواهد زدود  و مردمی را زیبا و خندان خواهد کرد. مردم جامعه دموکراتیک برای زندگی روزانه خود نیازی به دروغ و رشوه و گریه و زاری و بوقهای گوشخراش در هنگام رانندگی ندارند.

بشر سالیان سال در چنین حکومتهایی زیست کرد و اندیشید که چگونه میتواند این شرایط را تغییر دهد، دموکراسی نتیجه آن بود. برای خیلی ها دموکراسی یک شوخی و یک چیز فاتنزی به نظر میرسد و آنرا با نیشخند و تمسخر بیان میکنند، این درحالیست که این اختراع بزرگ بشری نتیجه تفکر و مبارزه ده ها و صدها فیلسوف و دانشمند در تمام درازای تاریخی است که گوشه گوشه اش بوی زخم و تعفن میدهد، دموکراسی اختراع شد تا مرهم این درد ها باشد و اصلا شوخی نیست. دموکراسی بازیچه و مسخره ای نیست، صدها بار و صدها جا آزمایش شده و جواب پس داده، دموکراسی در کنار سایر اکتشافات و اختراعات بشری مانند اینترنت و جریان الکتریسته و… که زندگی را آسام میکند ساخته و طراحی و  پرداخته شده تا شرایط بهتری را برای بشریت به ارمقان بیاورد؛ خواهیم دانست چرا…

خود کلمه دموکراسی از کلمه دمو «در زبان یونانی به معنی مردم» ایجاد شده است و دموکراسی را به شایستگی تمام به «مردم سالاری» ترجمه کرده اند. سابقه دموکراسی به یونان باستان برمیگردد اما دموکراسی به شیوه جدید را بعد از انقلاب بزرگ فرانسه میدانند. در سرزمین ما نیز سابقه دموکراسی به انقلاب مشروطیت بر میگردد و مشروطیت کلمه ای بود که از کلمه دموکراسی بر گرفته بود، شایان ذکر است دموکراسی از فراورده های مدرنیسم و یا تجدد است، دموکراسی را نباید در دوران پیشامدرن جوامع دنبال کرد، در باره مدرنیسم در «مدرنیسم چیست» توضیحات کافی داده شده است.

همانطور که گفته شد قدرت فساد می آورد و عدالت را از بین خواهد برد، قدرت مطلق هم فساد مطلق میاورد، توجه داشته باشید که مفعول در اینجا ابداً اهمیتی ندارد، چه قدرت مطلق را به سید علی خامنه ای بدهید، چه به شاهزاده رضا پهلوی، چه به حزب کمونیست کارگری چه به هر چیز، شخص، گروه، حزب دیگر، صرف این فعل آن مفعول را فاسد خواهد کرد و تمام تلاش باید بر این باشد که این تمرکز قدرت و وجود قدرت مطلقه بطور کلی وجود نداشته باشد! به خود امام راحل و پیامبر اسلام نگاه کنید، هردو وقتی در قدرت نیستند ظاهری انسان دوست و مفید دارند اما هردو وقتی به قدرت میرسند، دشمنان خود را از دم تیغ میگذرانند و وحشی و خونخوار میشوند، انسان قبل از قدرت و قبل از قدرت یکسان نیست! بسیاری از کسانی که طرفدار خمینی بودند حتی فکرش را هم نمیکردند که خمینی در مدرسه رفاه بنشیند و چپ و راست فرمان قتل و اعدام صادر کند، این اشتباه را نباید تکرار کرد، چاره این مشکل بزرگ دموکراسی است! برای حل این مشکل در یک حکومت دموکراسی نهادها را آنقدر باید خرد کرد که بتوان آنهارا مهار کرد و خطر فاسد شدن آنها را ضایع شدن حقوق سایر انسانها را بطور کلی از میان برداشت. تفکیک قوا و استقلال مطلق آنها از یکدیگر از مضامین همین اندیشه دموکراتیک است.

تعریف متفاوت دو واژه حق (درست و غلط) و شیوه رسیدن به معرفت (شناخت صحیح) دو مفهوم بود که به شکل گیری دموکراسی انجامید. باید دانست حق چیست و ملاک تشخیص آن چیست، مفاهیم دینی اینگونه بیان میکنند که دین و مذهب ما حق است و سایر ادیان باطل هستند، منطق دینی منطق دو دویی، سیاه سفید، خیر و شر، صفر و یک است، درحالی که در دنیای واقعی و در علم هرگز چنین نیست، علم قطعیت را بر نمیتابد، علم و روش علمی فکر کردن مبتنی بر ظن و تئوری و نظریه و فرضیه است تا یک سری حقایق غیر قابل انکار که انکار آنها موجب مرگ است. درست و غلط به آن معنی که در دین مطرح میگردد کاملا خرافی و غیر واقعی است. توجه داشته باشید که در گذشته افراد خیلی سریع به یقین میرسیدند و حتی انا الحق میگفتند. گویا آدمها هرچه احمق ترند بیشتر و زود تر به یقین میرسند و این جزم اندیشی چیزیست که دشمن اصلی دموکراسی است. درست و غلط در علوم انسانی و تصمیماتی که انسان میگیرد به معنی مطلق به هیچ عنوان وجود ندارد بلکه کاملا نسبی است، حال که حقیقت مفهومی نسبی است، از کجا معلوم کدام حقیقت درست تر است؟ دموکراسی در همینجا به کمک بشر می آید، احتمال اینکه یک جمعیتی یک اشتباهی را بکنند، کمتر است تا اینکه یک نفر یک اشتباهی را بکند، بنابر این تصمیم گیری را با توجه به رای اکثریت قرار میدهند. اینکه امروزه رای گیری یک چیز کاملا قبول شده است صرفا مربوط به دنیای مدرن و امروزی است، در گذشته اهمیت رای گیری و دموکراسی برای بشر مشخص و بدیهی نبود و اگر امروز هست باید آنرا بخاطر زحمات بی دریغ هزاران نویسنده و فیلسوف و شاعر و اندیشمند و … دانست، اگر چه امروزه هم برای دشمنان دموکراسی به ویژه حزب اللهی ها که از زیر دست باستانشناسان فرار کرده اند دموکراسی و رای گیری چندان ارزشی ندارد، دلیلش را خواهیم دانست.

شیوه شناخت و معرفت نیز از عوامل دیگر پیدایش دموکراسی بود، خردگرایی و سکولاریسم، روش درست فکر کردن و رسیدن به حقایق (حقایق مسلماً علمی وغیر قطعی هستند) را به بشر نشان داد، انشاء الله و ماشاء الله از صفحه فیزیکی روزگار حذف میشود و علت ها و معلول ها همگی زمینی و این جهانی میشوند و آن جهان و خرافات مربوط به آن به عده ای که اعتیاد عمیقی به افیون دین دارند سپرده میشود. در نوشتار علم چیست بیشتر در این زمینه توضیح داده شده است.

دو مولفه و رکن بزرگ را میتوان در تعریف دمکراسی برشمرد

  • پلورالیسم (کثرت گرایی)
  • حقوق بشر

پلورالیسم یا کثرت گرایی را میتوان وجود انواع و اقسام اندیشه ها در اجتماع و دارایی از حقوق مساوی برای آنها دانست، پلورالیسم در مقابل توتالیتریسم تعریف میشود. نظام و اجتماعی پلورال و کثرت پذیر است که به همه گونه اندیشه اجازه حیات بدهد، نیاز به اندیشه های مخالف در جامعه چیزیست که همه باید آنرا درک و قبول کنیم و برای آن بکوشیم. گروه ها و افراد جزم اندیشی وجود دارند که همانطور که گفته شد حقیقت را مطلق میدانند مثلا حزب اللهی ها فکر میکنند تازینامه خالی از خطاست و همه دستور العمل های لازم درون آن گنجانده شده است و روایات و قصه هایی که از 14 معصوم وجود دارد نیازگوی تمامی پاسخ های زندگی ما است بنابر این ما دیگر نیازی به کمونیست و مجاهد و سایر انواع و اقسام گروه ها و نظرهای مختلف نداریم. این جزم اندیشی همواره از حماقت عمیق طرفداران یک اندیشه (در این مثال زنده برادران حزب اللهی) حکایت میکند، در واقع هرگاه شما به یک کتاب به چشم تازینامه نگاه کنید (مثلا کتابهای مارکس) و به یک شخص به چشم حضرت علی نگاه کنید (مثلا به لنین و یا مارکس) و آنهارا حقیقت مطلق و قطعی بدانید (در حالی که چنین اندیشه ای ضد علم است) بدانید آنگاه به عرصه جزم اندیشی وارد خواهید شد و به کف اقیانوس بیپایان حماقت فرو خواهید رفت و مرگ و ایستایی و نیستی را برای آن اندیشه ای که طرفدارش هستید به هدیه خواهید برد. این کار حزب اللهی ها مثل همان حرف عمر خلیفه اول مسلمین است که وقتی کتابخانه هارا آتش میزدند میگفت اگر چیزهایی که در این کتابها است مفید است که حتماً در تازینامه هست و ما به آنها نیازی نداریم، اگر مفاهیم این کتابها مفید نیستند هم که باز به درد ما نمیخورند، پس آنهارا باید سوزان، حزب اللهی ها و مذهبیون و سایر جزم اندیشان تاریخ هم همینقدر احمقانه فکر میکنند.  ما باید درک کنیم که نیروهای مخالف ما، همانند آیینه ای هستند که زشتیها و زیبایی های مارا منعکس میکنند، ما همواره به منتقد و مخالف نیازمندیم، چرا که اشکالات مارا به ما نشان خواهد داد و کیفیت اندیشه و تفکر و عمل را تنها با وجود رقیب میتوان بالابرد. بنابر این هر اندیشه ای که داریم باید به دنبال ایجاد تریبون و دادن میکروفون به دست مخالف اندیشه خود باشیم نه این که سعی در حذف مخالفان داشته باشیم.

وقتی در جامعه ای منتقد وجود دارد کیفیت اندیشه ها در آن جامعه بالاخواهد رفت، چون اگر مثلا یکی مثل آیت الله میکینی در نماز جمعه پرت و پلا بگوید و از امام زمان و این دسته اراجیف صحبت کند مخالفان اندیشه وی به شدت وی را محکوم خواهد کرد، بنابر این آقای مشکینی که از فرجام کار خود آگاه است از این اراجیف نخواهد بافت و بر عکس قضیه هم صادق است. نباید فکر کنیم که اگر همه مثل ما فکر کنند پیشرفت و موفقیت دست یافتنی تر خواهد بود. به حزب اللهی ها نگاه کنید، از همان اوایل خلالوش 57 سر کمونیست هارا زیر آب کردند، بعد مجاهدین را. آنها ایده آل را این میدانستند که حکومت و اندیشمندان یک دست حزب اللهی باشند، در حالی که این حتی برای خود آنها یک فاجعه بود. آنها آیینه را شکستند تا کسی نباشد که آنها را به خودشان نشان دهد چون جزم اندیش و احمق هستند از دیدن زشتی های خود هراسانند، این جزم اندیشی و کج پنداری برادران حزب اللهی متاسفانه در ذهن بسیاری از ماها نیز وجود دارد، و تا وقتی ارزشهای دموکراتیک در میان ماها به وجود نیایید و آنهارا قبول و تایید و حفاظت نکنیم دموکراسی ای نخواهیم داشت. باید مخالفان اندیشه خودمان را مکمل اندیشه های خودمان بدانیم و بدانیم که به آنها نیاز داریم، ما در جامعه مان به احزاب کمونیست، سوسیالیست، مجاهد، حزب اللهی، ناسیونالیست و تمام اندیشه ها تا جایی که پایشان را از گلیم حقوق بشر دراز تر نکنند نیاز داریم. لازمه اقتدار کشور و جامعه وجود پلورالیسم در آن جامعه است.

در مورد حقوق بشر نیز گفتاری جدا در نظر گرفته شده است که میتوانید از اینجا بدان دست یازید. آزادی به معنی مطلق وجود ندارد، آزادی خود یکنوع محدود کردن است، هر انسانی قبل از اینکه مسلمان، بی دین، مسیحی، زرتشتی، ایرانی، افغانی و یا هرچیز دیگری باشد باید بیاموزد که یک بشر و یک انسان است! حال هر انسانی حقوقی دارد که برای همه انسانها یکسان است، آن حقوق را قوانین جهانشمول حقوق بشر مینامیم. حقوق بشر از هر قانون بشری ای بالاتر است و هیچ قانون بشری زمینی یا زیر زمینی یا آسمانی ای حق ندارد این قوانین را زیر پا بگذارد. ادیان اجازه پیاده کردن قوانین ضد قوانین حقوق بشر را ندارند. حقوق بشر مرز دموکراسی است. بعضی ها میگویند، نمیتوان نظر جمع را همیشه درست دانست، اگر جمعی تصمیم گرفتند که شخصی را باید کشت، آیا باید اورا کشت؟

افلاطون را میتوان بعنوان یکی از قدیمیترین دشمنان دموکراسی و آزادی برشمرد، افلاطون نمیفهمید چرا باید جمعی تصمیم بگیرند که به استاد او سقراط جام شوکران بدهند و اورا بصورت قانونی و رسمی بکشند. افلاطون در تصویر شهر ایدآل خود حکومت صحیح را حکومت عده ای افراد آموزش دیده و شایسته بعنوان حاکم میداند نه حکومت مردم بر مردم.  چیزی که دموکراسی در زمان افلاطون کم داشت همین حقوق بشر بود، اگر در زمان افلاطون چنین مفهومی وجود داشت احتمالا وی چنین نظری در باب دموکراسی نمیداد. حقوق بشر مرز دموکراسی و پاسخ به این شبهه افلاطون و بسیاری از آدمهای امروزی به دموکراسی است، در تعلیمات ارسطویی است که ارسطو نظریات استاد خود افلاطون را زیر سوال میبرد و ارزشهای دموکراسی را مجدداً مطرح میکند و از آنها دفاع میکند.

دشمنان دموکراسی :

کارل پوپر فیلسوف و اندیشمند بزرگ یک کتاب تحت عنوان «جامعه باز و دشمنانش» دارد که گمان میکنم به فارسی ترجمه شده باشد، خواندن این کتاب خالی از لطف نیست.

1) برادران حزب اللهی و سایر اسلامگرایان عالم هستی.

برادران حزب اللهی و مذهبیون همواره دشمنی خود را با دموکراسی از همان ابتدا نشان داده اند، شیخ فضل الله نوری، مدرس، نواب صفوی، خمینی و… از چهره های بارز و مشخص حزب اللهی جانوری و ضد دموکراسی  و ضد پارلمان و مجلس و جامعه آزاد بوده اند. مخالفت حزب اللهی ها با دموکراسی بر چه اساسیست؟

  • حزب اللهی ها فسیل هستند و همانطور که گفته شد از آزمایشگاه های باستانشناسی فرار کرده اند،  در دوران مدرن به سر نمیبرند. زندگی حزب اللهی ها بیشتر به زندگی قبیله های بیابانگرد عربی شباهت دارد تا به بشری که در قرن 21 ام زندگی میکند، باستانشناسان و جامعه شناسان با بررسی زندگی این دسته از هموطنان ما میتوانند به نحوه زندگی مردم غار نشین و قبیله های عربی بطور دقیق پی ببرند اما خوب خجالت میکشند، همانطور که گفته شد دموکراسی برای یک جامعه مدرن و متجدد است و در باب چنین جامعه ای در بخش مدرنیسم چیست سخن راندیم. این افراد به سبک مردم اروپایی 500 سال پیش زندگی و فکر میکنند و هنوز خیلی راه دارند تا به بشر متجدد و امروزی برسند.
  • مسئله فساد، حزب اللهی ها تعریف مسخره ای در مورد فساد دارند و فکر میکنند دموکراسی بد است چون به همجنس بازان اجازه میدهد با هم ازدواج کنند (همجنس گرایی چیست؟) و یا افراد در مورد تماس جنسی خود مخطار باشند، در مورد این سفسطه و بحث کلی در مورد فساد در نوشتار،  «سفسطه دین ضامن اخلاق در جامعه است» بطور کامل پرداخته شده است. معمولا تا از دموکراسی و آزادی صحبت میشود مغز کوچک حزب اللهی ها به این سو میرود که در غرب و در دموکراسی فساد است، این گفته بی خردانه حتی از تریبون های رسمی و حتی از دهان مبارک رهبر معظم انقلاب نیز به کثرت و شدت تمام خارج میشود.
  • حزب اللهی ها مخالفت جدی با پلورالیسم دارند، دلیلش هم بسیار ساده است، چون اندیشه های دینی و اسلامی دارند و این اندیشه ها به قدری بی پایه و مسخره و به دور از عقل است که در یک شرایط آزاد هرگز قادر به رقابت با سایر اندیشه ها نخواهد بود برای همین چون میدانند در شرایط آزاد کاملا مطرود و مورد تمسخر هستند و چون اندیشه دینی ایستا و غیر قابل ترمیم است نمیتوانند آنرا حتی اصلاح کنند از دشمنان اصلی شرایط برابر و آزاد و دموکراسی هستند. حزب اللهی ها و بطور کلی اسلامگرایان میدانند که اگر در جامعه آزادی زندگی بکنند غیر از خودشان و پسر خاله هایشان و دختر عمو هایشان کس دیگری به آنها و حزبشان رای نخواهد داد برای همین تمام تلاششان بر این است که چنین فضایی بوجود نیاید.
  • حزب اللهی ها چون جزم اندیش و فوق العاده خرافاتی و احمق هستند فکر میکنند از طریق یک سری روش ها به حقایق بی چون و چرا و متافیزیکی ای دسترسی دارند که آنها را از نیاز به منتقد و مخالف بی نیاز میکند و بنابر این نیاز به جامعه باز و آزاد و دموکراتیک را درک نمیکنند. درست برای این موجودات آن چیزیست که اسلام بگوید درست است و غلط برای آنها چیزیست که اسلام بگوید غلط است، بنابر این تعریف حق برای آنها چیزی کاملا متفاوت با تعریفیست که در دموکراسی مطرح است.
  • حزب اللهی ها و سایر لایه های انگلی جامعه ایران نسبت به غرب شرطی شده اند و با حالتی بچه گانه و لجوجانه از هر آنچه غربی باشد هراسانند. و چون دموکراسی پدیده ای غربیست چشم بسته از آن فراری هستند.
  • اسلامگرایان دموکراسی را ضد اسلام میدانند که خوب این کاملا صحیح است و ما نیز آنرا تایید میکنیم.

2) سلطنت طلبها و طرفداران حکومت ناسیونالیست مطلقه.

افرادی که به نام سلطنت طلب (و نه مشروطه خواه) معروف هستند همچون عمو بهروز، فولادوند و… از دشمنان دیگر دموکراسی هستند، نکته بسیار جالب و البته خوشحال کننده این است که خود شاهزاده رضا پهلوی در مورد دموکراسی تقریبا نظرات مشابهی با آنچه در این نوشتار آمده است دارد و خود قصد ندارد که بر ایران حکومت کند بلکه میخواهد سلطنت کند و سلطنت را یک سنت تشریفاتی میداند و به هیچ عنوان قصد ندارد در حکومت دخالت کند و حکومت ایده آل را حکومت دموکراسی میداند بنابر این من واقعا نمیدانم آقایان سلطنت طلب تیر، به چه دل بسته اند، البته افرادی مثل آقای فولادوند بیکار ننشسته اند و طرح عبور از رضا پهلوی را دارند و فکر میکنند رضا پهلوی به اندازه کافی لیاقت پادشاهی را ندارد.

  • این افراد فکر میکنند ملت ایران شعور و لیاقت دموکراسی را ندارند، چون عکس پیر جماران، حضرت امام را در ماه دیده اند. مثلا به انتخابات 12 فروردین اشاره میکنند که از طریق دموکراتیک نظام آقا امام زمان را انتخاب کردند، شاید بتوان گفت آنها اعتقاد دارند ملت ایران هنوز به دوران تجدد خویش وارد نشده است، اما آخر کسانیکه این حرف را میزنند معمولا خودشان بسیار سنتی و کهنه فکر میکنند و با برادران حزب اللهی تقریبا هم دوره هستند.
  • این افراد نیز لجاجت خاصی نسبت به مفاهیم خارجی  دارند و اگر دو مفهوم که یکی از آنها ایرانی است و دیگری غیر ایرانی است در مقابل آنها قرار دهید بدون توجه به اینکه کیفیت کدام مفهوم بالاتر است و کدام مفهوم از حقانیت و اصالت بالاتری برخوردار است، مفهوم ایرانی را انتخاب میکنند، به این نوع میهن پرستی، میهن پرستی یا ناسیونالیسم منفی میگویند. این افراد تلاش میکنند بگویند ما باید مانند اجدادمان زندگی کنیم بدون توجه به اینکه اجداد ما در زمان هخامنشی بهترین سیستم حکومتی جهان را داشتند اما الان آن سیستم یک سیستم مرتجع و بدردنخور حساب میشود و ما اگر بخواهیم به عظمت اجدادمان برسیم لازم نیست حتما مفاهیم آنها را کپی برداری کنیم و به عصر سنگ و کلوخ بازگردیم.
  • اعتقاد دارند ایران به یک شخص قاطع و خشن مثل رضاشاه بزرگ نیاز دارد تا گوش بگیرد و گوشمالی دهد و بسازد و به زور کشور را پیشرفت دهد. این نوع تفکر ناشی از همان جزم اندیشی است، این افراد واقعا فکر میکنند نیازی به بقیه انسانها ندارند و تنها کسی که چیزی سرش میشود خودشان هستند. البته این افراد معمولا از این قضیه خبر ندارند که رضاشاه ابتدا قصد ایجاد حکومت جمهوری داشت و چون با مخالفت جدی روحانیون مواجه شد (بویژه شخص آیت الله حائری) با مشورت با این افراد همان راه حکومت پادشاهی را ادامه داد.

3) رفقای کمونیست.

  • کمونیست ها در مقابل دموکراسی عکس العمل های متفاوتی دارند، اما میتوان گفت بطور کلی زیاد روی خوشی به دموکراسی نشان نمیدهند و آنرا دام امپریالیسم و فریب بورژوازی برای کنترل کارگرها میدانند. آنها دموکراسی را به سخره میگیرند و میگویند دموکراسی برای پولدارهاست و کارگران و اقشار ضعیفتر اجتماعی از حقوقی در نظامهای دموکراتیک برخوردار نیستند، گفته ها و نقد این تفکرات نیازمند نوشتارهای مفصل تری است و در حوصله این نوشتار نیست.
  • کمونیست ها به نظام اقتصادی سوسیالیستی اعتقاد دارند که به توزیع برابر ثروت (دموکراسی توزیع برابر قدرت است) می انجامد. پیاده کردن سوسیالیسم به اثبات تجربه تاریخی و تئوری خود نیازمند یک نظام بسیار قدرتمند و خشن است که معمولا با دموکراسی جور در نمی آید. تلفیق دموکراسی و سوسیالیسم (سوسیال دموکراسی) در کشورهایی مثل سوئد نتیجه های خوبی داده است اما مورد تایید اکثر کمونیست ها نیست.
  • کمونیست ها نیز نسبت به آمریکا همچون حزب اللهی ها شرطی شده اند و چون امریکا و لیبرال دموکراتیک ها معمولا بیش از هر کس دیگری از دموکراسی دفاع میکنند این افراد نیز به همین دلیل به مخالفت با دموکراسی میپردازند و مثلا ترجیح میدهند بجای حکومت پارلمانی حکومت شورایی داشته باشند.

یکی از بهترین و کامل ترین نوشته هایی که در مورد دموکراسی به زبان فارسی وجود دارد کتاب کوتاهی است با فرنام مانیفست جمهوریخواهی از اکبر گنجی، در این کتاب دموکراسی تعریف میشود، عدم دموکراتیک بودن جمهوری اسلامی اثبات میشود، ناسازگاری اسلام و دموکراسی اثبات میشود، این نوشته بسیار ارزشمند را از اینجا دریافت کنید.

اگناستیسیزم،ندانمگرایی، لا ادری گری چیست؟

شخصی که به اگناستیسزم اعتقاد دارد اگناستیک (گاهی بصورت اگنوستیک نوشته میشود)  نامیده میشود، اگناستیسزم را به فارسی به اشتباه شک گرا و یا عرفای منکر وجود خدا نامیده اند. اگناستیک کسی است که اعتقاد دارد خداوند را نمیتوان اثبات کرد بنابر این نمیتوان بطور علمی و منطقی گفت وی وجود دارد یا وجود ندارد. اگناستیک ها میتوانند  خداوند را قبول داشته باشند یا نداشته باشند.

بطور کلی و نسبی، شیعیان را نمیتوان اگناستیک دانست چون علمای (!) شیعی اعتقاد دارند که خداوند را میتوان اثبات کرد و اصالت عقل را قبول دارند. اما اهل تسنن خیلی کمتر بر این اعتقاد هستند و بعضی از فرقه ها دیانت و فلسفه را جدا از یکدیگر میدانند و استدلال را در مورد دیانت و توحید قبول ندارند.

اصولا انعکاس اعتقاد به خداوند در افکار را میتوان به سه دسته اساسی تقسیم کرد

  1. تیست ها (Theists) کسانیکه اعتقاد دارند خدا وجود دارد، و میتوان وجود وی را اثبات کرد.
  2. آتئیست ها (Atheists) کسانیکه اعتقاد دارند خدا وجود ندارد و عدم وجود وی را میتوان اثبات کرد.
  3. اگناستیک (Agnostics) کسانیکه اعتقاد دارند خدا را نمیتوان اثبات کرد، این دسته میتوانند به وجود خدا اعتقاد داشته یا نداشته باشند.

همچنین مراجعه کنید به:

ایمان چیست؟

1. این ایده که چیزی درست است، تنها به دلیل اینکه ما امیدواریم درست باشد.

2. این قضیه که چیزی درست است، حتی اگر مدرکی برای پشتیبانی آن وجود نداشته باشد.

3. این باور که چیزی درست است، حتی اگر مدارکی علیه آن وجود داشته باشد.

ایمان یک کلمه است که بصورت متداول و کلی به عقاید دینی و بصورت جزئی به قبول کردن اصول دینی و تعصبات و جهالتهای آن است. همینطور میتوان ایمان را اعتقاد به متن و باطن عقاید و مفاهیم مذهبی و دینی دانست.

نیچه در باب ایمان میگوید، یک گذار اتفاقی به دیوانه خانه نشان میدهد که ایمان هیچ چیز را اثبات نمیکند. البته ایمان، تابحال نتوانسته است کوه های واقعی را تکان دهد، اما میتواند کوه ها را جایی که قرار ندارند قرار دهد. ایمان یعنی اینکه صبر نکنیم تا ببینیم چه چیزی درست است.

میلیونها انسان امروز به اینکه هیچ خدایی جز الله وجود ندارد و محمد پیامبر اوست ایمان دارند و هر روز بارها شهادت میدهند که به این دو چیز ایمان دارند. چند قرن پیش نیوتون دانشمند بزرگ یهودی قوانین جاذبه را کشف کرد و تئوریهایی در این باب ارائه کرد، از آن دوران تا به این دوران تئوریهای نیوتون پابرجا هستند، آیا میبینید که اشخاصی روزی ده بار بگویند ما شهادت میدهیم که قوانین جاذبه درست است و نیوتون کاشف جاذبه است؟

آیا لازم است برای اینکه قوانین جاذبه حفظ شوند انسانهایی به خود بمب ببندند و مخالفان این قوانین را نابود کنند؟ آیا لازم است که میلیاردها میلیارد بودجه ملتها خرج شود برای گسترش قوانین جاذبه نیوتون؟ آیا اگر کسانی با قوانین جاذبه نیوتون مخالفت کند، طرفداران قوانین نیوتون آنها را لعنت میکنند و یا میکشند؟ آیا اگر کسی به قوانین نیوتون اعتقاد داشته باشد و بعد عقیده اش عوض شود به او میگویند خائن و مرتد؟ پاسخ این سوالهای ساده نه است اما چرا؟ چون جاذبه بر استدلال و منطق و قوانین علمی پایدار است، کسی به قوانین نیوتون ایمان ندارد، این قوانین امروز درست هستند و فردا ممکن است درستی آنان زیر سوال برود (برای بحث مفصل تری در این مورد به «سفسطه ناقص بودن عقل» مراجعه کنید.) اما در مقابل مفاهیمی که به آنها باید «ایمان» آورد، مشتی تخیلات و حرفهای کودکانه و بی اساس و غیر علمی و حتی در بسیاری از موارد ضد علمی هستند. مثلا شما باید اعتقاد داشته باشید که طبق گفته قرآن حضرت سلیمان با سوسک و مورچه و جانوران صحبت میکرده است و آنها به سلام و صلوات و ذکر خداوند مشغول هستند. یا اینکه مثلا یونس در شکم ماهی زندگی کرده است و یا حضرت آدم از آسمان روی زمین افتاده است و بشر اینگونه خلق شده است!

و چون این مفاهیم بی پایه و اساس هستند و کاملا ماهیت آنها برای خردگرایان روشن است، خداپرستان مجبور هستند که برای حفظ این مقدسات خود کودکانه و لجوجانه روزی 100 بار بگویند من شهادت میدهم خدایی وجود دارد و الله تنها خدا است و محمد پیامبر اوست، در حالی که اگر استناد و دلیل روشنی برای این ادعاهای مسخره وجود داشت دیگر اینقدر نیاز به تکرار و لجاجت باقی نمیماند. مذهبیون با تکرار و دخیل کردن احساساتی همچون عشق و ترس، خرد خود و دیگران را تضعیف میکنند و تلاش میکنند به مزخرفات و باورهای خرافی علی رغم نابخردانه بودنشان باور داشته باشند. در هر دفاعی که از ایمان و دین میشود حمله ای نیز به خرد و عقلانیت صورت میگیرد. امانوئل کانت تمام کوشش خود را در آثار فلسفه دینی خود برای نشان دادن اینکه با خرد و استدلال نمیتوان خدا و وجودش را شناخت، انجام داد تا به قول خود «جایی برای ایمان بوجود آید».

بنابر این میتوان گفت ایمان داشتن یعنی اعتقاد بدون دلیل داشتن. شما وقتی به چیزی ایمان دارید که نه برای آن مدرکی دارید نه علت و استدلال معتبری. باور داشتن و اعتقاد داشتن و ایمان داشتن باهم بسیار متفاوت هستند. یک دانشمند مدتها بعد از مطالعه و تحقیق فرضیه هایی را ایجاد میکند و وقتی با انجام آزمایشهای متعدد و مختلف درستی این فرضیه ها را آزمایش میکند و بعد از اینکه فرضیه یا نظر خود را مستدل کرد به آن مفهوم جدید که این دانشمند ایجاد کرده است نظریه گفته میشود. نظریه ها با تئوریهای مختلف دیگر باید همخوانی داشته باشند و الا از مقام نظریه بالاتر نخواهند رفت. اگر هیچ دلیل محکم و تئوری ای علیه یک نظریه وجود نداشته باشد به آن نظریه تئوری گفته میشود. تئوری بالاترین مقامیست که یک مفهوم میتواند داشته باشد. در دنیای علم «حقیقت مطلق» و «قانون محض»  یا هر نوع قطعیت دیگری وجود ندارد (برای اطلاعات بیشتر در مورد علم، قضیه علمی، روش علمی و … به برگ «علم چیست» مراجعه کنید.). خیلی از چیزها مثل سرعت نور و قوانین حرکتی نیوتون تئوری هستند و نه حقیقت. اما مفاهیم دینی اینگونه هستند که یک انسان سود جویی آنها را مطرح میکند و نه لازم است که آنها را اثبات کند نه چرا و چگونگی آنها را اعلام کند و نه غیره و یک مشت باورمند به آنها نه به چشم فرضیه یا نظریه یا تئوری بلکه به چشم حقایق و قوانینی که در مورد آنها حتی نباید شک کرد ایمان می آورند و از شک کردن به آنها نیز در هراسند.

هر انسان خردمند و سالم مغزی برای باورهای خود به دنبال شواهد و مستندات و یا حداقل دلایل و استدلالهای معتبر میگردد و تنها به چیزهایی باور پیدا میکند که آنها را از فیلتر خرد خود عبور داده باشد. اما مذهبیون از شما میخواهند که بدون وجود شواهد و مدارک معتبر (1) به باورهای نابخردانه آنها همچون وجود خدا، روح، جن، امام زمان و غیره ایمان بیاورید، و سعی میکنند با وعده های سر خرمن بهشتی خود و همچنین ترساندن شما از داستانهای مسخره آتش جهنم شما را گول بزنند و خرد شما را کور کنند تا شما نیز بتوانید به اباطیل آنها باورمند باشید. (2) مسئله در آنجا بغرنج تر میشود که ایمان علاوه بر «باورمند بودن بدون وجود دلایل و شواهد» است، بلکه «انکار شواهد و دلایل موجود علیه باورهایی که مومنان به آنها ایمان دارند» نیز هست، انسان مومن مدارک و شواهد علیه باورهای خود را نیز کودکانه رد میکند و نسبت به آنها شک گرا نیست.

جایگاه ایمان اینچنین است. بعضی وقت ها هست که یکسری مفاهیم غلط به ارزش تبدیل میشوند. مثلا بعضی وقتها هرکس بتواند با زرنگی و ضایع کردن حقوق دیگران نوبت خود را در یک صف جلو بیاندازد، بعضی ها او را تمجید میکنند و زرنگی و زیرکی وی را تحسین میکنند. در مورد ایمان که برابر با جهالت و نادانی است نیز چنین اتفاقی بین مذهبیون افتاده است. مسیحیان بی پرده از ایمان کور صحبت میکنند و میگویند شما نباید زیاد از مغز استفاده کنید، با عشق مسیح را درک کنید. در نوحه خوانی های شیعیان شنیدم که خطاب به امام حسین میگفت «سر از تنم جدا کنی، چون و چرا نمیکنم». اینگونه جلوه میکنند که هرکس نادان تر و گوسفند تر است انسان والاتر و برتری است اما اگر ارزش انسانی را بر خرد و عقلانیت و تفکر وی بدانیم و قبول کنیم هرکس به اندازه ای انسان است که می اندیشد، مومنین واقعی و کسانی که از ایمان بالایی برخوردار هستند معمولا بیخرد ترین انسانها هستند.

نظر مارتین لوتر از کسانی که در پروتستانتیزم مسیحیت اگر نه نقش اول، حداقل از مهمترین نقش ها را بازی کرده است در مورد بکار بردن خرد و عقلانیت در مفاهیم دینی، شاید بتواند بیش از هر چیز به ما کمک کند تا ماهیت ایمان را و عقل ستیزی اش را بیشتر درک کنیم. مارتین لوتر خرد را «عروس شیطان»، «فاحشه زیبا»، «بزرگترین دشمن خدا»، خوانده است، گفته است «برای مسیحی بودن شما باید چشم خرد را از حدقه در بیاورید» و نوشته است «بر روی زمین در میان تمام خطرات، هیچ چیز به اندازه خردی بارور و زیرک خطرناک نیست، بویژه اگر این خرد بخواهد به مسائل روحانی که مربوط به روح (چرا روح وجود ندارد؟) و خدا (خداوند چیست؟) هستند وارد شود، زیرا آموختن خواندن و سواد به یک خر از هدایت کردن چنین خردی به راه راست، بسیار ممکن تر است. خرد را باید گول زد، کور کرد و سر انجام نابود کرد. ایمان باید تمام خرد را، احساس (دریافت حسی از محیط)، فهم و هرچه را که میبیند پایمال کند و از دید خارج کند، و هیچ نخواهد بداند بجز کلام خدا (3). و البته گفته مارتین لوتر در مورد کوپرنیکوس، کسی که تئوری مرکزیت زمین را رد کرد و ادعا کرد زمین دور خورشید میگردد و مرکز کائنات نیست نیز برای نشان دادن تفاوت ایمانگرایی و خردگرایی خالی از لطف  نیست، مارتین لوتر گفته است «این احمق (کوپرنیکوس) میخواهد تمام دانش ستاره شناسی را برعکس کند، اما کتاب مقدس به ما میگوید که یوشع به خورشید فرمان داد که بایستد نه به زمین».

اگر ایمان و خرد  را بتوان با مقداری عددی سنجید، حاصلضرب ایمان و عقل عددی ثابت خواهد بود یعنی هرچقدر ایمان بیشتر باشد عقل کمتر و هرچقدر عقل بیشتر باشد ایمان کمتر خواهد بود، عقل و علم دو روشنی مزاحم برای ایمان و دین هستند. هیچ حقیقت علمی مطلقی در دنیا وجود ندارد و هر نظریه علمی ممکن است روزی غلط از آب در بیاید، خود این ادعا هم در این قضیه استثنا نیست و ممکن است این ادعا هم غلط از آب در بیاید. این به این معنی نیست که مفاهیم بی پایه و بی اساس هستند، بشر با استفاده و اتکا به تئوریها و همین مفاهیم علمی کارهای فوق العاده بزرگی انجام داده و انجام خواهد داد، بنابر این تئوریها ملاک عمل و ادراک هستند. مذهبیون به این نوع دید عادت ندارند و فکر میکنند باید به مفاهیم ایستای دینی اعتقاد داشت در حالی که همین مفاهیمی که ما به آنها تئوری میگوییم اما آنهارا حقیقت مطلق نمیدانیم هزاران و هزاران بار از آن مفاهیمی که مذهبیون به آنها ایمان مطلق دارند و آنها را حق و حقیقت مطلق میدانند محکم تر و با پایه تر و مستند تر است چون روش تفکر ما روش علمی است نه روش تخیلی و سوفسطایی دینی!

خردگرایی در مقابل دین خویی تعریف میشود و فرق یک خردگرا با یک دین خو در همین مسئله ایمان نهفته است. در مورد خردگرایی و چیستی آن در اینجا بخوانید.

توضیحات:

========================

1- برای اثبات وجود خدا هیچ دلیل و مدرک معتبری وجود ندارد، میتوانید ردیه ها و نقد های براهین اثبات وجود خدا را در بخشی با فرنام «رد براهین اثبات وجود خدا» بیابید.

2- برای بحث جالبی در این زمینه به نوشتاری با فرنام «دلایل خوب و بد برای باور داشتن» مراجعه کنید.

3- Walter Kaufmann, The Faith of a Heretic, p. 75

خداوند چیست؟

نویسنده – آرش بیخدا

«وقتی کودک بودم از خدا میخواستم که به من یک دوچرخه هدیه بدهد، بعد از چند سال دیدم خبری از دوچرخه نیست، یک دوچرخه دزدیدم و از آن پس از خدا خواستم که مرا ببخشد، گویا خدا اینگونه کار میکند.» امو فیلیپس (Emo Philips)

  • پیشگفتار
  • چرا باید تعریف مشترکی از خدا مورد توافق قرار گیرد؟
  • خدا در فلسفه دین
  • خدا در قرآن
  • واژه خدا در پارسی و اهمیت آن
  • خدا در گفتار روزانه
  • خدا پس از بیخدایی

پیشگفتار

تعریف کردن واژه خدا بسیار مشکل ساز است، زیرا هر یک از خداباوران حتی بیخدایان برای خودشان تصورات متفاوتی از خداوند دارند و این اجازه را به خود میدهند که خداوند را آنطور که خود میپندارند تعریف کنند. میتوان گفت به تعداد انسانهای موجود بر روی زمین خداوند وجود دارد و خدایان مختلف ویژگیهایی را دارند که خداپرستان مختلف آنها را میپرستند.

معمولا خدای آدمها شبیه خود آدمها است،‌ بگونه ای که گویا خدای هر آدمی تصور آن آدم از کاملترین موجود است. تلاش این نوشتار در دو بخش نخستین این است که واژه خدا را به گونه ای معنی دار و قابل بحث تعریف کند بگونه ای که مخاطب بتواند شناخت بهتری از مطالب فلسفی نوشته شده در مورد پرسش وجود خدا پیدا کند. در پایان این نوشتار چند بخش پیرامون نکاتی مرتبط و دارای اهمیت با واژه خدا همچون واژه خدا در زبان پارسی و پیشنهاداتی برای واژه های جایگزین برای گفتار روشنتر خواهید یافت.

چرا باید تعریف مشترکی از خدا مورد توافق قرار گیرد؟

خردمندانه این است پیش از گفتگو در مورد وجود یا عدم چیزی سخنی،‌ در مورد چیستی آن چیز سخن گفت. اگر قرار باشد دو نفر در مورد وجود خدا سخنانی معنی دار رد و بدل کنند آنگاه باید هردو دستکم در مورد اینکه خدا چیست با یکدیگر به همفکری و توافق نظر رسیده باشند،‌ در غیر این صورت گفتگویشان یا تنها آواهایی تهی از معنی است یا برای بیان به مفسر و چندین سخنرانی نیاز دارد، و انسانها با گفتار معنی دار با یکدیگر تبادل نظر میکنند. به عبارت دیگر این پرسش که «خدا چیست؟» مقدم بر پرسش «آیا خدا وجود دارد؟» است. افزون بر این «خدا چیست؟» پرسشی است که میتوان در مورد هر گفته ای که واژه «خدا» در آن استفاده شده است پرسید.

جدا از این، برای اینکه یک انسان در مورد خدا بطور جدی تفکر و تحقیق کند،‌ باید بداند راجع به چه تحقیق میکند،‌ مگر میشود کسی که نمیداند یا نمیتواند اسب را تعریف کند در مورد اسب تحقیق کند؟ اینکه شخصی قادر به تعریف خدا نباشد، اما همچنان خدا را باور داشته باشد مانند این است که شخصی به وژولک معتقد باشد، و قادر به تعریف یا توصیف وژولک نباشد،‌ آیا چنین باوری بخردانه است؟ اینکه خدا چه هست و چه نیست باید برای یک انسان خردمند آنقدر روشن باشد که اگر یکروز سر کوچه از کنار خدا رد شد بتواند او را بشناسد. کسانی که خداباورند اما تعریفی برای خدا ندارند نمیتوانند سخنی معنی دار راجع به خدا بگویند، چون نمیتوانند به چه اعتقاد دارند. آیا اگر خدایی وجود میداشت ترجیح میداد که انسانها از روی نادانی او را بشناسند؟ آیا این خردمندانه و حتی اخلاقمدارانه است که از کسی انتظار داشت تمام عمر خود را با فرض وجود چیزی به نام خدا زندگی کند در حالی که حتی نمیتواند آنرا تعریف کند؟

حتی در ابتدای رساله های مراجع تقلید نیز تاکید میشود که اعتقاد به توحید باید عقل محور و غیر تقلیدی باشد،‌ اما بسیاری از مردم معتقد به اسلام در تعریف خدا عاجزند. جای شگفتی ندارد چون اسلامگرایان از نشر افکار مخالف در سطح اجتماع بسیار میترسند،‌ از اینرو تفکر در این زمینه در حال سقوط است چون یک طرف تمام بلندگوها را دزدیده است.

بسیاری از متفکران خداباور معتقدند انسان هرگز نخواهد توانست خدا را بطور کامل بشناسد. از اینرو برخی از تلاش برای تعریف خدا طفره میروند. به دو دلیل یکی اینکه از یک چیز گنگ دفاع کرن در بحث های پیرامون خدا به آنها در کیش و مات نشدن در بحث ها یاری میرساند،‌ و دو اینکه آدمهایی ضعیفی هستند و حاضر نیستند جدی ترین افکار خود را خردگرایانه مورد بازبینی قرار دهند. در پاسخ به این دیدگاه میتوان گفت مگر انسان میتواند چیز دیگری را کامل بشناسد؟‌ مگر کسی وجود دارد که ریاضیات را کامل بشناسد؟‌ آیا کسی هست که با تمام مفاهیم تمام شاخه های ریاضی آشنایی کامل داشته باشد؟‌ برای رسیدن به چنین جایگاهی دست کم چند صد سال عمر لازم است،‌ البته در این میان چیزهای جدیدی نیز به ریاضیات اضافه خواهند شد. آیا این باید جلوی ما را از تلاش برای شناخت ریاضیات بگیرد؟‌

افزون بر این برای تعریف یک چیز لازم نیست آن چیز کاملا شناخته شود،‌ تنها کافیست عبارتی آورده شود که با استفاده از مفاهیم آشنا،‌ نشان دهد که آن چیز چیست،‌ و چه نیست،‌ و انجام اینکار از اتفاق همانطور که در بخش بعدی خواهد آمد چندان دشوار نیست. یکی از سخنرانان معروف اهل عرفان میگفت زمانی به خدا رسیده ای که نتوانی آنرا تعریف کنی. این ممکن است برای افراد دین خو قابل پذیرش باشد اما برای یک فرد خردگرا (خردگرایی چیست؟) تنها نشان از خاموش کردن غیر مسئولانه قوای عقل است و گویندگان چنین سخنی به درستی میدانند که اگر روشن و دقیق به خدا فکر کنند آنگاه دیگر خدایی وجود نخواهد داشت. این دست سخنان ضد عقل در نوشتاری جدا با فرنام «آیا عقل بشر ناقص است؟» مورد چالش قرار گرفته اند.

در پایان این بخش باید گفت شناخت خدا برای یک انسان پس از بیخدایی بسیار آسانتر میشود چون اگر خدایی وجود نداشته باشد آنگاه خدا ساخته بشر است،‌ و وقتی بشر چیزی را میسازد معمولا از آنچه در اطراف او موجود است استفاده میکند. بنابر این تعریف و شناخت خدایی که وجود ندارد بسیار آسان است بخصوص وقتی انسان میلی به وجود او نیز نداشته باشد.

خدا در فلسفه دین

در فلسفه دین، تعریف مورد توافق معمولا این است که خدا موجودی از همه جهت کامل یا Omni-max است،‌ یعنی اگر او دارای چیزی است،‌ آنگاه آنرا در حد کمال دارد،‌ در نتیجه:

  • در دانش،‌ همه چیز را میداند – علیم –  ‌Omniscience
  • در کنش،‌ هر کاری را میتواند انجام دهد – قدیر – Omnipotent
  • در نیکی – نیکوترین است – Omnibenevolent
  • در مکان – همه جاست – Omnipresent

این تعاریف، مفاهیمی هستند که سالها و قرنها و هزاره ها مورد بحث و جدل و گفتگوی فلاسفه بوده اند. از فلاسفه یونان باستان گرفته تا کلاسهای درس دانشگاه های امروز دنیا. مفاهیمی هستند که حتی در شکل گیری تصور خدا در ادیان سامی نقش تاریخی داشته اند.

این تعاریف در بحث های تخصصی دینی در مراکز سکولار و غیر سکولار دنیا معمولا مورد توافق قرار میگیرند. اما روشن است که بشر از واژه خدا بطور گسترده به معانی مختلف نیز استفاده میکند. اعتقاد اکثر خداباوران دینی چه در ادیان زنده چه مرده معمولا بر این است که خداوندشان، چه الله باشد، چه یهووه، چه مسیح، چه اهوره مزدا، چه زئوس و میترا و آتون و هرا، چنین ویژگیهایی دارد :

  • یک موجود/وجود است و وجود داشتن او عینی است.
  • خالق است.
  • دارای شخصیت است، دارای شعور و اختیار است.
  • ناظم و نگهدارنده و ناظر است.
  • خیر و نیک است.
  • مهربان است.
  • زیبا است.
  • بزرگ است.
  • بخشنده و عادل است.
  • ماورای طبیعت است و غیر مادی و غیر فیزیکی و بدون بدن، و ماوراء طبیع است.
  • ازلی و ابدی است و جاودان است.
  • بدون اشکال و کامل است.
  • در ذات خود ثابت است.
  • بینهایت است.
  • بی همتا است
  • مقدس  است.

پس از توافق بر اینکه خدا چیست نخستین سلسله پرسشهایی ها در مورد اینکه آیا خدایی با چنین صفات میتواند وجود داشته باشد شکل میگیرد. چون چیزی که در تعریفش تناقضی وجود داشته باشد مانند دایره چهار ضلعی حتی معنا ندارد چه برسد به اینکه وجود داشته باشد. نوشتارهایی در این مورد را میتوانید در بخش براهین منطقی اثبات عدم وجود خدا بیابید.

با داشتن معنایی روشن و مشترک در مورد خدا میتوان بطور منطقی در مورد وجود یا عدم وجود او استدلال کرد. تارنمای زندیق،‌ رایج ترین و معروف ترین دلایل وجود خدا را بطور مفصل رد میکند:

خدا در قرآن

میان تصوری که یک مسلمان امروزی نسبت خدا دارد و نقشی که قرآن از خدا ترسیم میکند معمولا تفاوتهای بسیار فاحشی وجود دارد. باوری که در ذهن مسلمانان وجود دارد بیشتر زاییده تخیلات خودشان است،‌ یا در صورتی که در این زمینه تحصیل کرده باشند بیشتر شبیه فلاسفه مسلمان و سنت فکری اسلامی است که اندیشمندان اسلامی سالها و قرنها پس از حیات محمد با توجه به آشنایی که با فلسفه یونان باستان و سایر ادیان موجود در منطقه همچون مسیحیت و یهودیت و آیینهای باستانی ایرانی در دوره هایی از تاریخ که اسلام از شبهه جزیره عربستان به ایران باستان،‌ یعنی جایی که تفکر و مدرسه از پیش وجود داشت و مدرسه و دانشگاه و تفکر پیشینه ای عمیق داشت شکل گرفت. در این دوره اسلام دیگر نمیتوانست تنها با توحش و خشونت پیش برود،‌ چون اسلام بطور گسترده بر مردم حکومت میکرد و نیاز به قاضی و فقیه و اندیشه سیاسی بود،‌ مسلمانان نمیتوانستند تنها با قرآن یا شمشیر از اسلام دفاع کنند، لذا نیاز به تولید فکر بود. جزئیات بیشتری در این زمینه را میتوانید در نوشتاری با فرنام آیا اسلام برای ایران علم آورد بخوانید.

پس از تعریف بالا از خدا اکنون زمان خوبیست که این مفهوم با آنچه در قرآن الله نامیده میشود مقایسه شود. خدای قرآن با خدایی که فلاسفه بزرگ خداباور از آن یاد میکردند بسیار متفاوت است،‌ چون خدایی نیست که از روی خرد ساخته شده باشد،‌ بلکه خداییست که به کار محمد می آمده است.  بنابر این توصیفات قرآن از خدا بسیار ابتدایی. خدای قرآن خدایست که عواطف  و رفتارهای انسانی دارد،‌ خشمگین میشود،‌ مکر میکند. آیاتی در قرآن وجود دارد که خدا را ناتوان و نادان نشان میدهد. جدا از این محمد و اطرافیانش طبیعتا به اندازه ای که مسلمانان بعدها از یونانیان در دوره عباسی پیرامون  وجود از نوع فراطبیعی آموختند، چیزی در این زمینه نمیدانستند. به همین دلیل خدا در قرآن اتفاقا بسیار فیزیکی است. در قرآن توصیفات خنده داری از خدا یافت میشود مثلاْ اینکه او حرکت میکند، دارای مکان و عرش است،‌ چشم و چهره و ساق دارد و حتی یک شیء خوانده شده است. برای مدارک و توضیحات بیشتر به نوشتاری با فرنام مقایسه الله و خدا مراجعه کنید.

واژه خدا در پارسی و اهمیت آن

در بسیاری از گفتگوها با پارسی زبانان شنیده میشود که خدا یعنی «به خود آمدن». برای من که با غیر پارسی زبانان نیز در مورد خدا بسیار گفتگو کرده بودم همواره این پرسش بوجود می آمد که چرا دیگران هیچوقت راجع به خدا چنین تعریفی نمیدهند؟ نه مسیحیان غربی نه حتی همسایه های عرب. جدا از این من آموختم که اکنون پس از ۱۴۰۰ سال از ظهور اسلام تقریبا در هیچ کشور غیر عرب اسلامزده، واژه ای غیر از الله برای خدا استفاده نمیشود، این تنها در ایران و یا در نقاط همسایه که روابط فرهنگی نزدیکی دارند دیده میشود. مثلا در ترکیه و پاکستان و اندونزی مردم مسلمان از در عباراتی مشابه «خدا حافظ»، «خدا را خوش نمی‌آید»، «ای خدا» دارند اما از خود واژه «الله» که نام رسمی خدا در اسلام است استفاده میکنند و واژه ای جایگزین در زبان محلی ندارند.

باید دانست زبان یک وسیله است،‌ ما انسانها همچون بسیاری از جانداران دیگر با تولید امواج صوتی با یکدیگر ارتباط برقرار میکنیم و پروتکل این ارتباط زبانیست که با آن سخن میگوییم و زبان در اصل همین است و بیش نیست، به همین دلیل تضمینی وجود ندارد که این واژه ها با حقایق و دنیای اطراف ما رابطه اینهمانی داشته باشند،‌ گاهی زبان ممکن است موجب گیجی و سردرگمی شود. برای نمونه اگر واژه «خدا» در پارسی امروزی وجود  نمیداشت و تنها واژه «ایزد» وجود میداشت آنگاه نوشتن این چند پاراگراف در این نوشتار ضرورتی نمی‌داشت.

اما این زبان بعدی تاریخی نیز دارد، میراثی است از گذشته و نتیجه تجربیات و تفکراتی که در میان یک مردم از نسلی به نسل دیگر از پدر و مادر به فرزند، به رایگان و با مهر داده شده. گفته اند زبان ما چیزهایی راجع به ما میداند که خود ما آنها را نمیدانیم. زبان یک مردم را تا حدود زیادی ادبا و اندیشمندان آن مردم شکل میدهند و از آنجا که ما مورد آزار و تازش اسلام بوده ایم ادبای ما با بیشترین نفوذ فرهنگی خود نگاهی بسیار نقادانه به دین داشته اند.

حافظ برای نمونه زاهدین را افرادی دارای پست ترین رفتارها نشان میدهد و چپ و راست به زاهد که همان آخوندهای امروزی باشند بد و بیراه میگوید، آنها را دو رو و نادان و کوته فکر نشان میدهد. مولوی موسای قرآن را به موسایی فهیم در موسی و شبان تبدیل میکند. روزی در گفتگویی پیرامون درگیری اسراییلیها با فلسطینی ها از یک مرد یهودی غیر ایرانی شنیدم که به داستان موسی و شبان اشاره میکرد و آنرا نشان از این میدانست که یهودیان اهل مدارا و فهم و زندگی و دوستی هستند. قدرت و زیبایی این داستانها در حدی است که این شخص نمیدانست این داستان ربطی به تورات و یهودیت ندارد و داستانی ساخته مولوی است. موسای کتابهای دینی یهودیان در شعور و فهم و مدارا فرقی با نوح که به باور مسلمانان و یهودیان با همکاری الله یا یهوه دست به کشتار جمعی تمام بشریت به غیر از خانواده خودش میزند کجا و موسای مولوی کجا؟ این حکمتها که آنها را از کودکی با شیرین ترین سخنان آهنگین و به یادماندنی می‌آموزیم در شکل گیری تصور ما از خدا نقش مستقیم دارند. این خدا در ذهن خداباوران ایرانی بسیار متفاوت است با خدای قرآن. جایگزینی واژه خدا در زبان پارسی در نتیجه یک پیروزی است بر اسلام و نتیجه تلاش پیشینیان است برای کم رنگ کردن آموزه های راستین اسلامی و جایگزین کردن آنها با آموزه هایی برتر.

این دیدگاه که خدا یعنی به خود آمدن،‌ باوریست کاملاْ‌ سازگار با فرهنگ ایرانی و ناسازگار با مفهوم خدا در اسلام و سایر ادیانی که باور دارند و نشان از آن دارد که پس از تازش اسلام به ایران،‌ ایرانیان همچنان خدایان خود را دارند.

اگر خدا تنها به معنی «به خود آمدن» باشد و نه خالق بشر و موجودی واقعی که در جایی خارج از خود ما وجود داشته باشد آنگاه دیگر این خدا،‌ آن خدای قرآن و سایر ادیان نیست. بلکه انسانیست که متوجه شده است انسان است، زیباییها و والاییهایی در واقع خدا شده است. بیخدایان نیز همینگونه فکر میکنند. به عبارت دیگر آموزه های غیر اسلامی و عرفانی ایرانی و شناختی که آنها از انسان دارند،‌ تا آنجا که انسانی باشند و نه اسلامی چیزهایی هستند که هر ایرانی از آنها بهره میبرد چه خداباور و چه بیخدا. این نوع نگاه معنوی به مفهوم خدا متفاوت از نگاهی تحلیلی است که معمولا در فلسفه دین به خدا وجود دارد.

گاهی این موضوع در گفتگوها بهانه ای در دست خداباوران ایرانی برای فرار از بحث واقعی در مورد وجود خدا است. روشن است که این قضیه بیشتر به کمبودهای زبان بعنوان یک ابزار برای ارتباط بر میگردد. دو فرانسوی هرگز در هنگام بحث در مورد خدا به اینکه خدا یعنی به خود آمدن بحث نمیکنند. همچنین غیر منطقی است که شخصی به دلیل اینکه نام یک فکر یا چیز را خدا گذاشته است،‌ خود را خدا باور معرفی کند. مانند اینکه من تصمیم بگیرم از این پس به هویج بگویم خدا، سپس نام خود را خداباور بگذارم چون هویج طبیعتا وجود دارد.

اما نگاه عرفانی و غیر فلسفی به زندگی و همه چیز نیز در جای خود دارای ارزش و برای برخی مفید و آموزنده است. تارنمای زندیق در تقابل با خدای عرفانی کوشا نیست چون تارنمای زندیق پیرامون بحث تحلیلی و موشکافانه است نه عرفانی و ادبی. اما بیخدایان از این دید نیز به خدا نگاه کرده اند. برای نمونه آثار نیچه و سایر فلاسفه غیر تحلیلی که همچون مثتنوی مولوی داستانوار و بیشتر ادبی و هنری هستند،‌ یا ادبای عصر روشنگری اروپا همچون ولتر دیدگاه هایی در ضدیت با خدا بیان میکنند که در فرهنگ ما به آن میگویند نگاه عرفانی.

خدا در گفتار روزانه

من گاهی در برخورد با برخی از افراد که تحت تاثیر آموزه های اسلامی چندان راجع به خدا فکر نکرده اند، دیده ام که گویا تصور میکنند خداباورند چون در گفتار روزانه از واژه خدا استفاده میکنند. یا شنیده ام که گاهی تصور میشود شخصی خداباور و در نتیجه خرافاتی است چون از عباراتی مانند به نام خدا،‌ بنده خدا،‌ ترا به خدا،‌ خدا را خوش نمی آید و غیره استفاده میکند. این تنها یک عادت زبانی است و ما نیاز به تغییر زبان پارسی نداریم،‌ زبان ما آنقدر غنی است که بدون واژه خدا حتی ساده تر و زیباتر میشود، تنها کافیست به اینکه چرا از واژه خدا استفاده میکنیم فکر کنیم و بجای آن منظور خود را با عبارات روشنتر و حقیقی تری بیان کنیم.

جدا از این امروزه در شهرهایی که مراکز مهم جمعیتی دنیا هستند،‌ در جاهای عمومی مانند مدرسه، دانشگاه،‌ بیمارستان،‌ پیاده رو،‌ محل کار و غیره مردم از عبارات دینی و واژه خدا استفاده نمیکنند و این بایسته یک جامعه مدنی متنوع است و تنها از روی نیکی و خیر خواهیست. در این جوامع مردم در مسجد و کلیسا از واژه خدا استفاده میکنند. مگر اینکه خداباوری تصمیم بگیرد خداباوری را بگستراند. از این رو پیشنهاداتی برای جایگزینی واژه خدا در زیر تقدیم میشود.

  • به نام خدا– معمولا در ابتدای سخنان جدی گفته مشود تا توجه مخاطبان جلب شود و سخنان یا کلاس درس شروع شود. بجای آن میتوانید بگویید با درود،‌ یا به مخاطبان روی خوش نشان داده،‌ به آنها خوش آمد گفته و از آنها سپاسگزاری کنید که وقتشان را به شما داده اند
  • انشاء‌الله– معمولا برای ابراز امیدواری برای وقوع چیزی مثبت در آینده گفته میشود،‌ در بیشتر مواقع بجای آن میتوانید بگویید امیدوارم. مثلا بجای انشاء الله عروس بشی بگویید امیدوارم عروس بشی
  • خداوکیلی– سوگند خوردن یک رسم قدیمیست و در جای خود مثلا در دادگاه کاربرد خود را دارد. و یک انسان به جای اینکه به خدا سوگند بخورد میتواند فقط سوگند خالی بخورد. خارج از دادگاه بد نیست آدم اعتبار از دیگران کسب کند تا مردم او را بدون قسم خوردن نیز باور کنند. آدمهای کلاه بردار و دروغگو به قسم خوردن نیاز شدید دارند. در برخی از موارد بجای پای خدا و اهل بیت را وسط کشیدن میتوان تنها گفت،‌ باور کن
  • خداییش– برای تاکید بر اینکه باید واقع بین و منصفانه به چیزی نگاه کرد گفته میشود. بجای آن میتوان گفت اگرچه،‌ براستی،‌ در حقیقت،‌ اگر منصفانه نگاه کنیم
  • خدا را خوش نمی آید– زمانی استفاده میشود که کاری کمی تا قسمتی غیر اخلاقی در شرف وقوع است،‌ بجای آن میتوان گفت کار درستی نیست،‌ کاری غیر اخلاقی است
  • خدا خواست– معمولا برای نشان دادن فروتنی در مورد چیزی که خواست ما بوده است و اتفاق افتاده است گفته میشود، بجای آن میتوان گفت،‌ کار جور شد،‌ یا آنطور که میخواستیم شد،‌ اوضاع بر وفق مراد شد

خدا پس از بیخدایی

تصور بیخدایی برای برخی خداباوران سخت است اما اگر فکر کنند متوجه خواهند شد که تجربه بیخدایی را دارند. برای نمونه یک هندو نسبت به خدای اسلام بیخداست و یک مسیحی به خدای اسلام باور ندارد و یک یهودی به خدای مسیحیت باور ندارد.

پس از بیخدای واژه خدا برای یک انسان تبدیل به واژه ای میشود که با توجه به مخاطب میتواند معناهای متفاوتی داشته باشد. با مسافرت به جاهای مختلف دنیا و سخن گفتن با آدمهای مختلف به سادگی میتوان درک کرد که آدمها برای خدا واژه میسازند، و تعریف آنها از خدا به خرافات محلی آنها ارتباط دارد، چرا که آدمها خدا را ساخته اند،‌ لذا خدایان در واقعیت پدیده هایی جغرافیایی، تاریخی است همچون سایر رسوم و رفتارهای مردم. و گاهی نیز در میان جمعیتهای بزرگی از مردم همچون بودایی ها حتی وجود ندارند،‌ چون بسیاری از ادیان خدامحور نیستند. بر خلاف خدایان اما رفتار محترمانه،‌ دوستانه،‌ لبخند زدن را همه انسانها میپسندند.

خدایان در طول تاریخ تفاوتهای بسیار کرده اند و کاملتر و پیچیده تر شده اند و یک نگاه مختصر به تاریخ هر ملتی نشان میدهد آن ملت هرچه در دانش و فلسفه بیشتر پیشرفته میشدند خدایانشان نیز به همین نسبت پیشرفته تر میشدند این بخوبی نشان میدهد که خدایان ساخته و پرداخته ذهن بشر هستند. به قولی میتوان گفت این خدا نیست که ادیان را روی زمین میفرستد، بلکه ادیان هستند که خدا را روی آسمان میفرستند. انسانها که خود را موجودات موقتی میدانسته اند و موجودیت خود را از موجودات قبلی میدانسته اند، موجود اولیه را که یک موجود اشتباه هم هست «واجب الوجود» نامیده اند، که این را میتوان تعاریف دیگری برای خداوند دانست. یکی از بزرگترین اشتباهاتی که انسانها را به خدا باوری میکشاند قضیه خدای حفره ها است، که در نوشتاری با فرنام خدای حفره ها چیست؟ به توضیح آن پرداخته شده است. مقایسه بسیار جالبی از خدایان ادیان سامی در بخش سوم کتاب تولدی دیگر آمده است.

اسپینوزا فیلسوف یهودی الاصل هلندی با مطالعه دقیق کتب دینی به نتیجه ای مشابه رسید و گفت «اگر مثلث میتوانست صحبت  کند، خدا را به شکل یک مثلث معرفی میکرد و اگر دایره میخواست خدا را تصور کند وی را دایره وار تصور میکرد». خدایی که هیتلر به آن اعتقاد داشت هیتلر را بر بقیه نژادها برتر میدانست و خلاصه اینکه  شخصیت افراد را از خدایی که تصور میکنند میتوان فهمید، اگر شخصی اعتقاد دارد که خدا مهربان است و همه را میبخشد میتوان دانست که او مهربان و باگذشت است، اگر شخصی مثل حضرت محمد خدایش جنایتکار و است و سادیست و عقده دارد و در حلق کافران مس ذوب شده میریزد میتوان دانست که این شخص خودش چنین خلق و خویی داشته است و همین به سادگی نشان میدهد که بشر خداوند را می آفریند نه خداوند بشر را.

خدا ممکن است بخش بسیار بزرگی از زندگی یک خداباور را اشغال کند،‌ چون او چگونه زیستن را خود نیاموخته است،‌ اما پس از بیخدایی خدا دیگر دارای اهمیتی نیست و مگر اینکه با یک خداباوری روبرو شوند، یا به دلیل مزاحمتها و آسیبهای دین به زندگی اجتماعی و شخصی خود لب به سخن بگشاید،‌ اما بیخدا راجع به خدا چندان فکر نمیکنند. خداوند موجودیست افسانه ای، همچون جن، پری، سیمرغ، دراکولا و امام زمان، که انسانها چون در مقابل نیروهایی طبیعی و مادی احساس ضعف میکردند اختراع کرده اند تا خود را با آن گول بزنند و خود را بی پشت و پناه احساس نکنند. انسانها در مقابل مرگ احساس ضعف میکردند و نمیخواستند باور کنند مرگ نابودی ابدی جسم آنهاست، در مقابل طبیعت احساس ضعف میکردند و نمیخواستند قبول کنند طبیعت میتواند برای آنها تصمیم بگیرد، برای همه این ترسها و بیم ها خداوندانی را خلق کردند تا مانند برادر بزرگتری همراه آنها باشد و از آنان مواظبت کند. یک بیخدا برای خوب زیستن نیازمند چنین اباطیلی نیست.

نکاح چیست؟

لغتنامه انگلیسی به  عربی بر روی اینترنت:

nekah-1

 

منبع +

 

 

nekah-2

منبع +

فرهنگ دهخدا:

نکاح منقطع. رجوع شود به صیغه شود. (مص) گاییدن. (از منتهی الارب). مجامعت کردن. (تاج المصادر بیهقی) (زوزنی). جماع کردن. (آنندراج). زناشویی کردن. (فرهنگ فارسی معین): و دعوی های بزرگ کردند چون نکاح بنات و اخوات و نکاح غلامان. (کتاب النقض ص 329). غالب شدن خواب بر چشم کسی. (از ناظم الاطباق) (از اقرب موارد) (از متن الغسه) تر کردن باران زمین را….

آیا شما به همسرانتان نکاح میکنید یا پیمان زناشویی دائم میبندید؟

تجدد مدرنیسم چیست؟

با یکی از برادران طرفدار نظام آقا امام زمان گفتمان میکردم، ادعا داشت نظام آقا امام زمان یک نظام دموکراتیک است، به او گفتم دموکراسی مربوط به جامعه مدرن است، جامعه ای که پیشا مدرن است نمیتواند دموکراتیک باشد، برادر در پاسخ گفت ما در مملکت آقا امام زمان فلان قدر دانشجو داریم، خودرو تولید میکنیم و داریم به تکنولوژی اتمی دسترسی پیدا میکنیم، جامعه ما مدرن است!

خیلی ها، مثل این سرباز گمنام امام زمان تا کلمه مدرنیسم را میشنوند به سرعت به فکر ماشین و چرخ دنده و هواپیما و آسمان خراش و ساختمانهای زیبا و دستگاه های الکترونیکی پیشرفته می افتند در حالی که مدرنیسم و یا مدرن بودن بر خلاف این استفاده ای که در زبان فارسی از آن میکنیم (مثلا میگوییم این تلویزیون مدرن تر از آن تلویزین است) معنی و مفهومی عمیق تر دارد.

مدرنیسم در واقع یک فرایند و جریان تاریخی است که در عرصه های متنوع و مختلفی چون فلسفه، علم، سیاست، اقتصاد، هنرو… تاثیر کاملا مستقیم میگذارد. هر کشوری که در آن بمب اتم تولید شود کشور مدرنی نیست! مدرنیسم و یا تجدد  فرایند گسترش خردگرایی در جامعه است.جامعه متجدد بالاجبار عرفی میشود و عرصه ها هر چه محدود تر از هستی فردی و اجتماعی زیر نگین الهیات و دین باغی میمانند. میگویند تجدد یک پدیده غربی است و وقتی آغاز شد که دن کشیوت دیگر به تعاریف دیگران از دنیای خارج بسنده نکرد و به راه افتاد تا دنیا را خود ببینید و تجربه کند.

تجدد به معنی به دور انداختن آنچه تا کنون داشته ایم نیست، بعضی ها فکر میکنند تجدد یعنی غربی شدن، یعنی اینکه گردن بند کلفت به گردن بیاندازند و بجای باشد بگویند OK! بلکه تجدد به معنی نگاه کردن منصفانه و خردمندانه و علمی به گذشته و کنار گذاشتن زشتیها و بدیهایش و اصلاح و تغییر یا حذف عوامل آن پلیدی هاست. تجدد خود شناسی دقیق تاریخی است. تجدد با بی بتگی و بی هویتی عجین نیست. بر عکس، تجدد واقعی را با خودشناسی اصیل همراه است. تجدد است که میتواند یک فرهنگ را ماندگار کند و الا فرهنگ پوسیده و غلط ایستا رو به زوال خواهد رفت. تجدد همان پویایی ای است که در مقابل ایستایی دینی (چه با اجتهاد و این مسائل مسخره اش و چه بی اجتهاد) قرار دارد. فرایند تجدد زندگی خصوصی و عمومی مردم جوامع سنت زده را به شدت در تمام عرصه ها متحول میکند.

حال بیایید تجدد را در عرصه های مختلف به اختصار بررسی کنیم.

تجدد در عرصه سیاست:

خداوند هرگز تابحال بر روی زمین نیامده است تا حکومت کند (حد اقل در ادیان سامی، و الا در تاریخ ادیان میبینیم که خدایان ابتدا بین مردم زندگی میکردند و کم کم به سوی آسمان تصعید شدند.)، همیشه یک شخصی بوده که یا ادعای خداوندی میکرده و یا اینکه میگفته من نماینده خداوند بر روی زمین هستم پس بنابر این حاکمیت مردم با من است من حاکمم و مردم رعیت، من ولی هستم و مردم صغیر. در زمانهای گذشته این کار آنقدر شایع و باب بوده است که میتوان حتی گفت دین اصولا برای همین موضوع طراحی و ساخته شده است، بعنوان نمونه میتوان در تاریخ از فرعون و کلیسای کاتولیک در دوران تاریخ سیاه اروپا و در حال حاضر از سید علی خامنه ای مقام معظم رهبری ایران یاد کرد، به این نوع حکومت های تمامیت خواه و دینی حکومت های تئوکراتیک (Theocratic) میگویند. در این حکومت ها معمولا گفته میشود که حکومت از آن خداست و خوب البته همانطور که گفته شد خداوند که روی زمین نمی آید، پس حکومت بر عهده کشیش ها و آخوند ها و موبدان و این جانوران الهی است اما آنها خود را به پدیده ای تخیلی به نام خدا میچسبانند. که البته تجدد در غرب جانوران الهی غربی یعنی کشیش هارا سر جایشان نشاند اما در ایران هنوز این جانوران آزادانه میچرخند و تکلم میکنند. بنابر این، این تجدد است که سیاست را از الهیات و الهیات را از سیاست دور میکند.

در این نوع حکومت ها مردم مکلف هستند، یعنی تکلیف دارند، بسیار از ملا تیوی میشنویم که فلان کار یک تکلیف شرعی، میهنی و… است، افراد مطیع امر رهبر هستند و با مغز های رهبران عمل میکنند. حکومت در این جوامع ودیعه ای الهی است. اما در جامعه مدرن، مردم شهروند هستند، و به جای مکلف بودن محق هستند یعنی حقوقی دارند که این حقوق باید توسط حاکمان پرداخته شود. مثلا مردم حق دارند که آزادی اندیشه و بیان و پوشش داشته باشند و دولت وظیفه دارد این شرایط را ایجاد بکند. مردم دیگر مطیع امر رهبران نیستند بلکه این رهبرانند که مطیع امر مردم هستند و اینبار این حاکمین هستند که باید بر اساس مغز مردم عمل کنند. حکومت در جامعه مدرن یک قرارداد اجتماعی است بین حاکمین و محکومین، مردم اشخاصی را انتخاب میکنند که آنها به ارباب خود که همان مردم باشند خدمت کنند نه اینکه حاکمین مردمی را انتخاب کنند که به اربابشان که حاکم و ولی فقیه و نظامش است خدمت کنند!،  خداوند هم این وسط اصولا هیچ کاره است، یعنی در جامعه متجدد حاکمیت مردم به جای حاکمیت خداوند و ظل الله و نمایندگان خداوند میشود.

در حکومت تئوکراتیک شعار «مرگ بر ضد ولایت فقیه» سر داده میشود چون ولی فقیه با خدا میخوابد و از امام زمان امضا میگیرد و همین شعار کافی است تا ثابت شود نظام آقا امام زمان یک نظام دموکراتیک و جمهوری نیست، اما در جامعه مدرن میتوان رئیس مملکت را به دادگاه کشید و از او به شدت انتقاد کرد و آب هم از آب به هم نمیخورد، هر کسی میتواند از مقام معظم نخست وزیری کشور دوست و برادر اسرائیل حضرت آریل شارون شکایت کند. به عبارت دیگر ساکنان شهر های مدرن رعیت سلطان نیستند. کودک نیستند که ولی (چه فقیه چه غیر فقیه) بخواهند. دموکراسی یک پدیده ایست که تنها در جامعه مدرن اتفاق می افتد، جامعه غیر مدرن را با هیچ جادویی نمیتوان دموکرات کرد، برای همین است که دموکراسی را پدیده ای زمینی باید دانست نه آسمانی، برای همین است که دموکراسی دینی شبیه یک جوک تلخ است، برای همین است که دین و اسلام و این قصه ها یک طرف هستند و دموکراسی طرف دیگر، باید از میان این دو پدیده یکی را انتخاب کرد. برای همین است که برای رسیدن به دموکراسی باید با اسلام مبارزه کرد، برای همین است که روشنفکر مذهبی که میگوید دنبال دموکراسی است درواقع هذیان میگوید.

سیاست در جامعه مدرن عرفی (سکولار) و عمومی است، حق حاکمیت ارث پدری یا الهی کسی نیست! حکومت یک سلطان کاملا ضد تجدد است، در نظامهای پادشاهی متجدد پادشاه فقط یک جنبه تشریفاتی دارد و اگر در سیاست دخالت کند به شدت با او برخورد میشود. در جامعه مدرن سیاست و تفکر عرفی (سکولار) هستند و نگاه جهانی کم کم جانشین نگاه ملی میشود.

از دیگر تفاوت های سیاسی جامعه متجدد و سنتی سیستم قضایی این جوامع است.

در جامعه سنتی ملاک عمل بر این ضرب المثل است که «تا نباشد چوب تر فرمان نبرد گاو و خر». در این جوامع مجرمین را مجازات میکنند تا بقیه درس بگیرند. مجازاتها معمولا بر اساس قصاص و تنبیه بدنی و حتی اعدام قرار دارند، غایت و هدف دولت از انجام این کارها هراس افکندن میان توده های مردم است، مثلا سنگسار میکنند تا هیچ کس به فکر زنا نیافتد. این نوع تفکر که پایه تمام تفکرات قضایی و جزایی دینی هستند یک دید کاملا احمقانه سنتی است که نه جواب میدهد نه انسانی است. در نظام های متجدد اساس بر انسانیت قرار داده شده است، هیچ انسانی را نباید طعمه این هراس افکنی کرد. هدف  از مجازات این نیست که انسانی را تنبیه کنیم تا دیگران درس بگیرند، هدف از مجازات ارشاد و اصلاح آن فرد است نه ترساندن بقیه انسانها، انسانها بچه نیستند که لولوخرخره دولتت برایشان لولوخر خره ایجاد کند، انسانها محترم و آزاد هستند، اگر کسی این شرایط با به هم بزند باید مجازات شود و این مجازات فقط و فقط برای اصلاح خود آن شخص است.

برای همین است که 158 کشور دنیا تا کنون مجازات مرگ برا به کلی برداشته اند. آمار هم به خوبی نشان میدهد کشورهایی مثل آمریکای جهانخوار با وجود اینکه مجازات مرگ دارند بالاترین آمار جرم و جنایت را دارند و کشورهایی مثل سوئد، دانمارک، هلند و… با اینکه چنین مجازاتهایی ندارند کمترین آمار جرم و جنایت را دارند، چکار کنیم که این مذهبیون این چیزها را درک نمیکنند و میگویند » اگر مجازات مرگ نباشد همه قاتل میشوند» ؟

تجدد در عرصه فلسفه:

اساس فلسفه در دوران تجدد انسان است، حقیقت دیگر الهامی نیست و از آسمان نمی آید بلکه اکتسابیست و بر روی زمین و با قوانین زمینی کشف و نه اختراع و از طریق مشاهده و آزمایش و تفکر علمی بدست می آید نه از راه ریاضت کشیدن و یا نزدیک شدن به خداوند(!). تجدد منادی خردگرایی است. خردگرایی را نیز در مقابل دین خویی تعریف میکنیم. ناسوت و ملکوت و جبروت و لاهوت و این اراجیف در فلسفه مدرن جایی ندارند، قلمرو فلسفه متجدد انسانگرایی و عرفی گرایی (سکولاریسم) است. در فلسفه متجدد عقل محور است نه جهل، موازین یا باید عقلی باشند یا باید اصولا نابود و نیست یا بسیار خصوصی باشند.

در فلسفه متجدد نوع تازه ای از اندیشه مبتنی بر خرد نقاد جانشین ایمان مطلق میشود و در نتیجه عرصه فلسفه به کلی دگرگون میشود و دیگر جایی برای اسطوره و خرافه و دین در این عرصه باقی نمیماند.

تجدد در عرصه علم:

با تغییر فلسفه علم نیز مسلما تغییر خواهد کرد، تجدد اولین دلیل پیشرفت علمی بشریت در تمام دورانها بوده است، تبدیل کیمیاگری به شیمی دقیقا یک محصول از تجدد است، پیدایش کلینیک و بیمارستان به جای سقا خانه و استفاده از دکتر بجای دعا نویس و ملا از نمادهای تجدد است. ایجاد شرایط سالمتر زندگی بجای دست به دعا بردن و درخواست بیمه سلامتی از خدا کردن نشان از تجدد دارد. علت ها معلول ها همگی زمینی و منطقی و علمی خواهند بود در علم متجدد هیچ اثری از انشاء الله و ماشاء الله دیده نمیشود، مشاهده علمی بر اساس روشهای علمی انجام میشوند و علم نیز همچون سیاست در جامعه مدرن به عرصه عرفی و عمومی وارد میشود. در ملکوت علم نیز همچون فلسفه جایگاهی برای اسطوره ها و… دیده نمیشود.

علم در جامعه مدرن ثابت نمیکند که محمد ماه را به دو نیم تقسیم کرده و یا اینکه دختران عربستان و مناطق گرمسیر به سن بلوغ میرسند. علم ثابت نخواهد کرد که روزه گرفتن برای بدن خوب است و یا علم ثابت نمیکند که وارد شدن با پای چپ به توالت مفید تر است. اینها تماماً مفاهیم علمی (!) مربوط به جامعه سنتی هستند.

تجدد در عرصه اقتصاد:

وجه مشترک جوامع فئودالی نوعی تفکر خدامدار، اقتصاد طبیعی و حاکمیت سنت ایستاست. تجدد پرچمدار خردمداری، اقتصاد کالایی و جهانگشای سرمایه داری، فروپاشی سنت و پیدایش جامعه مدنی است. اقتصاد هم به عرصه عمومی وارد میشود و زن بطور جدی و برابر به عرصه اقتصاد وارد میشود، میگویند میزان پیشرفت و آزادی را در یک جامعه باید با نگاه کردن به وضعیت زنان آن جامعه دریافت.

تجدد در عرصه هنر:

هنر نیز در اثر تجدد عرفی و مردمی میشود. تصاویر و نقاشی ها دیگر تصاویر حضرت علی و یا کاخها و غیره نیستند، تصاویر و نقاشی ها تصویر مردم روستایی و زندگی عادی مردم و انسانها میشود. در ادبیات نیز زبان عوام به عرصه داستانها قدم مینهد، علویه خانم صادق هدایت است که بر اثر مدرنیسم و تجدد جای خود را به کیکاووس و سلاطین شاهنامه و یا فرعون و نمرود قرآن میدهند. رمان یک پدیده ادبی محصول تجدد است که زندگی عادی انسانها را روایت میکند.

لطفاً متجدد باشید.

* بسیاری از مطالب این نوشتار اساساً از کتاب «تجدد و تجدد ستیزی در ایران» نوشته دکتر عباس میلانی برگرفته شده است، خواندن این کتاب فوق العاده ارزشمند را به تمام دوست داران این گونه مسائل توصیه میکنم.

خردگرایی چیست؟

ساده ترین تعریف خردگرایی (Rationalism) پذیرش اصالت خرد برای کسب شناخت (معرفت) است. خردگرایی معمولا در مقابل دین خویی یعنی پذیرش ایمان (ایمان چیست؟)، وحی و مفاهیم دینی یا عرفانی بعنوان منابع کسب معرفت و دانش مطرح میشود.

خردگرایی یک نظام فکری است، یعنی چگونه اندیشیدن را به انسان می آموزد. خردگرایی همچنین در قیاس با تجربه گرایی (Empiricism) مطرح میشود که مفهوم آن پذیرش تجربه بعنوان مهمترین منبع کسب معرفت است، هرچند تجربه گرایی و خردگرایی قابل جمع شدن با یکدیگر هستند، بدین مفهوم که یک شخص میتواند هم تجربه گرا باشد هم خردگرا.

پذیرفتن خردگرایی برابر است با عدم پذیرش حقایق بصورت مطلق. فرد خردگرا همواره احتمال خطا را در اندیشه اش میدهد و خود را بطور صد در صد متعلق به یک مکتب فکری نمیداند بلکه عاقلانه ترین و منطقی ترین مکاتب فکری را در زمان خودش انتخاب میکند و نسبت به افکارش تفکر انتقادی (Critical Thinking) دارد، یعنی با موشکافی با مسائل روبرو میشود و از توجیه و فرار از تناقضات و خطاهای اندیشه اش دوری می جوید.

فرد خردگرا درستی و راستی مفاهیم را تنها با استناد به قوه عقلانیت میسنجد و تنها مفاهیمی را میپذیرد که از فیلتر خرد با موفقیت خارج شوند. فرد خردگرا هیچ مفهوم غیر عقلایی را بعنوان حقیقت قبول نخواهد کرد. خردگرا حتی به خود خردگرایی نیز با دیده خردگرایی مینگرد یعنی درصورتی که طرز تفکر و نظام فکری عاقلانه تری از خردگرایی دریابد خردگرایی را نیز کنار خواهد گذاشت و به آن نظام فکری خواهد پیوست. خردگرایان همان روش علمی رسیدن به حقایق را که مبتنی بر اصول دقیق خردمندانه است و در آن تعصبی وجود ندارد در حوضه تفکرات خود استفاده میکنند.

انسان خردگرا لزوماً انسانی بیخدا نیست، یک دین دار نیز درصورتیکه مفاهیم سازگار با خرد را قبول کند و مفاهیم ناسازگار با خرد خویش را رد کند خردگرا است، اما چنین شخصی هرگز نمیتواند مسلمان باشد. برخی از اسلامگرایان ادعا میکنند که آنها نیز خردگرا هستند زیرا ابتدا اصول دین را با خرد خویش قبول میکنند و بعد دین را دنبال میکنند. گذشته از اینکه این حرف آنها در تناقض با مسئله ارتداد است، حتی اگر اینکار نیز توسط اسلامگرایان واقعا انجام گردد، نمیتوان آنها را خردگرا نامید زیرا خردگرا در هر زمان خردگرا است، نه تنها در پذیرش اصول، در نقطه مقابل اسلامگرا ادعا میکند که در بررسی اصول دینش خردگرایانه عمل میکند و بعد از آن دینخویی «پذیرش مفاهیم دینی مبتنی بر ایمان (ایمان چیست؟)» را پیش میگیرد.

خردگرایی مفهوم جدیدی نیست، در  تمام نقاط دنیا و در تمام طول تاریخ میتوان خردگرایانی را یافت، یا حداقل افرادی را یافت که خردگرایانه عمل کرده اند، مثلا منقول است که پیامبر اسلام در مقابل ابوجهل (نام اصلی وی ابوحکیمه «پدر دانش» بوده است و پیامبر او را با نام گذاری «پدر نادانی» خواند) ادعای به معراج کردن کرد.

ابوجهل به او گفت که یک پای خود را بلند کن و او اینکار را کرد. ابوجهل به او گفت حال پای دیگر خود را بلند کن و پیامبر نتوانست هردو پایش را بلند کند. ابوجهل به او گفت حال که تو نمیتوانی دو پایت را بلند کنی چگونه میتوانی به معراج رفته باشی؟ این برخورد ابوجهل یک برخورد خردگرایانه بود و در نقطه مقابل برخورد افرادی مانند علی بن ابی طالب که حرفهای محمد را بدون نقد و بررسی هضم میکرد و حاضر بود برای محمد آدم بکشد و حتی در راهش کشته شود برخوردی کاملا دین خویانه و ضد خردگرایی. همچنین برخورد شیطان با خداوند در اسطوره های سامی از همین قرار است، شیطان استدلال میکند و میگوید من برای چه باید به انسان سجده کنم؟ من از انسان برتر هستم و انسان موجودی پست است، در حالی  فرشته ها  همگی گوسفندوار به فرمان الله عمل کردند.

تنها ماهی های مرده هستند که با مسیر آب حرکت میکنند.

تفاوت اصلی میان دین خویان و خردگرایان در این است که دین خویان بدون چون و چرا و تفکر انتقادی و موشکافانه مفاهیم دینیشان را قبول میکنند، مثلاً اگر در اسلام گفته شده است که یک مرد حق ازدواج با 4 زن را دارد، آنها این حرف را گوسفندوار قبول میکنند و پرسش نمیکنند که چرا 4 و نه 5؟ فرق میان داشتن 4 زن و 5 زن چیست که ما باید آنرا قبول کنیم. اما خردگرا برخوردی نقادانه با چنین مسائلی دارد.

شایسته است در باب خردگرایی از برترد راسل منطق دان بزرگ تاریخ بعد از ارسطو نام برد و جمله ای که او گفته است را جمله ای که خردگرایی را در خود خلاصه کرده است دانست. برترد راسل گفته است، «من حاضر نیستم برای عقایدم کشته شوم، زیرا ممکن است عقاید من اشتباه باشند«، این با ظن نگاه کردن به مسائل و خردمندانه عمل کردن شیوه خردگرایان است و در مقابل دین خویان وجود دارند که به مفاهیم دینی خود یقین دارند و بر اساس آنها آدم میکشند و خود را میکشند. حال آنکه تفکرات دینی هزاران بار بی پایه و اساس تر و اسطوره ای تر و نابخردانه تر از تفکرات خردگرایان است.

برای اطلاع از تعاریف و دیدگاه های سایر صاحب نظران در مورد خردگرایی نوشتارهای زیر را بخوانید.

علم چیست؟

چیستی و تعریف علم خود یک مبحث بزرگ علمی فلسفی است که آنرا «فلسفه علم» نامند. علم درباره بدست آوردن دانش دقیق و قابل اتکا از دنیای اطراف ما است، کلمه علم در عربی به چندین معنی است، به معنی دانستن، دانش و حتی آموختن و آموزیدن. اما در انگلیسی علم «Science» از ریشه لاتین «Scire» به معنی دانش است. در فارسی و عربی کلمه ای ک مستقیماً به این کلمه انگلیسی اشاره کند وجود ندارد، اما منظور از علم در این نوشتار همان Science است. علم درواقع کشف کردن (و نه اختراع کردن) واقعیت هایی است که وجود و جریان کلی آنها بطور کلی مستقل از وجود انسانی و عوامل ادراک انسانی (حس، خیال و عقل) باشد (یعنی وجود عینی داشته باشند) و اگر مسئله و قضیه ای بر این اساس و مفهوم استوار باشد آن قضیه و مفهوم را را قضیه و مفهوم علمی گویند. میتوان مفاهیم را به علمی و غیر علمی و ضد علمی دسته بندی نمود.

روش علمی را میتوان اینگونه خلاصه کرد:

  1. مشاهده جنبه هایی از دنیای اطراف
  2. ساختن تئوری سازگار با مشاهده
  3. ایجاد پیشبینی های آزمون پذیر در مورد این تئوری
  4. آزمودن  پیشبینیها با آزمایش و یا انجام مشاهده های بیشتر
  5. ویرایش تئوری با توجه اطلاعات و دانسته های جدید
  6. بازگشت به مرحله سوم

آزمودن در علم با هدف از بین بردن تئوریها و رد کردن و تختئه و ابطال آنها انجام میگیرد، یعنی یک کشف علمی وقتی انجام گرفته است که تئوریهای قبلی توسط شخصی ابطال گردند. بنابر این دانشمندان همواره در تلاشند که یافته ها و دانسته های دانشمندان قبلی را باطل کنند تا نظریات و یافته های علمی تازه تری به دست آورند و این خود غنی بودن علم است. هر آنچه علمی است ابطال پذیر است.

بر خلاف باوری که عوام دارند هر آنچه یک نظر غیر قابل تردید تر باشد، آن نظر غیر علمی تر است، علم دنیای قطعیات نیست! مذهب و تخیلات مطالبی را بصورت قطعی و یقین مطرح میکنند و همین نکته ضد علم بودن آنها را نشان میدهد.

علم عبارت است از انکشاف واقعیتی که وجود و جریان کلی آن بی نیاز از من و عوامل درک انسانی (حس، خیال، عقل) بوده باشد که با آن ارتباط برقرار نموده است. در عین حال قضیه و مساله ای را که از این نوع انکشاف حکایت کند قضیه علمی گویند. هر نظریه که با هیچ پیشامد قابل تصور نتواند مردود شود، غیر علمی است. ابطال ناپذیری، حسن یک نظریه نیست (که مردمان غالباً چنان تصور میکنند)، بلکه عیب آن است.

قضیه علمی نه قابل اثبات است نه قابل رد، اگر چیزی بطور مطلق و قطعی غیر قابل رد کردن باشد آن چیز علمی نیست! نظریه فرضیه و تئوری هیچ کدام قطعیت ندارند و قطعیت در علم بی معنی است. علم دنبال قطعیات نیست بلکه بدنبال ظنیات است!

اساسا پدیده های علمی اگر تنها مبتنی بر مشاهده و آزمایش باشند از حد تئوری بالاتر نمیروند، چیزهایی که در فیزیک و سایر علوم با فرنام «قانون» از آنها یاد میشوند در واقع تئوری هایی هستند که افرادی آنها را ارائه داده اند، مثلاً تئوری قوانین حرکتی نیوتون. البته مفاهیمی در علم وجود دارند که تئورم (Theorem) یا قضیه هستند، این مفاهیم مستقیماً از ریاضیات مشتق شده اند به همین دلیل است که قطعیت دارند، اما همین قطعیت آنها نیز باعث نمیشود که نتوان روی درستی آنها شک کرد.

چیزی تئوری است که هیچ مدرک محکمی علیه آن وجود نداشته باشد، اگر یک تئوری با واقعیت و آزمایش جور در نیاید دیگر آنرا تئوری نخواهند نامید.

در ارتباط با علم به نوشتار زیر مراجعه کنید:

شرح سفسطه عقل بشر ناقص است! علم ناقص است!

آزادی چیست؟

در دست تهیه

آزادی یکی از زیباترین کلمات موجود در هر زبانیست، ساختمانها و مجسمه های آزادی معمولا تبدیل به سمبلهای کشورها و یا شهرها میشوند، آزادی کلمه ایست که همه آنرا ستایش میکنند و میپسندند  اما در تعریف آن باهم اختلاف نظر دارند؛ لزوم وجود آزادی آنقدر واضح است که کسی جزات نمیکند بگوید من با آزادی مخالفم، هرچند واقعا چنین باوری داشته باشد.

آزادی و محدودیت لازم و ملزوم یکدیگر هستند، آزادی را میتوان به نوعی اجازه ارتعاش در میان حوزه ای تعریف شده از امکانات تعریف کرد. آزادی مطلق در هیچ جامعه بشری ای وجود ندارد. در هیچ کجای دنیا مردم بطور مطلق آزاد نیستند. تعریف آزادی خود محدود کردن آزادی است اما این آزادی در محدودیت است که ما بدان در حوزه سیاست و علوم اجتماعی نیازمندیم. یعنی در واقع محدودیت درون کلمه آزادی تعریف میشود و اختلاف بر سر تعریف کلمه آزادی در واقع اختلاف بر سر تعریف این محدودیت هاست. انسانها آزاد هستند دستهایشان را محکم به حرکت در بیاورند اما این آزادی محدود میشود به وقتی که فاصله دست آنها از بینی افراد دیگر بیشتر و یا بسیار بیشتر از طول بازو و دست آنها باشد، اگر این فاصله کمتر باشد دیگر انسانها آزاد نیستند مشتشان را محکم به حرکت در بیاورند و این یک قانون است.

بنابر میتوان به سادگی دریافت که آزادی ارتباطی تنگاتنگ با قانون دارد و آزادی افراد معمولا محدود به قوانینی است که برای آنها وضع میشود. قوانین و حقوق نیز معمولا به موقعیت جغرافیایی و زمانی و سنی و جنسی و سایر ابعاد انسانها مربوط میشود. بعنوان مثال در بسیاری از کشور های پیشرفته دنیا انسانها میتوانند در صورت تمایل طرفین با هم ارتباط جنسی برقرار کنند اما این آزادی محدود به مقرراتی است. مثلا در کشور آمریکا هیچ مرد بالای 18 سالی به هیچ عنوان حق ندارد با زنی زیر 18 سال رابطه جنسی برقرار کند، و در قوانین اسلامی هر مردی میتواند با هر زن و دختری از 9 سال به بالا بعد از ازدواج دائم یا ازدواج موقت رابطه جنسی برقرار کند و اگر هم دختر زیر 9 سال باشد میتواند همچنان سایر لذتهای جنسی را از وی ببرد اما حق دخول به وی را ندارد، جزئیات بیشتر را در نوشته ای با فرنام «زادی آزار جنسی به کودکان، بچه بازی (پدوفیلیا؛ Pedophilia) در دین مبین اسلام از کتاب تحریر الوسیله امام خمینی.» بخوانید.

صرف نظر از موقعیت زمانی و مکانی، همه انسانها در هرکجا و هر زمان و هر دین و آیینی که زندگی میکنند دارای حقوقی میباشند که کسی حق ندارد این حقوق را از آنها بگیرد، این قوانین را قوانین حقوق بشر نامند (حقوق بشر چیست؟). بنابر این همه انسانها اصولا آزاد هستند که از حقوق خود که والاترین و مهم ترین آنها حقوق بشر است برخوردار شوند. معمولا اسلامگرایان و سایر افرادی که در انجماد فکری به سر میبرند از آزادیخواهان درخواست تعریفی برای آزادی میکنند. آزادی ای  که آزادیخواهان در واقع به دنبال آن هستند، را میتوان محدود شدن آزادیها به قوانین حقوق بشر و وضع قوانینی که پاسدار حقوق جهان شمول بشر باشد تعریف کرد.

حقوق بشر نتیجه و سرآمد فعالیت هزاران فیلسوف و دانشمند و حقوق دان و تمام خیرخواهان بشر است که امروز به دست ما رسیده است، اما  آزادی و دموکراسی ( دموکراسی چیست؟ ) برخی اوقات تجربیات بسیار تلخی را به بار می آورند، بعنوان مثال در آلمان نازی، حزب نازی ابتدا با استفاده از شرایط آزاد و دموکراتیک توانست رای اکثریت را به خود اختصاص دهد و سپس کم کم به یک حکومت ضد آزادی و دموکراسی تبدیل شد. به همین دلیل حقوق دانان و خیر اندیشان بشر در انتهای قوانین حقوق بشر یعنی در اصل 30 ام آن اصلی را تنظیم کرده اند که اگر این اصل وجود نداشت این قوانین و حقوق دارای نقصی بزرگ میبود. و آن اصل از این قرار است،

ماده سی ام: هیچیک از مقررات اعلامیه حاضر نباید طوری تفسیر شود که متضمن حقی برای دولتی یا جمعیتی یا فردی باشد که بموجب آن بتواند هر یک از حقوق و آزادیهای مندرج در این اعلامیه را از بین ببرند و یا در آن راه فعالیتی انجام دهند.

این اصل بدین معنی است که اگر انسانی با عقایدی و اهدافی خلاف این قوانین حقوق بشر بخواهد با سوء استفاده از این قوانین (از جمله آزادی بیان) بخواهد حقوق بقیه انسانها را از بین ببرد، نمیتوان به بهانه محق بودن در زمینه حقوق بشر وی به وی حق آزادی بیان داد. بعنوان مثال اگر کسی فکر میکند ایرانیها به صرف نژاد برتر از اعراب هستند  و به همین دلیل اعراب حق حیات ندارند و یا اینکه حق برخورداری از احترام و قوانین حقوق بشر را ندارند، چون این ایده و اندیشه مخالف با قوانین حقوق بشر است، نمیتوان به وی اجازه داد که از قوانین آزادی بیان اندیشه سوء استفاده کند و به تبلیغ این اندیشه خود بپردازد. در هر دولت پابند به قوانین حقوق بشری باید با این دسته ها و افراد و گروه ها مقابله کرد.

به عبارت دیگر میتوان گفت، افکاری که در مخالفت با قوانین حقوق بشر هستند، حق حیات سیاسی و اجتماعی در جامعه مدنی  را ندارند. یک حزب یا گروه آزاد نیست که بگوید زنان باید حقوق کمتری از مردان داشته باشند، یا شوهر میتواند زنش را بزند، یا تبلیغ سنگسار و اعدام بکند و از آنها دفاع بکند. در واقع در کشورهای مختلف یکی از وظایف اصلی حکومت این است که گروه ها و احزاب و دسته جات مختلف را ثبت و کنترل کند. اگر حزبی در مانیفست و تجلی خود و یا نشریه خود افکاری که مخالفت و قوانین حقوق بشر دارند را تبلیغ کند، دولت موظف است به سرعت آن حزب را منحل اعلام کند.

بنابر همین اصل حقوق بشر و با مطالعه و اثبات اینکه اسلام با حقوق بشر در تضاد جدی است (برای بحث مفصل در این زمینه فصل هفتم کتاب اسلام و مسلمانی با فرنام آیا اسلام با دموکراسی و حقوق بشر سازگار است؟ را مطالعه کنید) میتوان نتیجه گیری کرد که اسلامگرایان در جامعه ای آزاد و مبتنی بر قوانین جهانی حقوق بشر حق حیات سیاسی ندارند. یعنی حزبی به نام حزب الله  در شرایط آزاد حتی حق برخورداری از نشریه و روزنامه و حزب را ندارد، چون مانیفست این نوع احزاب مبتنی بر قرآن است و در یک جامعه آزاد و انسانی اینگونه احزاب و گروه ها کاملا منزوی هستند. بنابر این در آزادی ای که یک آزادیخواه معتقد به قوانین حقوق بشر بدنبال آن است، جایی برای اسلامگرایان و سایر گروه هایی که اندیشه های مخالف با حقوق بشر مثل سنگسار، اعدام، ارتداد، دست و پا بریدن، قصاص و… را دارند و همچنین اندیشه های مخالف پیش نویس قوانین اساسی کشور و یا برهم زدن نظم عمومی و یا آتش زدن پرچم کشورهای دیگر و سایر بیابانگرایی هایی که این دسته افراد میکنند ندارد. و این تنها راه برخورداری از یک جامعه سالم و آزاد و سازنده است. و حزب اللهی ها و اسلامگرایان چون از این به خوبی آگاه هستند راه تمسخر و مقابله با قوانین حقوق بشر را انتخاب میکنند. این مسئله در ابتدا معمولا کمی عجیب به نظر میرسد اما با نگاه به پیاده شدن آن در تمام کشورهای آزاد میتوان به درستی آن پی برد.

آزادی را میتوان همچنین در حوزه های مختلف از حوزه های زیر بررسی کرد.

  • آزادی اندیشه (اجازه تبلیغ برای اندیشه و مخالفت با سایر اندیشه ها)
  • آزادی بیان اندیشه (اجازه داشتن رسانه های جمعی و استفاده برابر از امکانات دولتی از جمله صدا و سیما، اجازه سخنرانی، تدریس، نوشتن کتاب و…)
  • آزادی پوشش
  • آزادی های مدنی (برخورداری از حقوق قضایی، حق اعتصاب، بیمه های اجتماعی و…)
  • آزادیهای سیاسی (حق نقد، اعتراض، کاندید شدن، رای دادن، و مبارزه غیر مسلحانه با دولت…)

زندگی کردن در شرایط آزاد برای همه آسان نیست، شما باید از تعدادی از آزادیهای خود که قبلا در شرایط غیر آزاد از آنها برخوردار بوده اید صرف نظر کنید تا مبادا به آزادی دیگران صدمه نزنید. بعنوان مثال مسلمانان در بسیاری از کشورها آزاد هستند که طبق آزادی ای که قرآن به آنها داده است زنانشان را کتک بزنند، و در کشورهایی که دولتهای آنها و سیستمهای قضایی آنها به حقوق بشر پایبند هستند باید از این حق الهی خود صرف نظر کنند. یا مثلا مسلمانان حق ندارند در چنین کشورهایی کسی را به جرم ارتداد بکشند.

معمولا انسانهایی که عقاید کهنه و ناکار آمد و پوسیده و ضعیفی دارند از آزادی هراسانند، بعنوان مثال میتوان به اسلامگرایان عالم اشاره نمود که دشمن آزادی هستند. این افراد به همین دلیل که میدانند در شرایط انسانی و مدرن آزادیهای خود از قبیل سرکوب اندیشه مخالف و سایر کارهای کثیفی که انجام میدهند برخوردار نخواهند بود، با آزادی دشمنی میکنند. میتوان این واقعیت را در یک جمله بسیار زیبا خلاصه کرد. در جایی که آزادی مطرود است، مطرود آزاد است.

موسسه ای شناخته شده به نام «خانه آزادی» هر ساله آماری را با متدهای علمی نظرسنجی در کشورهای مختلف انجام میدهد که نتایج آنرا بصورت یک کتاب منتشر میکند. اندازه گیری ها در نهایت توسط دو فاکتور آزادیهای مدنی و آزادیهای سیاسی ارائه میشوند. با نگاهی به گزارش این سازمان در سال 2003 ( + ) میتوان به سادگی در یافت که وضعیت آزادی در کشورهایی که مردم آنها اکثراً مسلمان هستند بسیار وخیم است و مردم از آزادی بسیار کمتری نسبت به کشورهای غیر مذهبی یا کشورهایی که مذهب در آنها یک امر شخصی حساب میشود (دینی شخصی حساب میشود که شریعتی درون خود نداشته باشد) بسیار بالاتر است. بدترین وضعیت از لحاظ آزادیهای مدنی و سیاسی در کشورهای کمونیستی مثل چین و کوبا و کشورهایی با جمعیت مسلمان مثل ایران، عراق، سودان، عربستان سعودی، افغانستان، مصر، امارات، یمن، قطر، پاکستان تشکیل میدهند. از آنجا که شعور هر ملتی را از دولتی که بر آن حکومت میکند میتوان فهمید و اصولا دولت ها و ملت ها هرچند دولتهای دیکتاتوری چندان از ملتها جدا نیستند، میتوان درک کرد که تا زمانی که اسلام در این کشورها وجود دارد، نمیتوان در آنها به آزادی امید داشت، و البته همانطور که اسلام دشمن بزرگ آزادی حساب میشود، آزادی نیز دشمن بزرگ اسلام است. و بهترین راه برای مبارزه با اسلام، تلاش برای ایجاد شرایط آزاد و برابر است، زیرا در چنین شرایطی اسلام جان سالم به در نخواهد برد.

بیخدایی چیست؟

ایده ای از خدا وجود دارد، و اعتقاد به آن پیش از آنکه بر پایه ی استدلال باشد، بر اساس عوامل غیر عقلیست. خداباوران به دلایل مختلف وجود خدا را قبول می کنند (معمولا از خانواده ی خود ارث می برند) و بعد سعی می کنند برای آن دلایلی پیدا کنند. البته متاسفانه اکثر ما در مورد بیشتر عقایدمان چنین روشی داریم، شما و من. نقص بزرگیست که باید درمان شود، و نیاز به تلاش بسیاری دارد. خداباوران پس از آنکه برای عقیده ی پیش فرض شده ی خود به دنبال دلیل گشتند، برهانهایی تهیه کردند، که در این سایت بررسی شد. این برهانها همگی اشتباه هستند، و هم در این سایت اشتباه آنها نشان داده شده، و هم در سراسر تاریخ، طوری که حتا برخی از خداباوران خود نیز این مطلب را قبول دارند. حال این نکته مطرح می شود، که با ابطال برهانها چه نتیجه ای می گیریم ؟

خداباور ممکن است پس از اینکه تمام برهانها ابطال شود، بگوید که «بسیار خوب، حال اگر میتوانی ثابت کن وجود ندارد !». برهانها در مورد وجود داشتن خدا بود، و ما برهان ها را نقض کردیم، نه وجود خدا را. خوب، حال به وجود داشتن خدا اعتقاد داشته باشیم یا به وجود نداشتنش ؟

پاسخ این مطلب در آتئیست یا آگنوستیک آمده است، و در آنجا شرح داده شده که چرا چنین موقعیتی معادل با فرض وجود نداشتن خداست.

انتقادی که می توان از این سایت، و مطالب مشابه گرفت این است که اعتقاد به خدا بر اساس استدلال شکل نگرفته، و در نتیجه بر اساس استدلال و منطق نیز از بین نمی رود. پس این همه تلاش برای چیست ؟

اول اینکه بسیاری از افراد، دست کم بین جوانان اهل فکر، نظری قطعی در مورد خدا ندارند، و در جستجوی جواب هستند. این افراد می توانند با مراجعه به چنین منبعی، و منابع مخالف، به نتیجه برسند.

از این گذشته، کسانی هم که جوابی یقینی برای مسئله دارند نیز به پایان خط نرسیده اند. همه ی ما در حال دگرگونی هستیم، و اعتقادات بسیاری از این افراد نیز تغییر خواهد کرد، و این تغییر در اثر جمع شدن موارد مختلفی که این مطالب هم می تواند یکی از آنها باشد انجام می شود. البته در این موارد مهمترین عنصر فکر کردن خود شخص است.

آخرین نکته ای که مطرح می شود این است که از بین رفتن اعتقاد به خدا چه نتایجی دارد. پیش از هر چیز باید تاکید کنم که در اینجا هدف بررسی درستی یا نادرستی مسایل است، نه نتایج آنها. با این حال، برخی از خداباوران اعتقاد دارند (یا دست کم اینگونه معتقدانده شده اند) که از بین رفتن این اعتقاد عواقب وخیمی دارد (که ابدا اینطور نیست) و لزا از این مطلب به عنوان شبهه برهانهایی به نفع خدا استفاده کرده اند. این شبهه برهانها در قسمت بررسی برهان ها طرح شده اند و مسئله ی نتایج اعتقاد تا جایی که به این حوزه مربوط می شود در آنجا بررسی شده اند.

به طور خلاصه، ما در جهانی زندگی می کنیم که مجهولات بسیاری را پیش روی ما قرار داده است. مجهولاتی که سبب شگفتی فراوان ما می شوند، و چون غرور و قدرت طلبی ما اجازه ی تسلیم نمی دهد، سعی می کنیم به هر شکل که شده بر آن مسلط شویم. یکی از روشها علم بوده است، که سعی کرده با استفاده از خود طبیعت آن را حل کند، و با مرور زمان به نتیجه برسد. روش دیگر دین است که سعی می کند هر چیز را در سریعترین شکل ممکن به نوعی ماست-مالی کند، و به این شکل بر این حس بد فایق آید. ولی آیا واقعا جوابهایی که دین به مجهولات می دهد جواب است ؟ یا تنها جایگزین کردن ابهامهایی واقعی با ابهامهایی دیگر ؟

دین را می توان در واکنش غیرخردورزانه با مجهولات، و ترکیب آن با سواستفاده ی برخی افراد خلاصه کرد. اگر این دو نبود، دینی به وجود نمی آمد، و ایده ی خدا نیز مانند بسیاری از خرافات دیگر که در حال حاضر بسیار کمرنگ تر شده اند از بین می رفت.

اردشیر پ

خدای حفره ها چیست؟

نویسنده – آرش بیخدا

«نادانی ما خداست، دانایی ما دانش است.»

رابرت گرین اینگرسال.

خدای حفره ها نام مستعاری است که به یک عادت غلط بشری که یکی از رایج ترین دلیل های گرایش به خداباوری (تئیست، خداباور چیست؟) است داده شده است. انسانها همواره در مقابل طبیعت احساس ضعف کرده و میکنند.

خدای حفره ها توضیح دینی از طبیعت را تداعی میکند، توضیحاتی که مشتق شده از علم هستند. این گونه تصور ها مبتنی بر این هستند که هر آنچه دانش بشر بتواند آنرا توضیح دهد خارج از دامنه فعالیت خدا است و در نتیجه هر آنچه دانش بشر نمیتواند آنرا شرح دهد، باید ناشی از فعالیت خدا باشد. به عبارت دیگر خداباورانی که از روی خدای حفره ها به خدا اعتقاد دارند، خدا را در حفره هایی که در دانش وجود دارد وارد میکنند.

یک مثال بسیار بارز از این نوع خداباوری را میتوان در طول تاریخ خداباوری دید. انسانهای بدوی برای توضیح نحوه کار پدیده های طبیعی مانند ماه، خورشید، ستاره ها و رعد و برق، علت های الهی را در نظر میگرفتند و در برخی جاها برای هرکدام از این پدیده های طبیعی خدای جداگانه ای نیز در نظر میگرفتند. اما با پیشرفت دانش در رشته های مختلف همچون، کیهانشناسی، هواشناسی، زمین شناسی، ستاره شناسی و بیولوژی نیاز برای توضیح اتفاقهای طبیعی با خدا به شدت به «حفره های» کوچک تری در دانش بشری کاهش پیدا کرد.

بعنوان مثال از آنجا که انسانها دیگر در مورد شیوه کار خورشید و ماه و ستارگان چندان بی اطلاع نیستند، بیشتر حوزه شک ورزی به عدم وجود خدا در چیز هایی محدود شده است که دانش هنوز پاسخ های محکمی برای آنها ندارد (یا دانش این افراد هنوز پاسخی برای آنها ندارد) همچون نحوه شکل گیری و پیدایش حیات و همچنین پیدایش جهان هستی. به دلیل همین طرز تفکر معمولاً نخستین پرسشی که از یک بیخدا میشود این است که «پس دنیا وانسان را که بوجود آورده است؟» این پرسش درون خود استدلالی را مخفی کرده است که آن استدلال از این قرار است،

«ما نمیدانیم جهان چگونه آنرا بوجود آورده است، پس خدا آنرا بوجود آورده است، پس خدا وجود دارد.»

این نمونه بسیار آشکار استفاده از روش «خدای حفره ها» برای باور به خدا است. یکی از نسخه های قدیمی تر این نوع استدلال ها در میان پیشینیان این بوده است.

«ما نمیدانیم رعد و برق چگونه شکل میگیرد، پس باید خداوندی این کار را کرده باشد.»

همواره در دانش بشر حفره هایی و نکات نادانسته ای وجود خواهد داشت، مسلماً وجود این حفره ها دلیل خوبی برای باور داشتن به خدا نیست، انسان خردگرا (خردگرایی چیست؟) باید در مورد آنچه نمیداند باید صداقت روشنفکری داشته باشد و بگوید «نمیدانم!» نباید بجای آن موجودات خیالی همچون خدا (خداوند چیست؟) را دلیل نادانسته ها بداند و بخواهد اینگونه حفره های درون تصوراتش را پر کند، مغز انسان مدرن و خردگرا از داشتن حفره ها در هراس نیست، ندانستن قطعاً پاسخی معتبر تر از در نظر گرفتن علت های غیر معتبر و موهوم، خیالی، ماوراء طبیعی و غلط است. استفاده از همین طرز تفکر بوده است که باعث شده است طول تاریخ خداباوری هرچقدر که دانش بشری پیشرفت میکرده است حوزه فعالیت خدایان نیز محدودتر شده است.

خداباوران معمولا اعتراف میکنند که خدایشان را نمیفهمند و از کارهای او سر در نمی آورند، به همین دلیل است که معمولاً در پاسخ به رفتارهای تناقض آمیز دوست خیالیشان میگویند «حتماً حکمتی در کار است که ما نمیدانیم»، بسیاری از خداباوران حتی ویژگیهای اصلی و دقیق خدا را که در تعریف خدا (خداوند چیست؟) مطرح شده است را نمیدانند. این افراد به چیزی اعتقاد دارند که خود نمیدانند چیست، به عبارت دیگر نادانی خود را بعنوان خدا مورد ستایش قرار میدهند و بنده حفره های ذهنی خویش و نادانیشان هستند نه حتی بنده خدا، این افراد از روش «خدای حفره ها» استفاده نمیکنند بلکه خدای آنها تماماً یک حفره است.

به همین دلیل بی اطلاع بودن خداباوران از رفتار خدایشان است که «خدا فلان کار را کرده است» جواب قانع کننده و معتبری برای هیچ ذهن علمی نیست. یک فیزیک دان که در زمان حال زندگی میکند هرگز این مسئله را که فلان پدیده به دلیل اینکه خداوند خواسته است رخ داده است را بعنوان یک پاسخ علمی به پرسشهای علمی نخواهد پذیرفت، برای همین است که در هیچ شاخه ای از علم حرفی از خدا زده نمیشود زیرا علم خدا را به رسمیت نمیشناسد. بنابر این از دیدگاه فلسفه علم، خدا هرگز نمیتواند پاسخی قابل قبول برای هر مسئله علمی در هر یک از شاخه های علمی باشد، زیرا اساساً خدا در تعریف علیت نمیگنجد. برای اطلاعات بیشتر به نوشتاری با فرنام  علیت و امکان ناپذیری منطقی یک علت الاهی (1996)مراجعه کنید.

عبارت «خدای حفره ها» نخستین بار توسط هنری دورمند (Henry Drumond)  یک خطیب پروتستانت مسیحی اسکاتلندی در قرن 19ام استفاده شد که در آن مسیحیانی را که برای اثبات وجود خدا به نادانسته های بشری اتکا میکنند و «حفره هایی که میخواهند با خدا پرشان کنند» می تاخت و آنها را تشویق میکرد که تمام طبیعت را به فعالیت خدا نسبت بدهند، نه تنها آنچه را که دلیل واقعی اش را نمیدانند.

روش خدای حفره ها تنها در مورد خدا بکار گرفته نمیشود، بشر بطور طبیعی در مقابل چیزهایی که در طبیعت میدیده است همواره به ماوراء طبیعت چنگ زده است، بعنوان مثال روح نیز یکی دیگر از این تعاریف ماوراء طبیعت است. بیشتر انسان ها از آنجا که توضیحی علمی برای پدیده هایی مثل دژاوو، خواب دیدن، رویاهای صادقه و غیره نداشتند و ندارند به موجودی همچون روح معتقد میشوند. بررسی کامل این مسئله در نوشتاری با فرنام چرا روح وجود ندارد؟ انجام شده است.

انسانهایی که دچار بیماری فکری خدای حفره ها هستند در واقع حقایقی را برای خود خلق میکنند، این در حالی است که حقیقت خلق کردنی نیست، آنچه ذهن خلق میکند نمیتواند حقیقی باشد بلکه حقیقت کشف کردنی است. ترس انسانها از اعتراف به ندانستن و جهل است که باعث میشود انسانها به خدای حفره ها دچار شوند. انسانها باید درک کنند که دانستن اینکه ما نمیدانیم، خود یک دانش و نوعی دانایی است و از اتفاق دانش بسیار پر ارزشی هم هست. ندانستن به خودی خود عیب نیست و اینگونه نادانی خطرناک یا ترسناک هم نیست. نادانی در زمانی عیب است و خطرناک است که پنهان باشد، و یا اینکه نادانی پنداشته نشود. هنگامی که نادانسته ها به خطا دانسته پنداشته میشوند و دانسته های غیر واقعی و خلق شده جای آنها را میگیرند نادانی به خطرناک ترین نوع ممکن خود تبدیل میشود. این نوع نادانی است که دین خویی و حماقت و خرافه را به همراه می آورد، دانسته پنداشتن نادانسته ها به نادانسته پنداشتن دانسته ها نیز کشیده میشود، به همین دلیل است که دین خویان سر ستیز با دانسته های بشری دارند و آنرا ناقص میخوانند (در نوشتاری با فرنام عقل بشر ناقص است! علم ناقص است! به این مسئله پرداخته شده است) نوع سالم نادانی که اعتراف به نادانی است از طرف دیگر مادر تمام دانسته های بشری است و هر دانایی آنگونه نادانی را ستایش میکند.

فرق یک انسان دین خو و یک خردگرا در مورد چیزهایی که نمیدانند این است که آدم خردگرا میداند که نمیداند اما انسان دین خوی نمیداند که نمیداند، او فکر میکند که میداند در حالی که دانسته های او ذره ای ارزش ندارند زیرا مبتنی بر اباطیل و تخیلات و اوهام او و انسانهای دیگر هستند.  کدامیک از این دو گونه انسانها هوشمند ترند؟ کسانی که نمیدانند که نمیدانند یا کسانی که بر نادانی خویش اشراف کامل دارند؟ کسانی که با جوابهای غلط و اسطوره ای خود را راضی نگه میدارند یا کسانی که میدانند که نمیدانند و بجای سرگرم کردن خود با ماوراء طبیعت و اباطیل وابسته به آن، تلاش میکنند که جوابهای واقعی و علتهای طبیعی را پیدا کنند؟ برای اثبات اینکه شخصی ادعا کند جهان را خدا خلق کرده است همانقدر شواهد وجود دارد که شخصی بخواهد اثبات کند جهان را یک خرس بالدار شاخدار قرمز راه راه نامرئی بدجنس خلق کرده است.

انسانهایی که دچار به تنبلی فکری هستند معمولا با جوابهای نابخردانه و ساده زود راضی میشوند، جهان چگونه شکل گرفته است؟ خدا آنرا شکل داده است، ما چرا فقیر هستیم؟ خدا خواسته است! اما برای یک انسان خردگرا، بالغ و عاقل و به معنی واقعی کلمه، فیلسوف (خرد دوست) هرگز با چنین پاسخ هایی راضی نمیشود، او پاسخ های دقیق، درست و قابل آزمایش و سنجشی میخواهد که از فیلتر خرد عبور کنند و بار نقد های پولادین نتواند آنها را کج کنند. اینگونه حقایقی خود می درخشند و در دفاع از آنها نیازی به کشتار و تکفیر مرتد و غیره نیست، اما از اراجیف دینی نمیتوان دفاع کرد مگر با سانسور، ارعاب، نیست کردن مخالفان و در نتیجه استبداد فکری.

شایان ذکر است، حوزه استفاده «خدای حفره ها» تنها محدود به علم نمیشود بلکه اینگونه استدلال ها را میتوان در پرسشهای فلسفی نیز یافت. بعنوان مثال یکی از مسائلی که بسیار از خداناباوران پرسیده میشود مسئله اخلاق است، خداباوران معمولا از بیخدایان میپرسند که اگر خدا نباشد تکلیف اخلاق چه میشود؟ چرا ما باید اخلاقمدار باشیم؟ باز هم میتوان این پرسش را بصورت یک استدلال آورد،

«اگر خدا وجود نداشته باشد اخلاق وجود ندارد، اخلاق وجود دارد پس خدا وجود دارد.»

ردیه این استدلال را که معروف به استدلال اخلاقی کانت است در نوشتاری با فرنام «برهان اخلاق» بیابید. این مسئله نیز دقیقاً مانند همان مسئله بوجود آمدن جهان است یعنی خداباور چون از ماهیت اخلاق و بحث ها و نظریات  موجود در این رشته بسیار کهن و عمیق فلسفی آگاهی ندارد، باز هم میخواهد این حفره های درون ذهنش را با خدا پر کنند. پاسخ به این پرسش را در دو نوشتار با فرنام های «بیخدایی و اخلاق» و «سفسطه دین ضامن اخلاق در جامعه است» بیابید. همانگونه که در علم، خدا به رسمیت شناخته نمیشود در فلسفه نیز تا زمانی که خدا اثبات نشده باشد، نمیتوان از او در هیچ استدلالی استفاده کرد، برای بحث های مربوط به اثبات و رد وجود خدا به نوشتاری با فرنام  «از کجا میدانید خدا وجود ندارد؟» مراجعه کنید.

مثال این دسته از افراد را که از روی نادانی وجود موجودات و اشخاص ماوراء طبیعی را میپذیرند مانند مثال معروف فضانوردی است که با یک آدم فضایی در کره ماه برخورد میکند. این فضانورد به آدم فضایی به رسم یادبود یک مجسمه یخی هدیه میکند. آدم فضایی مجسمه را به خانه اش میبرد و فرا با حالتی بسیار خشمگین به نزد فضانورد باز میگردد و میگوید مجسمه ای که تو به من دادی را یک نفر از من دزدیده است. من شب آنرا روی بخاری خانه ام گذاشتم و فرا دیدم نیست. فضانورد به او میگوید که مجسمه تو را کسی ندزدیده است، مجسمه در تماس با گرمای بخاری ذوب شده است و به آب و سپس به بخار تبدیل شده است. در این مثال ساده آدم فضایی چون با ویژگیهای ماده آشنایی ندارد موجوداتی را مسئول اتفاق افتاده میبیند. به عبارت دیگر چون از علت یا علت های واقعی آگاهی نداشته است علت هایی خیالی را برای آن تصور کرده است. انسانهای دین خوی نیز در مقابل نادانی خود دقیقاً همینگونه رفتار میکنند.

یک نمونه معروف از کسانی که به خدا به دلیل همین عادت «خدای حفره ها» اعتقاد داشته است اسحق نیوتون فیزیک دان و ریاضی دان بزرگ انگلیسی است. دیدگاه نیوتون نسبت به خدا را در نوشتاری با فرنام » نیوتون و خداباوری او» بیابید.

تئیسم، خداباوری چیست؟

نویسنده – آرش بیخدا

تئیست کسی است که تئیسم یعنی خداباوری وابستگی فکری داشته باشد. یعنی معتقد باشد که خداوند (خداوند چیست؟) وجود دارد.

اصولا انعکاس اعتقاد به خداوند در افکار را میتوان به سه دسته اساسی تقسیم کرد

  1. تیست ها (Theists) کسانیکه اعتقاد دارند خدا وجود دارد، و میتوان وجود وی را اثبات کرد.
  2. آتئیست ها (Atheists) کسانیکه اعتقاد دارند خدا وجود ندارد و عدم وجود وی را میتوان اثبات کرد.
  3. اگناستیک (Agnostics) کسانیکه اعتقاد دارند خدا را نمیتوان اثبات کرد، این دسته میتوانند به وجود خدا اعتقاد داشته یا نداشته باشند.

حدیث چیست؟

نویسنده – آرش بیخدا

حدیث دومین منبع دریافت حقایق در مورد اسلام است. روش دریافت حقایق، مثلا در مورد موارد حقوقی/قضایی اینگونه است که در هر مورد ابتدا به قرآن یعنی اولین منبع اسلام مراجعه میشود، و اگر قرآن پاسخگوی مسئله نبود سپس به حدیث مراجعه میشود و بعد از آن به نظرات قضات بزرگ و قضات پیشین و آرای فقها ارجاع میشود.

گروهی از اسلامگرایان، اخیراً احادیث را کلا باطل میدانند و به دلیل مطالب وحشیانه و احمقانه ای که در احادیث به پیامبر اسلام نسبت داده شده است، آنرا اساساً دروغ میشمارند، و میگویند تنها قرآن مرجع اسلام است، به این سفسطه این دسته از اسلامگرایان در نوشتاری با فرنام «من احادیث را قبول ندارم، اسلام یعنی فقط قرآن» پاسخ داده شده است.

در سوره ماده گوساله (بقره) آیه 129 میخوانیم که:

رَبَّنَا وَابْعَثْ فِيهِمْ رَسُولاً مِّنْهُمْ يَتْلُو عَلَيْهِمْ آيَاتِكَ وَيُعَلِّمُهُمُ الْكِتَابَ وَالْحِكْمَةَ وَيُزَكِّيهِمْ إِنَّكَ أَنتَ العَزِيزُ الحَكِيمُ.

ای پروردگار ما ، از ميانشان پيامبری بر آنها مبعوث گردان تا آيات ، تورا برايشان بخواند و به آنها کتاب و حکمت بياموزد و آنها را پاکيزه سازد و تو پيروزمند و حکيم هستی.

لذا از نظر قرآن پیامبران در کنار کتاب که به مردم می آموزند به آنها حکمت نیز می آموزند، در مورد اسلام کتاب، قرآن است، اما حکمت چیست؟ حکمتی که پیامبر به مردم آموخته است، تنها در حدیث یافت میشود.

حدیث در لغت به معنی گفتار است اما در اصطلاح فقهی به گفته های پیامبر (یا در مورد تشیع امام) گفته میشود. احادیث نشان میدهند که پیامبر کاری را کرده است و یا دستوری در مورد مسئله ای داده است. همچنین اگر پیامبر در مقابل انجام کاری سکوت کرده باشد، با سکوت و عدم اعتراض خود آن کار را تایید کرده است و لذا آنکار از نظر فقهای اسلامی، مورد تایید پیامبر و در نتیجه اسلامی به شمار میرود.

شیعیان چهار کتاب حدیث را معتبر میشناسند و این چهار کتاب منابع دست اول حدیث حساب میشوند. این چهار کتاب که به «کتب امهات شیعه» (کتابهای مادر شیعه) معروفند از این قرارند.

اصول کافی – نوشته ابو جعفر محمد کلینی

من لایحضره الفقیه – نوشته ابن بابویه شیخ صدوق

تهذیب الاحکام – نوشته تالیف شیخ صدوق

استبصار – نوشته شیخ صدوق

اهل تسنن نیز برای خود 6 کتاب را صحیح مینامند و آنها را منابع معتبر حدیث میشمرند.

بخاری

مسلم

سنن ابوداوود

ترمدری

ابن مانجه

نسائی

از آنجا که اکثریت مسلمانان را اهل تسنن تشکیل میدهند و دیدگاه تشیع در مورد تاریخ اسلام از نظر اکثر اسلامشناسان در سطح دانشگاهی قابل قبول نیستند، کتابهای اهل تسنن اساساً از اعتبار بیشتری برخوردار هستند و بويژه کتاب صحیح بخاری از معتبر ترین کتابهای مرجع در مورد تاریخ اسلام است و مورد توجه و استناد تمامی محققان از جمله محققان شیعه و سکولار است. در میان کتابهای شیعه نیز اصول کافی معتبر ترین و اصلی ترین منبع حساب میشود.

احادیث موجود در این کتابها با اینکه از میان انبوهی از احادیث دیگر انتخاب شده اند اما بازهم برخی از آنها بسیار مضحک و نابخردانه هستند، گروهی از مسلمانان روی صحت و درستی این احادیث و اینکه این احادیث واقعا از پیامبر اسلام یا سایرین نقل شده اند، تعصب میورزند و گروهی دیگر تعصب چندانی روی این قضیه ندارند.

برای بررسی صحت و درستی یک حدیث روشها و علومی در طول تاریخ پدید آمده است که بر اساس آنها حدیث شناشان احادیث را بر اساس میزان اعتبار آنها به دسته بندیهای مختلفی تقسیم میکنند و مکاتب فکری مختلف اسلامی در این زمینه روش و متد خود را دارند.

کتب بسیار کامل و جامعی در مورد حدیث را میتوانید در تاریخ حدیث بیابید.

متافیزیک چیست؟

نویسنده – آرش بیخدا

فیزیک در یونانی به معنی طبیعت است و متا نیز به معنی فراتر و یا مابعد است، بنابر این متافیزیک را در زبان فارسی به فراماده، فوق العاده، مابعد طبیعت و… آورده اند.

شاید از کلمه متافیزیک بیش از هر کلمه دیگری در دنیای دکانداران دینی و دینگرایان سوء استفاده میشود. دین داران خودشان را معتقد به متافیزیک میدانند و میگویند که بیخدایان از متافیزیک آگاهی ندارند و وجود هر چیز متافیزیکی را رد میکنند. اشخاصی که صدسال پیش نهایتاً از حضرت عباس و ابوالفضل علمدار حرف میزدند و برای مردم دعا نویسی میکردند، امروزه با بیان مطالب مضحکی چون «نیروهای متافیزیکی، انرژی مثبت و انرژی منفی» و… همچنان همان دکانهای خود را باز نگه داشته اند ولی اینبار بجای حضرت عباس، از متافیزیک سوء استفاده میکنند. در این نوشتار توضیحاتی در مورد کلمه متافیزیک و اینکه چیست و به چه معنی است داده خواهد شد.

البته کلمه متافیزیک آنقدر بطور متنوع در جاهای مختلف استفاده شده است که واقعا دشوار است که بگوییم واقعا چه معنی ای میدهد. ارسطو شاگرد افلاطون حکیم (Philosopher) و عالم (Scientist) یونانی شخصی بود که کتب بسیاری (درمورد خواب، حکومت، حیوانات، حرکت، اخلاق، بیان، حیات و…) را در تالیف کرد که در زمان خودش یک دایره المعارف کامل به حساب می آمد و گنجینه ای بود از علوم و ایده های فلسفی که تا آن دوران وجود داشتند و تا دورانهای زیادی این کتابها مرجع علمی به شمار می آمدند تا اینکه کم کم منسوخ شدند و علوم جدید تر و ایده های فلسفی جدید تر شکل گرفتند و دیگر کمتر مجالی برای طرح اندیشه ها و تحقیقات ارسطو مطرح میشد و ارزش کمتری یافتند، هرچند که هنوز هم کهنه پرستان دینی مثل ارسطو فکر میکنند. در پاسخ به سوال دلیل بیگ بنگ چه بوده است؟ اولین موجود رو کی آفرید؟ چرا یک چیز نمیتواند از ناچیز بوجود بیاید؟ به یکی از این اندیشه های ارسطو که همچنان مورد استفاده است یعنی برهان حرکت، یا علیت برای اثبات وجود الوهیت مطرح شد.

آثار ارسطو را به چندین دسته تقسیم کردند، کتابهای نظری و پزشکی و طبیعی و… اما یکی از کتاب های ارسطو که دوازدهمین کتاب وی بود و در مورد مسائلی فلسفی صحبت میکند. ارسطو این کتاب دوازدهم خود را «فلسفه ابتدایی (فلسفه اولی و یا حکمت نخستین)»،  «حکمت»، یا «مطالعه هستی» نامید (این کتاب را میتوانید به زبان انگلیسی از اینجا بخوانید) اما خوانندگان آثار ارسطو و منتقدان وی بعد ها این کتاب را متافیزیک خواندند. چون ارسطو همانطور که گفته شد کتابهای زیادی در مورد طبیعیات و فیزیک نوشت، و چون این کتاب را بعد از کتاب فیزیک نوشت، آنرا متافیزیک خواندند، یعنی کتابی که بعد از کتاب فیزیک نوشته شده است، و یا آنچه بعد از فیزیک آمده است. از آن زمان تا این دوران از این کلمه سوء استفاده های زیادی شده است. لذا شاید بتوان گفت کلمه متافیزیک از آن زمان حیات گرفت. و این نام برای این موضوع تقریباً بطور کاملاً تصادفی انتخاب شد.

امروزه در فلسفه متافیزیک یکی از شاخه های پنجگانه فلسفه است. اکثر فلاسفه بر این توافق نظر دارند که فلسفه را میتوان به پنج شاخه مجزا تقسیم بندی کرد.

فارسی انگلیسی حوزه تلاش برای پاسخ به این پرسش
متافیزیک Metaphysics مطالعه وجود چه چیزهایی وجود دارند؟
معرفت شناسی Epistemology مطالعه دانش من از کجا و چگونه میدانم؟
اخلاقیات Ethics مطالعه عمل من چگونه باید رفتار کنم؟
سیاست Politics مطالعه نیرو چه اعمالی روا هستند؟
زیبایی شناسی Esthetics مطالعه هنر زندگی چگونه میتواند باشد؟

متافیزیک شاخه ای از فلسفه است که بطور کلی به مطاله طبیعت جهان هستی و خود مسئله هستی و ماهیت آن میپردازد. متافیزیک پایه جهان بینی است. و تعیین میکند چه چیزهایی وجود دارند و چه چیزهایی نمیتوانند وجود داشته باشند. مقلا بحث پیرامون اینکه جهان اطراف ما یک ماهیت حقیقی دارد (رئالیسم) یا یک ماهیت خیالی (ایدئالیسم) دارد تماماً مربوط به شاخه متافیزیک فلسفه است. شاخه های مختلف فلسفه که در بالا ذکر شده است بطور وراثتی مرتب شده اند، به این معنی که هرکدام از شاخه های پاینی نیازمند شاخه یا شاخه های بالاتر هستند. بنابر این متافیزیک به نوعی مادر فلسفه است و بدون دانستن مسئله وجود و چگونگی آن نمیتوان هیچ مسئله دیگری را بررسی کرد. متافیزیک لازمه شناخت حکمت است، بدون آن نمیتوان با اینکه چه چیزی حقیقی است و چه چیزی حقیقی نیست روبرو شد. معمولاً فلسفه در مکاتب فلسفی که در شرق بوجود آمده اند را با متافیزیک  آغاز میکنند، یعنی از مسئله وجود آغاز میکنند، اما آموزش فلسفه در غرب از معرفت شناسی یعنی مطالعه دانایی و بررسی شیوه های دانستن آغاز میگردد. یعنی ابتدا راجع به این صحبت میشود که آیا ما میتوانیم چیزی را بدانیم و بشناسیم؟ و اگر میتوانیم این دانستن به چه شکل است.

در بحث های متافیزیکی تلاش بر این است که به پرسشهایی مانند، چه چیزهایی وجود دارند؟ واقعیت چیست؟ آیا اختیار وجود دارد؟ آیا علت و معلول وجود دارد؟ آیا مفاهیم مجردی مانند اعداد وجود دارند؟ ماهیت زمان و فضا چیست؟ یک چیز چیست و فرق آن با یک فکر چیست؟ آیا یک علت اولیه و یا خدا وجود دارد؟، پاسخ مناسب داده شود.

معمولا یکی از رایج ترین سوالهایی که از بیخدایان میشود این است که آیا شما به متافیزیک اعتقاد دارید؟ و پرسیدن این سوال ناشی از درک غلط پرسش کننده از کلمه متافیزیک است، پرسش کننده معمولا منظورش از پرسش این سوال این است که، آیا شما به جادوگری و زیر پا رفتن قوانین فیزیکی و چیزهای عجیب غریب مثل خدا و امام زمان و جن و پری و شیطان و سوپرمن و دراکولا و معجزه و شفا اعتقاد دارید؟ که پاسخ به این سوال بازیافت شده معمولا از طرف خردگرایان خیر است اما پرسش نخستین تغریباً بی معنی است. متافیزیک چیزی نیست که کسی به آن باور داشته باشد یا نداشته باشد.

بعضی ها پارا فراتر از این گذاشته اند و میگویند متافیزیک یک علم و رشته علمی است، و جالبت تر اینجاست که بعضی ها در این رشته علمی فارق التحصیل شده اند (!) و مثلا دکترای متافیزیک گرفت اند (!) این در حالیست که هیچ دانشگاه معتبری چنین رشته تحصیلی ای را ارائه نمیدهد که مثلا به کسی لیسانس یا فوق لیسانس متافیزیک بدهد. تنها موسسات خصوصی و دکانهایی مثل حوزه جهلیه قم و دانشگاه هایی مثل دانشگاه امام صادق و دکانهای مسیحیت و سایر دین خویان جهان ممکن است چنین رشته های تحصیلی را ارائه کنند، بعنوان مثال چند دکان که در رشته متافیزیک مدرک تحصیلی 100% غیر معتبر از لحاظ علمی و قوانین دولتی  میدهند را در اینجا معرفی میکنیم. + + +

برای اطلاعات بیشتر از موارد خرافی ای که سعی میشود توسط افراد سودجود زیر نام متافیزیک به مردم تحمیل شود، نوشتاری شایسته از استوار غلام دانایی با فرنام «فرا روا نشنا سی: درک ماوراء حسی، تله پاتی، رویای حقیق،…» را مطالعه بفرمایید.

شایان ذکر است، آنچه معمولاً با نام متافیزیک به مردم از طرف خرافه گرایان تحمیل میشود در حقیقت سوپر نچورالیسم است و نام درست برای این مسائل همان فراطبیعت گرایی و ماوراء طبیعت است. شاید توضیح این نکته لازم باشد که کلمه متافیزیک و سوپرنچورال از لحاظ لغوی بسیار به هم شبیه و نزدیک هستند اما معنی فلسفی بسیار متفاوتی دارند.

خدا انگاری چیست؟

نویسنده – آرش بیخدا

عبارت Deist بطور معمول به آن دسته از متفکران قرن 17 ام و 18 ام گفته میشود که با مشاهده طبیعت و مطالعه علوم به این نتیجه رسیدند که خدا وجود دارد، اما مذاهب و ادیان را مسخره و زائد دانستند و روابط بین خدا و بشر توسط وحی را نابخردانه انگاشتند. اعتقادات آنان برگرفته از خردگرایی مربوط به دوران خود بود، از این رو از این عبارت دیگر کاربرد چندانی در دوران فعلی ندارد. امروزه از عبارت آزاد اندیش «Freethinker» بجای Deist برای اشاره به این نوع اندیشیدن استفاده میشود.

از خدا انگاران معروف میتوان افراد زیر را نام برد.

  • ولتر
  • اسحق نیوتون (در خدا انگار بودن یا مسیحی بودن نیوتون اختلاف نظر وجود دارد)
  • روسو
  • توماس پین
  • بنجامین فرنکلین
  • توماس جفرسون
  • جورج واشنگلتن

توسط آرش بیخدا

گزاره چیست؟

نویسنده – آرش بیخدا

کلمه قضیه یا گزاره (Proposition) کلمه ای است که در منطق به محتویات یک ادعا اطلاق میشود. مثلاً جمله «شیر سفید است» یک گزاره است.

یک ادعا (Assertion) نیز مفادی را حمل میکند که ممکن است درست یا غلط پنداشته شوند. در مثال بالا، ادعای سفید بودن شیر میتواند درست یا غلط باشد.

در منطق اصلی وجود دارد با نام «اصل دوبنیادی» یا دو والانسی بایوالنس(Priniciple of bivalence)، که بر اساس این اصل هر گزاره ای لزوماً یا صحیح (درست) است یا غلط (نادرست). مثلاً گزاره سفید بودن شیر تنها یا میتواند درست باشد یا نادرست.

هر گزاره را میتوان دارای دو ویژگی کمیت و کیفیت دانست.

ار لحاظ کمیت یک گزاره میتواند کلی یا جزئی باشد

گزاره کلی، در مورد تمام اعضاء مجموعه ای ادعایی را مطرح میکند:

تمام اسب ها حیوان هستند

هر اسبی یک حیوان است

هیچ اسبی حیوان نیست

گزاره جزئی، در مورد زیر مجموعه ای از تمام اعضاء مجموعه ای ادعایی را مطرح میکند:

برخی از اسب ها حیوان هستند

تعدادی از اسبها حیوان نیستند

از لحاظ کیفی یک گزاره میتواند ایجابی یا سلبی باشد

گزاره ایجابی، ادعایی را بصورت مثبت مطرح میکنند:

همه اسبها حیوان هستند

برخی از اسب ها حیوان هستند

گزاره سلبی، ادعایی را بصورت منفی مطرح میکنند:

هیچ اسبی حیوان نیست

برخی از اسبها حیوان نیستند

هر گزاره همچنین دارای دست کم یک محمول و دست کم یک موضوع است، مثلا در گزاره «همه اسبها حیوان هستند» محمول «همه اسبها» هستند و موضوع نیز «حیوان بودن» است.

حال دو گزاره که از لحاظ محمول و موضوع با یکدیگر یگانگی دارند میتوانند چهار نوع ارتباط با یکدیگر داشته باشند. این چهار نوع ارتباط از قرار زیر است:

تناقض(تناقض چیست؟)

اگر دو گزاره در موضوع و محمول و در 8 شرط دیگر که در نوشتار تناقض چیست؟ آمده است یگانگی داشته باشند، و هم از لحاظ کیفی و هم از لحاظ کمی با هم اختلاف داشته باشند، یعنی هم در ایجاب و هم در سلب این دو گزاره متناقض هستند. مانند:

«همه صندلی ها چوبین هستند»، «بعضی از صندلی ها چوبین نیستند»

تضاد

اگر در کیفیت اختلاف داشته باشند، یکی موجبه  باشد یکی سالبه، در 8 شرط دیگر که در نوشتار تناقض چیست؟ آمده است یگانگی داشته باشند و در کمیت اختلاف نداشته باشند و هردو کلی باشند و اگر دو گزاره کلی باشند، این دو گزاره متضاد یکدیگر هستند. مانند:

«همه صندلی ها چوبین هستند»، «هیچ صندلی چوبین نیست»

داخلتین تحت التضاد

اگر در کیفیت اختلاف داشته باشند، یکی موجبه  باشد یکی سالبه، در و 8 شرط دیگر که در نوشتار تناقض چیست؟ آمده است یگانگی داشته باشند و در کمیت اختلاف نداشته باشند و هردو جزئی باشند. این دو گزاره داخلتین تحت التضاد هستند. مانند:

«بعضی از صندلی ها چوبی هستند»، «بعضی از صندلی ها چوبین نیستند».

 متداخلین

اگر در کیفیت وحدت داشته باشند، هردو موجبه  باشد یا هردو سالبه، در و 8 شرط دیگر که در نوشتار تناقض چیست؟ آمده است یگانگی داشته باشند و در کمیت اختلاف داشته باشند یعنی یکی جزئ و دیگری کلی باشد، آن دو گزاره با یکدیگر تداخل دارند. مانند:

«همه صندلی ها چوبین هستند»، برخی از صندلی ها چوبین هستند.»

اینهمانی دو گزاره

همچنین شایان یادآوری است که اگر دو گزاره از لحاظ کمی با هم برابر باشند، از لحاظ کیفی هم با هم برابر باشند. در این صورت آندو دیگر یک گزاره هستند نه دو گزاره و رابطه اینهمانی بین آندو برقرار است که معمولاً جزو روابط منطقی به شمار نمیرود.