تکامل چیست؟

نوشته آرش بیخدا

پیشگفتار:

تکامل یک مبحث بسیار گسترده و بزرگ در رشته زیست شناسی است و نوشتن در ارتباط با آن در تارنمایی که ارتباطی با رشته های علمی ندارد بسیار دشوار است، زیرا از طرفی مطالب نباید بسیار عمیق و پیچیده و فنی باشند، و از طرف دیگر نباید بسیار سطحی باشند. هدف از نوشتن این نوشتار بیشتر یک مقدمه است برای آشنایی با تئوری تکامل و رفع شدن سوء تفاهماتی که دین خویان در مورد تکامل ایجاد کرده اند، و همچنین بررسی کوتاهی از درگیری های موجود میان دین و بویژه اسلام با تئوری تکامل است، نه شرح و توضیح علمی و کامل نظریه تکامل. علاقه مندان میتوانند برای مطالعه بیشتر در مورد تکامل به بخش زیست شناسی کتابخانه دانشگاه های شهری که در آن زندگی میکنند مراجعه کنند. توصیه میکنم علاوه بر کتابهایی در مورد تکامل، بدنبال کتابهایی در مورد داستان آدم و حوا و خلقت انسان نیز بگردید. مطمئناً اگر کتابی در این زمینه پیدا کنید در بخش افسانه ها و داستانهای ننه قمر خواهد بود نه در بخش بیولوژی. آخرین بار که من برای مطالعه در مورد تکامل به کتابخانه رفتم دست خالی برگشتم زیرا انبوه کتابهای نوشته شده در مورد هر بخش کوچکی از تکامل، انتخاب یک کتاب را برای من بسیار دشوار کرده بود و من فرصت جستجوی طولانی را نداشتم.

در این نوشتار ابتدا تاریخچه کوتاهی از تکامل و نقش داروین در تئوری تکامل را بیان خواهم کرد و سپس به تعریف تکامل خواهم پرداخت، بعد از آن تکامل را از نگر رابطه آن با وجود خدا و دین بررسی خواهم کرد و اندکی به برخوردهای میان دین خویان و تکامل خواهم پرداخت و بعد هم چند شبهه عوامانه بسیار رایج از تکامل را مطرح کرده و پاسخ خواهم داد.

تاریخچه مختصری از تکامل و نقش داروین در تکامل:

تکامل یعنی اینکه انسانها از نسل میمون ها هستند. این ابتدائی ترین و خام ترین برداشتی است که ممکن است شخصی از تکامل داشته باشد و متاسفانه تنها اطلاعی که بسیاری از دین خویان از تکامل دارند همین است، که یک آدمی به نام داروین پیدا شده است و ثابت کرده است انسانها قبلاً میمون بوده اند. متاسفانه این برداشت نابخردانه تنها بین دین خویان و خرد باختگان که انتظاری بیش از این هم از آنها نمیرود رایج نیست، بلکه کسانی که بیخدا هستند نیز برخی اوقات چنین نظراتی را اعلام میکنند.

دوست کمونیست و کردی برای من تعریف میکرد که برای «هدایت» رهبر یکی از احزاب کردستان با او جلسه ای گذاشته بودند و میخواستند به او اثبات کنند که «انسانها از نسل میمون هستند»، او به آنها با درشتی برخورد کرده بود و گفته بود نه! کرد ها از نسل شیرند.

در بیان تاریخچه مختصری از تکامل باید گفت که داروین نخستین کسی نیست که تکامل را کشف کرد، هزاران سال پیش از داروین تئوری تکامل در افسانه ها و اسطوره های برخی از ملت ها وجود داشته است، مثلا هندو ها معتقد بوده اند حیات از آب شروع شده است و اولین موجودات ابتدا در آب شکل گرفتند و بعد به سایر موجودات تبدیل شدند. بعدها دانشمندان و فلاسفه ای مثل تالس تکامل را بصورت فرضیه های طبیعی برای توضیح علمی حیات مطرح کردند اما بررسی علمی و دقیق تکامل در دوران اخیر شکل گرفته است. پیش از داروین چند دانشمند دیگر مانند لامارک شخصی که زیست شناسی را به معنی امروزی اش بنا نهاد نیز در مورد تکامل مطالعاتی داشتند و نظریاتی را نیز ارائه داده بودند.  تفاوت اصلی میان نظریه تکامل لامارک با نظریه داروین در این بود که داروین تکامل را امری گروهی و مربوط به گونه های جانوری میداند ولی لامارک آنرا امری انفرادی میدانسته است، اما با این وجود، این داروین است که  پدر تکامل خوانده میشود زیرا درک مدرن ما از تکامل به تئوری گزینش طبیعی بر میگردد که چارلز داروین و آلفرد راسل والاس آنرا در سال 1858 در کتاب «مشاء انواع یا ریشه گونه ها» (Origin of species) مطرح کردند.

تعریف گزینش طبیعی:

بر اساس نظریه گزینش طبیعی، طبیعت موجوداتی که ویژگیهای مساعد برای نجات یافتن و ادامه حیات و تکثیر شدن را دارند را حفظ میکند و موجوداتی که این ویژگی ها و صفات را نداشته باشند تدریجا منقرض میشوند.

گزینش طبیعی در قیاس با گزینش مصنوعی نامگذاری شده است که در آن انسانها گونه خاصی از جانداران را که مورد نظر آنها است انتخاب میکنند و آنها را تکثیر میکنند، مثلا کشاورزان گندم را گزینش کرده و به تکثیر آن کمک میکنند و یا دامداران گاو را گزیده و با پرورش دادن آن به ادامه حیات و تکثیر آن یاری میرسانند، داروین معتقد بود طبیعت نیز چنین میکند، و موجوداتی که بتوانند خود را با شرایط زیستی همساز کنند احتمال ادامه یافتن حیاتشان از باقی جانداران بیشتر خواهد شد و برعکس، یعنی طبیعت نیز بصورت استعاره ای همچون آن کشاورز که گزینش مصنوعی میکند، موجوداتی را انتخاب میکند و باعث گسترش آنها میشود. مفهوم گزینش طبیعی همان تولید مثل افراقی است، یعنی بعضی از اعضای یک گونه بیش از سایر اعضا تولید مثل میکنند و در نتیجه میزان بیشتری از ژن آنها به نسل بعدی انتقال می یابد. گزینش طبیعی از مرکزی ترین یا شاید هم مرکزی ترین نکاتی است که بیولوژی امروزه بر روی آن تمرکز دارد.

داروین با بررسی آناتومی استخوان بدن جانورانی که جمع آوری کرده بود به این نتیجه رسید که شباهت بسیار زیادی در طرز شکل گیری این ساختمان استخوانها وجود دارد و در مورد انسان اعلام کرد که آناتومی بدن انسان با آناتومی بدن بوزینه (و نه میمون، ساختمان بدن میمون و گوریل و شامپانزه و بوزینه علی رغم تشابه ظاهری بسیار متفاوت است) بسیار شبیه است و نتیجه گرفت که انسان و بوزینه از یک تیره و از یک منشع تکاملی هستند (نه اینکه انسان قبلا بوزینه بوده است)، یعنی به تعبیری پسر عموهای یکدیگر هستند. نکته جالب این است که کلمه اورانگوتان که ریشه مالزیایی دارد به معنی «مرد جنگلی» است. داروین حدود 20 سال از انتشار تئوری خود، خودداری کرد و بعد از تحقیقات بسیار آنرا انتشار داد. خود کتاب داروین از آثار بسیار جالب علمی است، خواندن کتاب او به همه کسانی که علاقه مند به چنین موضوعاتی هستند توصیه میشود.

تکامل امروز با آنچه داروین کشف کرده بود بسیار متفاوت است و مانند هر موضوع دیگری دستخوش تغییرات گسترده شده است و خود تکامل یافته است. بنابر این داروین نخستین کاشف تکامل نیست، بلکه از کسانی است که بیشترین خدمت را به بیولوژی در این زمینه کرده است، داروین مبتکر نظریه گزینش طبیعی است و نظریه او از نظریاتی است که انقلابی را در دنیای علم راه انداختند.

تکامل چیست:

اگر  تاریخ زمین را بصورت یک تقویم 30 روزه از ابتدای بوجود آمدن زمین تا به امروز تصور کنیم. هر روز آن 150 میلیون سال خواهد بود. خواهیم دید که اولین سیستمهای زنده در روز  4ام این تقویم که برابر خواهد بود با تقریبا 4 میلیارد سال پیش بوجود آمدند. اولین سیستمهای زنده در واقع بسیار زود بدنیا آمدند. قدیمیترین فسیلهایی که یافت شده است در حدود 3.1 میلیارد سال پیش (27 امین روز) بوجود آمدند. بر اساس این تقویم اولین انسانهای واقعی چیزی حدود 10 دقیقه آخر این تقویم به دنیا آمدند و تاریخ ثبت شده بشری که به دوران سومری ها باز میگردد حدود 30 ثانیه آخری این تقویم را اشغال میکند. به این تقویم، تقویم زمین شناسی گفته میشود که نمونه ای بسیار مختصر از آن در زیر آمده است. علامت سوال به این معنی است که در دقت این روز در زمین شناسی تردید وجود دارد.

 تقویم زمین شناسی Geological Calander.منبع این اطلاعات یکی از کتابهای دانشگاهی رشته بیولوژی با مشخصات زیر است:

Life on Earth (Second Edition)Authors: Willson, Eisner, Briggs, Dickerson, Metzenberg, O’Brien, Susman, Boggs.
دوران ARCHEOZIC
دوران PROTEROZOIC
دوران PALEOZOIC
دوران MESOZOIC
دوران CENOZOIC
1 2
3 4اولین نظام زنده؟ 5 6 7اولین سلول؟ 8باکتری 9سرخسهای سبز و آبی
10قدیمیترین فسیلها(FIG TREE CHERT) 11 12 13 14 15 16
17 18 19 20 21 22 23
24اولین سلولهای EUCARYOTIC 25اولین حیوانات 26 27حیات آبزی(فسیلهای فراوان یافت شده است) 28اولین گیاهان روی خشکیاولین مهره داراناولین حیوانات روی خشکیاولین دوزیستان 29جنگلهای زغالی انبوهحشرات 30دایناسورها و اولین پرنده هااولین گیاهان گلدار
اولین پستانداران  و چیرگی خزندگان چیرگی پستانداران


حال

همانطور که در این تقویم نیز مشخص است، گونه های مختلف جانوری همگی به یکباره پا به زمین نگذاشته اند، بلکه به تدریج گونه های جدیدی در روی زمین بوجود آمده اند. وجود تک سلولی ها بر روی سیاره ای با شرایط مساعد برای حیات همچون زمین کافی است تا به بوجود آمدن پر سلولی ها، نرم تنان، بی مهرگان، دو زیستان، پستانداران و در نهایت انسان بیانجامد. این تقویم تنها موجوداتی که پا به روی زمین گذاشته اند را نشان میدهد، جالب است بدانید دانشمندان معتقدند تعداد گونه های جانوری که هم اکنون بر روی زمین وجود دارند کمتر از یک دهم 1% تمام گونه های جانوری است که تابحال روی زمین زیسته اند.  باید توجه داشت که تئوری تکامل به نحوه پیدایش حیات و تک سلولی های نخستین ارتباط چندانی ندارد، بلکه به چگونگی ادامه حیات ارتباط دارد، برای توضیح چگونگی شکل گیری حیات تئوریهای دیگری همچون آزمایش میلر یولر مورد بررسی قرار گرفته اند. حال تکامل نظریه ای است که میتواند به ما در فهم اینکه چگونه گونه های جانوری جدید بر روی زمین پدیدار میشود و برخی جانداران نیز از روی زمین محو میشوند کمک میکند.

تعریف تکامل:

تکامل در بیولوژی، به پروسه ای اطلاق میشود که بر اساس آن، جمعیت گونه ها با ویژگیهای برتر وراثتی افزایش می یابند و از نسلی به نسل بعدی منتقل میشوند. در طول زمان این ویژگیها به گونه جانوری کمک میکنند که به تعداد بیشتری نسبت به گونه های رقیب تکثیر بیابند و در جمعیت بر آنها تسلط بیابند. اتفاق افتادن این پروسه در مدت های طولانی میتواند پدید آمدن موجودات جدید را توضیح دهد.

بر اساس تئوری تکامل موجودات جدید تر همگی اجداد مشترکی دارند، و برای نشان دادن این شراکت در اجداد، معمولا از درختواره های فیلوژنتیکی (Phylogenetic tree) استفاده میشود، بعنوان مثال درختواره زیر (برای بزرگ شدن روی آن کلیک کنید) ارتباط حیوانات با گیاهان و سایر موجودات را نشان میدهد.

منبع تصویر + (تارنمای دانشگاه ایالت فلوریدا)

فسیلهای باقیمانده از اجداد انسانها به خوبی نشان میدهد که ساختار بدن آنها با بدن انسانهای امروزی بسیار متفاوت هستند و اکتشافات در این مورد بسیار گسترده بوده است و شاید آخرین آنها کشف آدمها با ساختمان بدنی کوچکتر و جمجمه کوچکتر اشاره کرد که در اکتبر 2004 در جزیره فلورز یافت شد (منبع خبر +) اما امروز بالاخره با پیشرفت ژنتیک دیگر نیازی به پیدا کردن استخوان ها و فسیل ها برای اثبات تئوری تکامل وجود ندارد، پیشرفت علوم مارا برای بررسی تکامل از یافتن فسیل ها و باقیمانده های جانوران تقریباً بی نیاز میکنند، هرچند گنجینه بسیار غنی از فسیلها امروز از لحاظ شهودی نیز راه را برای مشاهده تکامل جانوران بسیار هموار میکند.

یافته ها در مورد فسیل ها بسیار پرارزش هستند اما باید توجه کرد که باقی ماندن یک جانور بصورت فسیلی امری بسیار نادر است چون معمولاً شرایط بسیار خاص و دقیقی باید شکل بگیرد که جانوری بصورت فسیل باقی بماند، مثلاً جسد آن جانور باید بر اثر اتفاقات خاصی در لجن مدفون شده باشد و هزاران عامل دیگر باید وجود داشته باشند که از جانوری فسیل باقی بماند. بنابر این ایرادی که برخی از دین خویان به تکامل وارد میکنند، مبنی بر اینکه فسیل های کافی برای اثبات تکامل یافته نشده است، حتی اگر چنین فرضی را درست فرض کنیم نیز ایرادی معتبر نخواهد بود.

همانطور که گفته شد توسعه و پیشرفت در ژنتیک درهای جدیدی را برای فهم تکامل باز کرده است، بگونه ای  که امروز مطالعات ژنتیکی پایه درک ما از تکامل هستند، یعنی بهترین توضیحات و توجیهات را برای بررسی موضوعات مختلف در ارتباط با تکامل را میتوان از دیدگاه ژنتیکی دریافت کرد. اطلاعات ژنتیکی که دستورالعمل های ساخت سلول هستند را امروز میتوان در هر موجودی مانند یک کتاب باز کرد و خواند. و همین تحقیقات ژنتیکی امروز نشان میدهد که 99% ژنهای انسان و بوزینه کاملا مشترک هستند و تفاوت بیولوژیکی میان انسانها و بوزینه ها در همان 1% است که باهم اختلاف دارند، بنابر این تحقیقات امروزی هم تئوری داروین را که با بررسی و مشاهده استخوانهای جانوران توسعه یافته بود، تایید میکنند. برای توضیح بیشتر در این مورد ابتدا باید اندکی با DNA آشنا شویم. در مورد DNA بطور مفصل در نوشته ای با فرنام (بنیاد و شالوده حیات، حیات چگونه آغاز میشود ؟) توضیحات کافی داده شده است و در اینجا تنها بطور مختصر در مورد آن توضیحاتی داده خواهد شد.

DNA یک مولکول بلند است که از زنجیره ای از واحدهای کوچکتر بیوپولیمر (واحدهای مرکبی که در سلول های زنده پیدا میشوند، مانند پروتئین ها، اسید نوکلئید ها و یا کربوهیدراتها ) تشکیل شده اند. اگر تمام DNA های انسان در کنار هم قرار گیرند و انتهایشان به ابتدای دیگری متصل شود رشته ای به طول تقریبی 175 سانتیمتر ضخامتی کمتر از یک میلیونیم سانتیمتر حاصل میشود. اگر ضخامت و طول این رشته را بصورت متناسب به ضخامت یک رشته سیم ویولون افزایش دهیم، طول رشته به حدود 9 مایل خواهد رسید. در درون سلول این مولکولهای بلند دو به دو با هم پیچ میخورند و یک RNA را تشکیل میدهند. این رشته ها بوسیله پیوند هایی شیمیایی ای متشکل از فسفر و نوعی قند که بین این دو رشته وجود دارد به هم پیوسته میشوند. این پیوندها در واقع از یک بدنه و یک پایه تشکیل شده اند،  دو نوع پایه در این پیوند ها وجود دارد که پورین و پریمیدین نامیده میشوند. هر کدام از این دو نوع پایه خود دو نوع دیگر دارند، این پایه ها با توجه به نوع مواد شیمیایی بکار رفته در آنها دسته بندی شده اند.

  • پورین ها (Purines) خود به  دو دسته دیگر تقسیم میشوند:

1. آدنین (Adenine) که با حرف A نمایش داده میشوند.

2. گانین  (Guanine) که با حرف G نمایش داده میشوند.

  • و پریمیدین ها (Pyrimidines) نیز خود به دو دسته دیگر تقسیم میشوند:

3. تیمین (Thymine) که با حرف T نمایش داده میشوند.

4. سیتوزین (Cytosine) که با حرف C نمایش داده میشوند.

بنابر این ما 4 نوع پایه داریم که اینها یک سیستم عددی مبنای 4 را برای تبادل اطلاعات بین مولکول ها بر عهده دارند.  بنابر این اطلاعات DNA یک موجود را میتوان همچون رشته ای از اطلاعات صفر و یک کامپیوتری (مبنای دو که تمام دستگاه های دیجیتال از آن استفاده میکنند) همچون کتابی خواند، با این تفاوت که الفبای  DNA تنها از 4 حرف تشکیل شده است. بعنوان مثال رشته زیر را میتوان حاوی اطلاعاتی دانست که از سلولی به سلول دیگر منتقل شده است.

ATAATTCGTTCAAGGGCTATATGCCGTTTAAAACGT

واحد های تولید کننده و نوع مواد تشکیل دهنده DNA تقریباً در تمامی موجودات روی کره زمین (به استثنای چند ویروس که مواد دیگری DNA آنها را تشکیل میدهند) مشترک و دقیقا شبیه یکدیگر هستند. این موضوع خود نشان میدهد که تمامی این DNA ها ریشه های مشترک دارند و از یک جا برخاسته اند و از DNA اولیه ای که شکل گرفته است مشتق شده اند. اما بطور مشخص و واضحی اطلاعات DNA یک انسان سیاه پوست با یک انسان سفید پوست تفاوت هایی دارد و میان DNA یک انسان با یک گیاه تفاوت های بسیار بیشتری وجود دارد و یا اطلاعات میان DNA یک انسان و یک بوزینه 99% مشابه یکدیگر است. و البته میان DNA افرادی که از یک خانواده هستند تفاوت اطلاعات بسیار ناچیز تر است از تفاوت DNA بین دو غریبه. میان DNA زن و مرد نیز تفاوت هایی وجود دارد.  تشابه میان اطلاعات ژنتیکی انسان و بوزینه نظریه داروین مبتنی بر ارتباط انسانها و بوزینه ها را که از روی مشاهده فیزیولوژیکی بدن بوزینه انجام گرفته بود تایید میکند. بطور کلی برای نشان دادن اینکه انسان چگونه تکامل یافته است، دو درختواره توصیه میشود، که هر دو آنها را میتوانید در زیر ببینید.

میمون اورانگوتان گوریل بوزینه انسان
میمون اورانگوتان گوریل بوزینه انسان

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

همانگونه که گفته شد تکامل ارتباط مستقیمی با ژنتیک دارد، DNA در واقع دستور العمل های مهندسی ای را داراست که دستور العمل ساخت سلول را به مهندس های موجودات زنده یعنی پروتئین ها منتقل میکند و پروتئین ها با دقت تمام این دستور العمل ها را پیاده میکنند و نتیجه یک سلول با فعالیت دقیقاً مشخص و با ظرافت تمام است. همانطور که نوشته های الفبای مبنای 32 زبان فارسی از نقطه ها و کلمات و فاصله ها تشکیل شده است، الفبای مبنای 4 ژنتیکی نیز از حالت مشابهی پیروی میکنند و الفبای خاص خود را دارند.

همانطور که گفته شد DNA ها خود نیز از پروتئین های کوچکتری که خود متشکل از آمینو اسید ها هستند ساخته شده اند و تعداد کل انواع آمینو اسید ها در سلولهای بدن 20 نوع است. در یک زبان مبنای 4 برای نامیدن هرکدام از این 20 نوع آمینو اسید تنها 3 حرف نیاز است و 64  (4 * 4 * 4) کلمه 3 حرفی مختلف را میتوان با ترکیب این الفبای چهار حرفی ژنتیکی تشکیل داد. اما در موجودات زنده تنها از 16 نوع کلمه سه حرفی متشکل از این حروف الفبای مبنای 4 استفاده میشود که به هر کدام اصطلاحا کودون (Codon) میگویند. شکل زیر این مفهوم را به تصویر کشیده است.

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

هر کدام از این کودون ها معنی مشخصی دارند و همه آنها امروز شناخته شده اند و معانی آنها نیز تفسیر شده است. بعضی از این کودون ها نقش آغاز و پایان یک پیغام ژنتیکی را بازی میکنند. شکل این پایه ها بگونه ای است که تنها میتوانند با پایه مشخصی توسط پیوند های هیدروژنی ترکیب شوند و ارتباط برقرار کنند، مثلا هروقت در یک شاخه A وجود داشته باشد، حتماً باید در طرف دیگر T وجود داشته باشد. پیوستن A با C مانند این است که کسی تلاش کند یک دوشاخه را به یک پریز که سه سوراخ دارد وصل کند، این اتفاق غیر ممکن نیست اما بسیار دشوار است و بسیار کم اتفاق می افتد.

A با T پیوند میخورد

C با G پیوند میخورد

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

این است که در واقع وقتی سلولی میخواهد تکثیر شود، در بین دو رشته ای که اطلاعات DNA آنرا تشکیل میدهند شکافی ایجاد میشود. چون A تنها با T و C تنها با G ارتباط برقرار میکند، این دو رشته از هم شکافته شده دقیقا اطلاعات مشترکی را حمل میکنند و مانند این است که قرینه یکدیگر باشند، بعد ازجدا شدن این دو شاخه وقتی DNA جدید درون فضایی پر از انواع و اقسام آمینو اسید ها قرار میگیرد به سرعت جفت های خود را جذب میکند، و دوباره به یک شکل نردبان پیچ خورده دو شاخه ای مانند آنچه قبلا در سلول قبلی بوده است تبدیل میشود و در این پروسه است که دستور العمل های ساخت سلول از سلولی به سلول دیگر منتقل میشوند. اطلاعات ترتیب یافته به سبک اطلاعات ژنتیکی در واقع حاوی تمام مشخصات موجود جدیدی است که باید شکل گیرد، این اطلاعات در میان تمام جانوران از والد به فرزند انتقال می یابند و در بدن فرزند دوباره شبیه سازی میشود.

حال بصورت تصادفی و بر اثر برخی علت های دیگر گاهی اوقات این اطلاعات ژنتیکی بواسطه یک جهش ژنتیکی تغییر پیدا میکنند. اگر جهش ژنتیکی وجود نداشته باشد تمامی موجودات دقیقاً شبیه یکدیگر خواهند بود. این تغییرات ژنتیکی یکی از عوامل تکامل هستند و عامل دیگر نیز شرایط زیستی در محیطی است که این جانداران در آن زندگی میکنند. تغییرات زیست محیطی باعث میشوند موجوداتی که سازگارتر با محیط هستند نجات پیدا کنند و موجوداتی که سازگاری با محیط ندارند نابود شوند. برای اینکه این مسئله بهتر درک شود به مثالی توجه کنید:

در جنوب غربی ایالات متحده امریکا زمینهای شنی وجود داشت که رنگ زرد داشتند، تا اینکه آتشفشانی فوران میکند و مواد مذاب روی سطح شن ها را فرا میگیرند، بعد از اینکه این مواد مذاب سرد میشوند سطح این زمین زرد رنگ به سنگهای تیره تبدیل میشود، موشهای زرد رنگی که رنگ زمین شنی پیش از فوران آتشفشان در آن زمین ها زندگی میکردند به این منطقه جدید باز میگردند، هر 1000 سال یکبار یک موش سیاه رنگ بر اساس تصادفات (جهش) ژنتیکی ایجاد میشود، اگر فرض کنیم در صورتی که سیاه بودن یک موش  یک صدم درصد احتمال بقای آن موش را نسبت به موشهای زرد بیشتر بکند، زیرا جغدهایی که در آن منطقه وجود دارند میتوانند موش های زرد رنگ را به دلیل اینکه نمیتوانند خود را بر روی سنگ های سیاه استتار کنند به سادگی شکار میکنند، در حالی که موش های سیاه میتوانند بسیار ساده تر خود را از دید شکارچیان پنهان کنند، در نتیجه جمعیت موشهای سیاه به تدریج بیشتر میشود و جمعیت موشهای زرد کمتر و کمتر میشود، بعد از حدود 1000 نسل از زاد و ولد این گونه جانوری جمعیت موشهای سیاه به نود و پنج درصد کل جمعیت موشها تبدیل میشود. در این مثال یک موش سیاه به دلیل تغییری که برای نجات در مورد او تحقق افتاده است پس از 1000 نسل به اکثریت آن گونه جانوری تبدیل میشود. حال اگر فرض کنیم آن امتیاز از یک صدم درصد به ده درصد تبدیل شود این وضعیت در 100 نسل تحقق خواهد یافت، و تحقیقات نشان داده است که این عدد حتی بیش از ده درصد است. در واقعیت این تغییر جمعیت و تکامل ممکن است در صد سال اتفاق بیافتد.

میبینیم که در مثال بالا که یک مورد کوچک از تکامل است، هر دو عامل، یعنی شانس و همچنین شرایط زیستی چگونه باعث تکامل یافتن این موجودات میشود. تغییرات متعدد به مرور زمان منجر به شکل گیری گونه های جدید بسیار متفاوت با گونه های پیشین میشود و تکامل همیشه ادامه پیدا میکند، در نتیجه همه جانداران در هر زمان و مکانی همواره در حال تکامل یافتن هستند.

تکامل و ارتباط آن با دین و خدا:

یکی از مسائلی که باعث میشود دین داران با این تئوری علمی در جنگ باشند این است که تکامل نشان میدهد انسانها از نگر بیولوژیکی آنچنان موجودات متفاوتی از سایر جانداران نیستند، اما  بر اساس باورهای دینی انسانها اشرف مخلوقات هستند و جهان برای انسانها آفریده شده است (به این دیدگاه انتروسنتریسم «Anthropocentrism» گفته میشود)، اما تئوری تکامل و سایر واقعیت های طبیعی نشان میدهند که اینگونه نیست و این انسان است که بگونه ای سازگار با طبیعت تکامل یافته است. دلیل دشمنی دین داران با کشف شدن اینکه زمین مرکز کائنات نیست نیز همین بود، باورهای دینی به آنها آموخته بود که زمین مهمترین عنصر تمام کائنات است (به این دیدگاه ژئوسنتریسم Geocentrism گفته میشود) و اگر اینچنین نبود از نظر آنها دیگر لابد انسان نیز مهمترین موجود نبود و اتفاقا بعدها هم همان تکامل نشان داد که اینگونه است و انسان نیز از لحاظ بیولوژیکی و طبیعی یک حیوان است. برخی از دین داران گمان میکنند این واقعیت توهین به بشر است که به او گفته شود تو نیز یک قسمتی از طبیعت هستی و صاحب طبیعت نیستی و ابر و باد و مه و خورشید برای تو در کار نیستند. حتی برخی از نادانترین دینگرایان این را اثباتی بر درستی دینشان قرار داده اند، یعنی مثلاً گفته اند تکامل باطل است زیرا انسان را پایین می آورد و دین درست است زیرا انسان را بالا میبرد، و این چیزی جز مغلطه توسل به نتیجه باور نیست، یعنی از روی خوبی و بدی نمیتوان درستی و یا نادرستی یک قضیه را اثبات کرد، این «استدلال» خداباوران به این معنی است که انگار هر نظریه ای که جایگاه بالاتری به انسان بدهد، آن قضیه درست تر است، اگر این قضیه نابخردانه درست باشد، میتوان گفت خدا نوکر و بنده انسان است، زیرا در این صورت انسان جایگاهش بسیار بالاتر خواهد بود، و دین داران با اینکه میگویند انسان بنده خدا است به بشر توهین میکنند، این دو «استدلال» به یک اندازه مضحک هستند.

دیگر مسئله ای که باعث دشمنی دینداران با تئوری تکامل شده است داستانها و اسطوره های خلقت مانند قصه آدم و حوا است که بنیادگرایان دینی برداشتی واقع انگارانه از آنها دارند، یعنی معتقدند واقعا چنین اتفاقهایی افتاده است و روشن است که این داستانها در صورت درست بودن تئوری تکامل تنها به قصه هایی تبدیل میشوند که واقعیت خارجی نداشته اند. در ادبیات تمام ملتها معمولا اسطوره های خلقت یافت میشوند، مثلا در اسطوره های ایرانی داستان مشیه و مشیانه وجود دارد. داستان آدم و حوا نیز تنها یک داستان محلی اینچنین در میان یهودیان بوده است که مسلمانان گمان میکنند چون در قرآن است باید حقیقت مطلق باشد. این دیدگاه از طرف دینداران مدرنتر مورد تایید است، مثلا پاپ ژان پل دوم اعلام کرده بود که داستان آدم و حوا میتواند تنها یک داستان آموزنده باشد، و تکامل ممکن است درست باشد، اگر تکامل درست باشد لزوماً لطمه ای به انجیل و تورات نمیخورد. اما مسیحیان و مسلمانان و یهودیان بنیادگرا با برداشتهای لیبرالتر از داستانهای دینی توافق ندارند در کنار تکامل سعی کرده اند تئوری (!) های دیگری همچون تنظیم هوشمند (Intelligent Design) و یا خلقت علمی (Creationist science) پدید آورده اند که این دیدگاه ها در مجامع علمی مورد قبول نبوده اند و در دادگاه های مختلف در کشورهای مختلف طرفداران تدریس این مفاهیم محکوم به دروغگویی و تلاش برای علمی جلوه دادن اباطیل دینیشان شده اند.

عده ای گمان میکنند تکامل ضد وجود خدا است و سازگاری با وجود خدا ندارد، برداشت این عده ناشی از درک ضعیف آنها از مسئله علیت است، این افراد گمان میکنند که اگر همه چیز در مورد حیات با تئوری ها و علتهای طبیعی قابل توضیح باشد دیگر نمیتوان برای خدا نقشی را در نظر گرفت، بعبارت دیگر این عده برای خدا بدنبال علت عرضی میگردند. بطور کلی نه تئوری تکامل نه هیچ تئوری علمی دیگری نمیتواند عدم وجود خدا را اثبات کند، اثبات عدم وجود خدا مسئله ای کاملاً فلسفی است نه علمی زیرا خداوند در صورتی که وجود داشته باشد میتواند علتی طولی باشد، در این مورد در نوشتاری با فرنام «خدای حفره ها چیست؟» توضیحات کامل آورده شده است، بنابر این تکامل به هیچ عنوان تئوری نیست که درستی آن عدم وجود خدا را اثبات کند و کمتر فیلسوف بیخدایی است که از تکامل بدین شکل سود جسته باشد، مگر آنکه در رد  برهان نظم از آن برای نشان دادن اینکه تئوری تکامل لزوماً نیازی به علت عرضی الهی ندارد استفاده کرده باشد، اما این ناسازگاری تنها بین خدای فلسفی (خداوند چیست؟) است که وجود ندارد، بین خدای دینی، مثلا خدای اسلام و تکامل ممکن است اختلاف نظر وجود داشته باشد، زیرا خدای اسلام گفته است که بشر بصورت خلقت آدم و حوا بوجود آمده است و آدم تکامل یافته نبوده بلکه از خاک پدید آمده است و این کاملا در تناقض با نظریه تکامل است. نتیجه آنکه استفاده از تئوری تکامل برای اثبات عدم وجود خدا بصورت عام آن جایز و درست نیست اما استفاده از این تئوری برای رد وجود خداهای خاصی مثل خدای اسلام ممکن است درست باشد و وحشت دین خویان از این تئوری نیز ممکن است دلیلی موجه داشته باشد.

اما از این گذشته تکامل بدون شک به گسترش بیخدایی کمک کرده است، در فلسفه روشی وجود دارد که معروف به «تیغ اوکام» (Occam’s Razor) است. بر اساس این روش وقتی توضیحات کافی برای توضیح یک قضیه وجود داشته باشد، توضیحات اضافی دیگر که در توضیح آن قضیه تغییری ایجاد نمیکنند اهمیتی پیدا نمیکنند و حتی نادیده گرفته میشوند، از این روش معمولا بیشتر در بررسی نظریه های طبیعی استفاده میشود. دلیل این نامگذاری نیز این است که این روش همچون یک تیغ توضیحات اضافی در مورد هر قضیه را میبرد و اوکام نیز نام منطق دان انگلیسی بوده است که این روش را معرفی کرده است. در بررسی مسئله روح مثالی را مطرح کردم که در اینجا نیز آنرا تکرار میکنم. تصور کنید عده ای به موجودی نامرئی و غیر مادی به نام «گوراگورا اعتقاد داشته باشند و ادعا کنند گوراگورا موجودی است که در هنگام عطسه کردن نزد انسانها می آید و انسانها را میبوسد. و بوسه او سبب عطسه انسانها میشود. هیچ کس نمیتواند گوراگورا را ببیند و یا او را لمس کند. حال آیا کسی میتواند اثبات کند که گوراگورا وجود ندارد؟ این باورمندان به گوراگورا ممکن است به شما بگویند هر گاه او شما را ببوسد شما عطسه کرده اید و هر گاه شما را نبوسد عطسه نخواهید کرد، و اگر شما این باور آنها را انکار کنید، آنها از شما خواهند پرسید، پس انسان برای چه عطسه میکند؟ اگر دلیلی علمی برای عطسه پیدا کنید و به آنها بگویید که عطسه کردن به این دلیل و به آن دلیل علمی است که اتفاق می افتد، ممکن است معتقدان به گوراگورا به شما بگویند «خوب ما نیز منکر این دلایل علمی نیستیم، اما گوراگورا هم همزمان با آن دلایل علمی شما را میبوسد، و اگر گوراگورا وجود نداشته باشد و شما را نبوسد شما هرگز عطسه نخواهید کرد.» حال برای دانشمندی که قضیه عطسه کردن را بررسی میکند، یافتن دلایل علمی عطسه کردن کافی هستند و او هیچ توضیح اضافی در مورد گوراگورا را نخواهد پذیرفت. ارتباط تکامل با خدا نیز بسیار مشابه با همین مثال است. اعتقاد به اینکه خدا باعث تکامل شده است همانقدر خردمندانه است که اعتقاد به اینکه گوراگرا باعث عطسه کردن میشود خردمندانه است. اما به نظر من هرگز نمیتوان از تکامل علیه وجود خدا بطور قطعی استفاده کرد.

برخی از خداباوران معتقدند تکامل نیز به دلیل پیچیدگی و نظمی که درون خود دارد نمیتواند بدون نظارت خدا ممکن باشد، این «استدلال» بسیار شبیه به برهان نظم است و در رد برهان نظم به اندازه کافی در دفاع از بطلان بودن این استدلال صحبت شده است.

شبهات رایج در مورد تکامل:

بعد از این توضیحات مختصر راجع به تکامل اکنون شایسته است به برخی از شبهات رایج که در مورد تکامل مطرح میشود و معمولا ناشی از سوء تفاهماتی است که در اذهان اشخاص پیش می آید بپردازیم. در این بخش به دو شبهه بسیار رایج در مورد تکامل خواهیم پرداخت.

تکامل هنوز اثبات نشده است و تنها یک نظریه است:

این اعتراض از رایج ترین اعتراضاتی است که عوام نسبت به تکامل مطرح میکنند. این افراد نمیدانند که در دنیای علم هیچ مفهومی بالاتر از تئوری نمیرود و تئوری بالاترین مرحله ایست که یک نظر علمی میتواند داشته باشد. بسیاری از سایر مفاهیم علمی همچون جاذبه نیوتون، سرعت نور، بیگ بنگ و غیره تماما تئوری هستند، اساساً هرچیز که بر مشاهده مبتنی باشد نمیتواند از مرحله تئوری بالاتر رود. در برخی از شاخه های علم (منظور از علم همان Science) است، مفاهیمی وجود دارند که مشتق شده از اصول قطعی ریاضیات هستند به آن دسته از مفاهیم قضیه یا تئورم (Theorem) گفته میشود مثلا روابط فیثاغورس و تالس دو نمونه از قضایا هستند، سایر چیز ها نمیتوانند چیزی جز تئوری باشند. پیرامون این مسئله در نوشتاری با فرنام علم چیست؟  توضیحات بیشتری آورده شده است.

نتیجه آنکه تئوری بودن تکامل نمیتواند از ارزش و درستی آن بکاهد و کسانی که این ایراد را وارد میکنند مفهوم کلمه «تئوری» را در فلسفه علم درک نمیکنند. از این گذشته هر تئوری برای توضیح یک واقعیت شکل میگیرد، مثلاً تئوری جاذبه نیوتون برای توضیح واقعیت جاذبه شکل گرفته است، دقیقاً همین ارتباط میان تئوری تکامل و خود تکامل بعنوان یک واقعیت وجود دارد.

تکامل تصادفی است و احتمال آن پایین است، پس محال است:

در پاسخ به این شبهه باید گفت نخست اینکه تکامل تماماً مبتنی بر تصادف نیست، شخصی که این اعتراض را مطرح میکند عامل دوم تکامل را که عاملی غیر تصادفی است را نادیده میگیرد، از این گذشته تئوری تکامل تماماً مبتنی بر تصادف نیست، بلکه عوامل جبری نیز در آن نقش بازی میکنند. بسیاری از بیولوژیست ها معتقدند دو عامل اساسی در تکامل نقش بازی میکنند،

  1. تغییراتی که بر اساس تحولات تصادفی ژنتیکی (جهش ژنتیکی) انجام میگیرند.
  2. تغییراتی که قدرت و احتمال نجات یافتن و تکثیر موجود را بالا میبرند، که عدم تحقق این تغییرات موجب حذف آن موجود توسط گزینش طبیعی میشود.

کسانی که این اعتراض را بیان میکنند درکی بسیار ضعیف از تئوری احتمالات دارند، اینکه احتمال وقوع یک اتفاق پایین باشد هرگز و هرگز به این معنی نیست که آن اتفاق محال است، لذا این اعتراض نیز از پایه غلط است. در این مورد در نوشتاری با فرنام «مگر میشود همه چیز بطور تصادفی بوجود آمده باشد؟» توضیحات کافی داده شده است.

نتیجه گیری:

باید روی این نکته تاکید کرد که تکامل باور دینی و داگمای بیخدایان نیست، بیخدایان وجود خدا را به این دلیل انکار و نفی نمیکنند که معتقد به تکامل هستند. اینکه بیشتر بیخدایان معتقد به تکامل هستند به این دلیل است که بیخدایان معمولا بیشتر از خداباوران علاقه به یافته های مستند علمی دارند و با تئوری های علمی خردگرایانه تر برخورد میکنند و معتقد به قصه های ننه قمر کتابهای دینی نیستند. هیچ نظریه دیگری در حال حاضر برای توضیح انواع گونه های جانوری وجود ندارد و اگر تکامل روزی رد شود و تئوری بهتری ارائه شود بدون شک بیخدایان خردگرا نیز این تئوری را کنار گذاشته و تئوری جدید را خواهند پذیرفت.

در پایان با معرفی چند لینک دانشگاهی برای آموختن بیشتر در مورد تکامل این نوشتار را به پایام میبرم.

کتاب داروین بصورت گفتاری +