بایگانی برچسب‌ها: پرسش

آیا جهاد امری دفاعی است؟

نقد و رد سفسطه دفاعی بودن آیات جنایی قرآن.

پیشگفتار

توصیه میشود پیش از خواندن این نوشتار، دو نوشتار 164 آیه جهاد در قرآن و همچنین  بخش آیات جنایی قرآن را بخوانید.

بدون شک يکي از مهمترین مسائل در پیرامون به اسلام که در درازاي تاریخ مورد انتقاد شديد و بازپرسي انديشمندان و پژوهشگران منتقد اديان و اسلامشناسان منتقد قرار گرفته است و اکنون نيز نقد و بررسي ميشود، و هر چند وقت یکبار جهانیان را مجبور میکند که به یاد اسلام بیافتند، ذات خشن، جنگ طلبانه، تجاوزگرانه و تروریستی اسلام بوده و هست. اسلام در حقيقت يک اندیشه ي سیاسی مرگبار و فاشیستی است، که ماهيت خود را زیر سايه ي ناموجوديهاي فراطبیعی و نا محسوس خرافی و محبوب عوام پنهان میکند و با آميخته شدن در قدرت و سياست که جزيي جدايي ناپذير از آن است، جامعه ي انساني را دچار کمبود ها و ددمنشيهاي بسيار زيان آوري ميکند.

آنچه که از سوي انسانگرایان غیر مسلمان بشدت باعث  انزجار از اسلام ميشود و بيش از هر موضوع ديگري به چشم آنها می آید و همواره بگونه اي واضح اسلامگرایان را از دیگر افراد جامعه جدا ميسازد همين توحش و خشونتی است که در نتيجه ي باورهاي اسلامي در کردار اسلامگرايان نمايان ميشود. که اين خشونت خود بعنوان عمده ترین پيامدهايي شناخته ميشود که انديشه ي اسلامي براي انسان غیر مسلمان به ثمر مي آورد مسئله جهاد که از اصولی ترین و اساسی ترین مسائل اسلام است از مهمترین نمودهای قانوني و نامگذاري شده ی این توحش و خشونت طلبی است.

بر هر شخصی که اندکی با قرآن آشنا باشد آشکار است که از اساسی ترین پیامهای قرآن تشویق و ترویج مسلمانان به جنگ و خشونت و جهاد است. این پیامها معمولاً از سوي روحانیون و مروجین اسلام در مواقع صلح و زمانی که مسلمانان قدرت تجاوز به دیگران را ندارند پنهان نگاه داشته ميشوند و اما در هنگامی که همين روحانیون تمايل به وا داشتن مسلمانان به کشتن ديگران و کشته شدن خود آنها پيدا ميکنند، این آیات را رو کرده و به تبليغ و شناساندن آنها ميپردازند.

پنهان شدن این آیات جنایی دستکم دو دلیل دارد، دلیل نخست این است که روحانیون میترسند آتش جهاد و توحش اسلامی دامن خودشان را هم بگیرد، در دوران معاصر دستکم یکبار این اتفاق افتاده است، گروه تروریستی فرقان، کسانی که طرفدار اندیشه های شریعتی بودند بر روی آخوندها شمشیر کشیدیند و آنها را ترور کردند و دلیل دوم این است که جنگ و خشونت که از بنمایه های اصلی اسلام بوده و هست در نگر انسانگرایان و مسلمانانی که اسلام هنوز انسانیتشان را کامل تخریب نکرده است منفی و بد جلوه میکند و از این رو بر دین فروشان بهتر است که این لکه ننگ را تا میتوانند پنهان دارند.

اما افشا شدن این آیات و اصول غیر انسانی و غیر اخلاقی طبیعتاً پاسخهایی را نیز از طرف مسلمانان به همراه دارد. عمده ترین پاسخ سفسطه آمیزی که به این اعتراض داده میشود و شبهه ای که از طرف مسلمانان و اسلامگرایان بر این اعتراض وارد میشود این است که جهاد مسئله ای دفاعی است و دفاع نیز حق طبیعی هر ملتی است. باقی سفسطه هایی که در این مورد میشود حتی آنقدر ارزش و عمق ندارند که بتوان به آنها پرداخت و پاسخی برای آنها نوشت.

هدف من از نوشتن این نوشتار نقد این پاسخ و نشان دادن آن است که این پاسخ سفسطه آمیز است و دروغی دیگر است از طرف اسلامگرایان برای نقاب کشیدن بر روی چهره زشت و انسان ستیز اسلام. برای رسیدن به این هدف به ناچار باید به مقدار لازم پیرامون مسئله جهاد توضیح دهم و به همین دلیل این نوشتار را میتوان بعنوان توضیحاتی بر مسئله جهاد اسلامی نیز تلقی کرد.

جهاد یعنی چه؟

واژه ي جهاد همچون بیشتر واژه هایی که در فقه و اصول اسلامی در مورد آنها بحث میشود دارای یک معنی لغوی و یک معنی اصطلاحی است معنی لغوی جهاد در پارسی «تلاش، تکاپو، و جنگ» است. معنی مصطلح قرآنی جهاد نیز تلاش و تکاپو برای رسیدن به یک هدف است و رایج ترین تعریف جهاد با توجه به آیات قرآنی «جنگ در راه الله» است. جهاد ممکن است معنی غیر اسلامی و ضد اسلامی نیز داشته باشد یعنی ممکن است به تلاش مخالفان اسلام علیه اسلام نیز جهاد گفته شود (هرچند معمولاً کم پیش می آید که از جهاد برای رساندن این منظور استفاده شود)، لذا از نگر اسلامی جهاد لزوماً باری مثبت ندارد، گرچه معنی رایج آن اغلب بار مثبت دارد. مثلاً در آیه زیر از واژه جهاد بصورت منفی (از نظر اسلامی) استفاده شده است:

سوره لقمان آیه 15

وَ إِنْ جاهَداكَ عَلى أَنْ تُشْرِكَ بِي ما لَيْسَ لَكَ بِهِ عِلْمٌ فَلا تُطِعْهُما وَ صاحِبْهُما فِي الدُّنْيا مَعْرُوفاً وَ اتَّبِعْ سَبِيلَ مَنْ أَنابَ إِلَيَّ ثُمَّ إِلَيَّ مَرْجِعُكُمْ فَأُنَبِّئُكُمْ بِما كُنْتُمْ تَعْمَلُونَ.

و هرگاه آنها تلاش كنند (در این راه جهاد کنند) كه موجودي را شريك من قرار دهي كه از آن آگاهي نداري (بلكه مي‏داني باطل است) از آنها اطاعت مكن، ولي با آنها در دنيا به طرز شايسته‏اي رفتار كن، و پيروي از راه كساني بنما كه به سوي من آمده‏اند، سپس بازگشت همه شما به سوي من است و من شما را از آنچه عمل مي‏كرديد آگاه مي‏كنم.

واژه جهاد و مشتقات آن در حدود 32 بار در قرآن آمده است (1) و همانطور که گفته شد رایج ترین معنی آن جنگ در راه الله است. در قرآن از واژه های دیگری نیز برای جنگیدن استفاده شده است، مثلاً از واژه های «قتال و مقاتله، حرب و محاربه» نیز استفاده شده است که این واژه ها کاملاً خنثی هستند یعنی میتوان آنها را هم بر علیه اسلام و هم له اسلام استفاده کرد. بنابر این منظور از جهاد در این نوشتار همان تعریف مصطلح و رایج آن یعنی جنگ در راه الله و در دفاع از اسلام است.

آیا مسلمانان دعوت به جهاد میشوند؟

فراخوان قرآن از مسلمانان به جهاد کردن در بسیاری از آیات اين کتاب صورت گرفته است. بیهوده نیست اگر گفته شود اساساً هدف پیامبر اسلام از علم کردن اسلام جمع آوری آدمکش ها و تشکیل لشگر برای فتح و غارت اعراب بادیه نشین و بعد هم انجام همان کار در حق همسایگان شبهه جزیره عربستان بوده است. حجم سنگینی از قرآن را آیاتی تشکیل میدهد که مسلمانان را دعوت به حرب، قتال و جهاد میکنند، کمتر موضوعی است که قرآن اینقدر آیه به آن اختصاص داده باشد.

این حجم سنگین تبعاتی را نیز به همراه داشته است، شاید به این نکته توجه کرده باشید که بسیاری از تفریحات، هنر ها و سرگرمی ها در اسلام به شدت تحریم شده اند، مثلاً شرابخواری، شطرنج، موسیقی، رقص، نقاشی، مجسمه سازی و غیره. البته با پیشرفت علم، انسانگرایی و عقلانیت، فشاری بر مسلمانان وارد آمده است که در نتیجه آن بسیاری از این احکام منسوخ شده اند و باقی مانده آن احکام نابخردانه و الهی نیز قهراً به همین ترتیب بزودی منسوخ خواهند شد اما برای مسلمانان اولیه این کارها بگونه ای بسیار جدی حرام حساب میشده است و از یک مسلمان هرگز انتظار نمیرفت که چنین کارهایی کند. مثلاً در نوشتارهایی که از شیعیان علیه یزید بن معاویه نوشته اند، بسیار دیده میشود که «آن ملعون شطرنج بازی میکرد»!. دلیل این احکام احمقانه چیست؟ کدام آدم عاقلی ممکن است رقصیدن را نکوهش کند؟ پاسخ بسیار ساده و روشن است، پیامبر اسلام بدنبال تشکیل یک پادگان نظامی بوده است و معمولاً در هر پادگان نظامی این کارها جلف و مزاحم نظم گیری ارتش و پادگان بوده و هست. نقاش و موسیقی دان و رقاص را معمولاً در پادگان ها جایی نیست. از همین رو است که پیامبر اسلام هرچه بیشتر سعی در میلیتاریزه کردن جامعه اسلامی داشته است و این کار او بر روی قوانین اسلامی نیز تاثیر مستقیم و شگرفی داشته است. هنوز هم ائمه جمعه وقتی نماز میخوانند سلاح به دست میگیرند تا نشان دهند که اهل جنگیدن هستند، بر هر پدر مسلمانی واجب است که جنگیدن را به فرزندش بیاموزد. در احادیث آنقدر برای توصیه جهاد حدیث وجود دارد که واقعاً ذکر آنها دشوار است، اما بعنوان نمونه از احادیث معروف نبوی که میتوان تقریباً در هر مجموعه حدیثی یافت از این قرار است:

نهج الفصاحه شماره 576 و 1329

انًّ ابواب الجنه تحت ظلال السیوف

براستی که درهای بهشت زیر سایه شمشیر هاست.

نهج الفصاحه شماره 1619

ذروه سنام الاسلام الجهاد فی سبیل الله لا یناله الا افضلهم.

اوج مسلمانی جهاد در راه خدا است که جز مسلمانان برجسته بدان نرسند.

نهج الفصاحه شماره 2250

لقیام الرجل فی الصف فی سبیل الله عز و جل ساعه افضل من عباده ستین سنه.

یک ساعت ایستادن مرد بصف در راه خدا از شصت سال عبادت بهتر است.

نهج الفصاحه شماره 2564

ما من جرعه احب الی الله من جرعه غیظ کظمها رجل او جرعه صبر علی مصیبه و ما من قطره احب الی الله من قطره دمع اهرقت من خشیه الله و قطره دم اهریقت فی سبیل الله.

هیچ جرعه ای نزد خدا از جرعه خشمی که مردی فرو برد یا جرعه صبری که بر مصیبت نو شده محبوب تر نیست و هیچ قطره ای در نزد خدا از قطره اشگی که از ترس خدا ریخته شود یا قطره خونی که در راه خدا ریخته شود محبوبتر نیست.

اما در پاسخ به اینکه آیا در قرآن نیز مسلمانان دعوت به جهاد میشوند یا نه، ابتدائاً پرسش دومی را مطرح میکنیم، آیا مسلمانان وظیفه دارند روزه بگیرند؟ حتماً اگر خود شما نیز مسلمان بوده اید و یا هستید و یا با مسلمانان مراوده دارید خوب میدانید که روزه گرفتن در اسلام چه اهمیت و ارزشی دارد. به مسلمانان در آیه زیر دستور به گرفتن روزه داده شده است.

سوره بقره آیه 183

يا أَيُّهَا الَّذِينَ آمَنُوا كُتِبَ عَلَيْكُمُ الصِّيامُ كَما كُتِبَ عَلَى الَّذِينَ مِنْ قَبْلِكُمْ لَعَلَّكُمْ تَتَّقُونَ.

اي افرادي كه ايمان آورده‏ايد، روزه بر شما نوشته شد همان گونه كه بر كساني كه قبل از شما بودند نوشته شده، تا پرهيزكار شويد.

به ترکیب و لحن این آیه دقت کنید، عبارت «کتب علیکم ال….» (بر شما …. را واجب کردیم/نوشتیم) از محکمترین حکم های الهی است، یعنی هرگاه این عبارت به کار میبرد بنا به نظر مفسرین قرآن الله به مسلمانان بگونه ای بسیار قطعی و محکم دستور انجام آن عمل را میدهد و انجام آن عمل بر مسلمانان واجب است، از همین رو است که روزه نگرفتن در اسلام مکافات سختی دارد.  حال چند صفحه بعد تر در همان سوره به آیه زیر برخورد میکنیم:

سوره بقره آیه 216

كُتِبَ عَلَيْكُمُ الْقِتالُ وَ هُوَ كُرْهٌ لَكُمْ وَ عَسى أَنْ تَكْرَهُوا شَيْئاً وَ هُوَ خَيْرٌ لَكُمْ وَ عَسى أَنْ تُحِبُّوا شَيْئاً وَ هُوَ شَرٌّ لَكُمْ وَ اللَّهُ يَعْلَمُ وَ أَنْتُمْ لا تَعْلَمُونَ.

جهاد در راه خدا، بر شما مقرر شده، در حالي كه برايتان ناخوشايند است. چه بسا چيزي را خوش ‍ نداشته باشيد، حال آنكه خير شما در آن است. و يا چيزي را دوست داشته باشيد، حال آنكه شر شما در آن است. و خدا مي‏داند، و شما نمي‏دانيد.

حال باید برای شما روشن شده باشد که جنگیدن و قتال کردن در اسلام چقدر برای مسلمانان اهمیت دارد یا باید داشته باشد، دقیقاً به همان اندازه که نماز و روزه اهمیت دارند. در همان سوره و با همان لحن و با همان عبارتهایی که بر مسلمانان روزه گرفتن واجب شده، قتال کردن و شرکت در جهاد نیز واجب شده است، یعنی این دو به یک اندازه از نظر الله اهمیت دارند.

اما دعوت مسلمانان به جهاد به این آیه بسیار محکم محدود نمیشود، در بسیاری از آیات قرآن مسلمانان به جهاد دعوت میشوند. در قرآن مسلمانان به دو گونه برای جهاد تشویق میشوند، یکی پاداش اخروی است و دیگری غنیمت هایی است که از چپاول دشمن بدست می آورند، به این شیوه اصطلاحاً تبشیر (بشارت دادن، مژده دادن) گفته میشود،  در هردو این گونه ها مسلمانان برای سود مادی خود باید و پاداش الهی دست به جهاد بزنند. در زیر به چند نمونه از آیاتی که مسلمانان را به جهاد تشویق میکنند اشاره میکنیم.

چند مورد از آیاتی که وعده پاداش اخروی میدهند:

سوره نساء آیه 4

فَلْيُقاتِلْ فِي سَبِيلِ اللَّهِ الَّذِينَ يَشْرُونَ الْحَياةَ الدُّنْيا بِالآْخِرَةِ وَ مَنْ يُقاتِلْ فِي سَبِيلِ اللَّهِ فَيُقْتَلْ أَوْ يَغْلِبْ فَسَوْفَ نُؤْتِيهِ أَجْراً عَظِيماً.

آنها كه زندگي دنيا را به آخرت فروختهاند بايد در راه خدا پيكار كنند، و آن كس كه در راه خدا پيكار كند و كشته شود يا پيروز گردد پاداش ‍ بزرگي به او خواهيم داد.

سوره نساء آیات 95 و 96

لا يَسْتَوِي الْقاعِدُونَ مِنَ الْمُؤْمِنِينَ غَيْرُ أُولِي الضَّرَرِ وَ الْمُجاهِدُونَ فِي سَبِيلِ اللَّهِ بِأَمْوالِهِمْ وَ أَنْفُسِهِمْ فَضَّلَ اللَّهُ الْمُجاهِدِينَ بِأَمْوالِهِمْ وَ أَنْفُسِهِمْ عَلَى الْقاعِدِينَ دَرَجَةً وَ كُلاًّ وَعَدَ اللَّهُ الْحُسْنى وَ فَضَّلَ اللَّهُ الْمُجاهِدِينَ عَلَى الْقاعِدِينَ أَجْراً عَظِيماً؛دَرَجاتٍ مِنْهُ وَ مَغْفِرَةً وَ رَحْمَةً وَ كانَ اللَّهُ غَفُوراً رَحِيماً.

افراد با ايماني كه بدون بيماري و ناراحتي از جهاد باز نشستند يا مجاهداني كه در راه خدا با مال و جان خود جهاد كردند يكسان نيستند، خداوند مجاهداني را كه با مال و جان خود جهاد نمودند بر قاعدان برتري بخشيده و به هر يك از اين دو دسته (به نسبت اعمال نيكشان) خداوند وعده پاداش نيك داده و مجاهدان را بر قاعدان برتري و پاداش ‍ عظيمي بخشيده است؛ درجات (مهمي) از ناحيه خداوند و آمرزش و رحمت (نصيب آنان مي‏گردد) و (اگر لغزشهائي داشته‏اند) خداوند آمرزنده و مهربان است.

سوره صف آیات 10 تا 12

يا أَيُّهَا الَّذِينَ آمَنُوا هَلْ أَدُلُّكُمْ عَلى تِجارَةٍ تُنْجِيكُمْ مِنْ عَذابٍ أَلِيمٍ؛ تُؤْمِنُونَ بِاللَّهِ وَ رَسُولِهِ وَ تُجاهِدُونَ فِي سَبِيلِ اللَّهِ بِأَمْوالِكُمْ وَ أَنْفُسِكُمْ ذلِكُمْ خَيْرٌ لَكُمْ إِنْ كُنْتُمْ تَعْلَمُونَ؛ يَغْفِرْ لَكُمْ ذُنُوبَكُمْ وَ يُدْخِلْكُمْ جَنَّاتٍ تَجْرِي مِنْ تَحْتِهَا الأَْنْهارُ وَ مَساكِنَ طَيِّبَةً فِي جَنَّاتِ عَدْنٍ ذلِكَ الْفَوْزُ الْعَظِيمُ.

اي كساني كه ايمان آورده‏ايد آيا شما را به تجارتي كنم كه از عذاب از عذاب دردناك شما را رهائي مي‏بخشد؟!؛ به خدا و رسول او ايمان بياوريد، و در راه خداوند با اموال و جانهايتان جهاد كنيد، اين براي شما از هر چيز بهتر است بدانيد. ؛ اگر اين كار كنيد گناهانتان را مي‏بخشد و شما را در باغهائي از بهشت داخل مي‏كند كه نهرها از زير درختانش جاري است، و در مسكنهاي پاكيزه در بهشت جاويدان جاي مي‏دهد و اين پيروزي عظيمي است.

سوره توبه آیه 111

إِنَّ اللَّهَ اشْتَرى مِنَ الْمُؤْمِنِينَ أَنْفُسَهُمْ وَ أَمْوالَهُمْ بِأَنَّ لَهُمُ الْجَنَّةَ يُقاتِلُونَ فِي سَبِيلِ اللَّهِ فَيَقْتُلُونَ وَ يُقْتَلُونَ وَعْداً عَلَيْهِ حَقًّا فِي التَّوْراةِ وَ الإِْنْجِيلِ وَ الْقُرْآنِ وَ مَنْ أَوْفى بِعَهْدِهِ مِنَ اللَّهِ فَاسْتَبْشِرُوا بِبَيْعِكُمُ الَّذِي بايَعْتُمْ بِهِ وَ ذلِكَ هُوَ الْفَوْزُ الْعَظِيمُ.

خداوند از مؤ منان جانها و اموالشان را خريداري مي‏كند كه (در برابرش) بهشت براي آنان باشد (به اين گونه كه) در راه خدا پيكار مي‏كنند، مي‏كشند و كشته مي‏شوند، اين وعده حقي است بر او كه در تورات و انجيل و قرآن ذكر فرموده، و چه كسي از خدا به عهدش وفادارتر است، اكنون بشارت باد بر شما به داد و ستدي كه با خدا كرده‏ايد و اين پيروزي بزرگي (براي شما) است.

چند مورد از آیاتی که وعده پاداش دنیوی میدهند:

سوره الفتح آیه 20

وَعَدَكُمُ اللَّهُ مَغانِمَ كَثِيرَةً تَأْخُذُونَها فَعَجَّلَ لَكُمْ هذِهِ وَ كَفَّ أَيْدِيَ النَّاسِ عَنْكُمْ وَ لِتَكُونَ آيَةً لِلْمُؤْمِنِينَ وَ يَهْدِيَكُمْ صِراطاً مُسْتَقِيماً.

خداوند غنائم فراواني به شما وعده داده كه آنها را به چنگ مي‏آوريد، ولي اين يكي را زودتر براي شما فراهم ساخت، و دست تعدي مردم (دشمنان) را از شما باز داشت، تا نشانه‏اي براي مؤ منان باشد، و شما را به راه راست هدايت كند.

سوره نساء آیه 94

يا أَيُّهَا الَّذِينَ آمَنُوا إِذا ضَرَبْتُمْ فِي سَبِيلِ اللَّهِ فَتَبَيَّنُوا وَ لا تَقُولُوا لِمَنْ أَلْقى إِلَيْكُمُ السَّلامَ لَسْتَ مُؤْمِناً تَبْتَغُونَ عَرَضَ الْحَياةِ الدُّنْيا فَعِنْدَ اللَّهِ مَغانِمُ كَثِيرَةٌ كَذلِكَ كُنْتُمْ مِنْ قَبْلُ فَمَنَّ اللَّهُ عَلَيْكُمْ فَتَبَيَّنُوا إِنَّ اللَّهَ كانَ بِما تَعْمَلُونَ خَبِيراً.

اي كساني كه ايمان آورده‏ايد هنگامي كه در راه خدا گام بر مي‏داريد (و به سفري براي جهاد مي‏رويد) تحقيق كنيد و به كسي كه اظهار صلح و اسلام مي‏كند نگوئيد مسلمان نيستي بخاطر اينكه سرمايه ناپايدار دنيا (و غنائمي) بدست آوريد، زيرا غنيمتهاي بزرگي در نزد خدا (براي شما) است، شما قبلا چنين بوديد و خداوند بر شما منت گذارد (و هدايت نمود) بنا بر اين (بشكرانه اين نعمت بزرگ) تحقيق كنيد، خداوند به آنچه عمل مي‏كنيد آگاه است.

علاوه بر تبشیر در قرآن آیاتی نیز برای انذار وجود دارند، این آیات مسلمانان را از جهاد نکردن می ترسانند. برای نمونه میتوان به آیات زیر در قرآن اشاره کرد:

سوره توبه آیه 38

يا أَيُّهَا الَّذِينَ آمَنُوا ما لَكُمْ إِذا قِيلَ لَكُمُ انْفِرُوا فِي سَبِيلِ اللَّهِ اثَّاقَلْتُمْ إِلَى الأَْرْضِ أَ رَضِيتُمْ بِالْحَياةِ الدُّنْيا مِنَ الآْخِرَةِ فَما مَتاعُ الْحَياةِ الدُّنْيا فِي الآْخِرَةِ إِلاَّ قَلِيلٌ.

اي كساني كه ايمان آورده‏ايد چرا هنگامي كه به شما گفته مي‏شود به سوي جهاد در راه خدا حركت كنيد سنگيني بر زمين مي‏كنيد (و سستي به خرج مي‏دهيد) آيا به زندگي دنيا به جاي آخرت راضي شده‏ايد! با اينكه متاع زندگي دنيا در برابر آخرت چيز كمي بيش نيست!

در حاشیه این مسائل باید توجه داشت که مسئله جهاد برای اعراب از اهمیت و جاذبه بسیار بالایی برخوردار بوده است و بسیاری از افراد تنها برای اینکه بتوانند در جهاد شرکت کنند و سهمی از غنائم بدست بیاورند به اسلام میپیوستند. پروفسور مونت گومری وات (Montgomerry Watt) از بزرگترین اسلام شناسان معاصر معتقد است «حمله به کاروان ها و قبایل دیگر را میتوان به گونه ای ورزش رسمی کشور عربستان در آن دوران دانست» (2) و این ورزش پیش از اسلام هم همان غزوه نام داشته است.  پیامبر اسلام گفته است:

نهج الفصاحه، 483

الزموا الجهاد تصحوا و تسغنوا.

جهاد کنید تا سالم باشید و بی نیاز شوید.

البته بی نیاز شدن ترجمه دقیق تسغنوا نیست، تسغنوا از غنی شدن و ثروتمند شدن می آید، منظور پیامبر اسلام از این سخن بسیار روشن است، جهاد کاری برای کسب درآمد بوده است. جذابیت جهاد در اسلام به قدری بود که عده ای خلافکار و دزد حرفه ای مانند خالد ابن ولید، کار و کسب (!) خود را رها کردند و به اسلام پیوستند تا بتوانند سود بیشتری بدست بیاورند. پیوستن این ارازل و دزد ها به اسلام بعد از مرگ خود پیامبر برای مسلمانان دردسر ساز شد، زیرا این ارازل و دزدان بر سر غنیمت ها و قدرت با یکدیگر به جنگ ها پرداختند، علی شریعتی در مورد این مسئله نوشته است:

جبهه گیری حضرت امیر در اعراض از دنیا و مبارزه با تجمل، اشرافیت، پول پرستی، کنز و… که ابوذر آن همه بر آن تکیه میکند، مربوط به زمان عثمان است، یعنی زمانی که اصحاب تبدیل شده اند به یک طبقه جدید-همان چیزی که ما امروز خیلی خوب میفهمیم-طبقه جدیدی که از پولهای بارآورده و باد  آورده که به نام جهاد و زکات و فیء و انفال و… زیر دست و پای دولت و دولتی ها ریخته و از پست های گردن کلفتی که بر اصحاب عرضه شده، برخوردار شده است: کسی که در مدینه خیمه ای داشته، اکنون حاکم ری، حاکم طوس، حاکم قاهره و فسطاط شده است، و معلوم است که در همان کاخ ها و دم و دستگاه ها زندگی میکند و همان آشپزی که برای فلان کنسیل رومی در فسطاط غذا درست میکرده، اکنون مثلاً برای عمر و عاص کار میکند؛ عمر و عاصی که در مدینه، در زمان پیغمبر، اش جو میخورده، امروز در سفره کنسیل رومی غذا میخورد. در ایران هم همینطور، در سفره های ساسانی غذا میخوردند. چنین گرایشی است که فریادهای علی را تنها گذاشته و دعوت های حسین را نیز بی پاسخ گذاشته، برای اینکه مسلمان ها روی «بخور» و «بزن» و «بچاپ» چهاراسبه می تاختند، آن هم تحت نام و توجیه دینی:

«جهاد کردیم، غنیمت به دست آوردیم و خداوند به ما برکت داد». (3)

البته شریعتی آنقدر وجدان نداشته است که بنویسد علی و محمد خود از چه وضع فلاکتباری به تشکیل حرمسرا و کسب ثروتهای فراوان از همین راه جهاد دست یافتند اما سایر نوشته های او بسیار درست هستند، اسلام یک عده بیابانگرد حق الهی داد تا به دزدی و چپاول و کشتار نامسلنانان بپردازند، همانطور که هم اکنون نیز به یک عده وحشی و فرومایه (اسلامگرایان) حق الهی حکومت بر سایر مردمان را داده است. و علی شریعتی بی وجدان اینرا «به بهانه جهاد» میداند نه «با استفاده از جهاد»، تو گویی خود محمد و علی و فرزندانشان هرگاه فرصت می یافتند چنین نمیکردند. در مورد فرومایگی و دزد بودن مسلمانان اولیه یکی از نویسندگان دیگر مسلمان نوشته است:

«جمع کثیری از خوارج نهروان از افراد بادیه نشین و نو مسلمانانی بودند که از اسلام و حقائق آن بهره ای نداشته و تنها به ظواهر آن ایمان آورده و به زبان، اسلام را پذیرا شده بودند. بی آنکه از حقائق اسلام خبری داشته باشند! بلکه میتوان گفت که اکثر آنان از نو مسلمانان بی منطق شکل گرفته، و از بدویان اطراف کوفه و بصره بودند، که در فرصتهای مناسب و در جنگها شرکت میکردند، و بعد از فتح و پیروزی، غنائمی بدست می آوردند! و به این جهت هم خو گرفته و عادت کرده بودند! ولی آنان در جمل و صفیه ، چیزی به عنوان غنائم جنگی عائدشان نشد. نتوانستند غنائمی به دست بیاورند. یکی از اعتراضات مهم آنان به امام علیه سلام این بود که چرا امام نگذاشت بعد از جنگ جمل و صفیه اموال آنها را به غنیمت بگیرند! و آنها علناً به امام اعتراض میکردند که چگونه میشود که کشتن جملی ها و صفینی ها حلال باشد، اما غنیمت گرفتنشان حرام!» (4)

این نویسنده مسلمان تقریباً همه چیز را درست نوشته است غیر از اینکه «حقائق» اسلامی همین هست که اکثر مسلمانان (نه تنها جمع کثری از خوارج که همگی بسیار دین دار بودند و برخی از آنها از کسانی بودند که محمد را نیز در جهادهایش همراهی کرده بودند) قبل از اسلام به شغل شریف دزدی و کاروانزنی مشغول بودند و بعد از اینکه گانگستری همچون محمد اینکار را الهی کرد و آنرا به انحصار خود در آورد با آغوش باز اسلام را پذیرفتند تا بتوانند از این اتحادیه تبهکاری سود ببرند، البته آنها تقریباً کور خوانده بودند چون با دزدی دزد تر و حرفه ای تر از خود یعنی محمد روبرو شده بودند که سر کیسه غنائم و اموال و زنان مسروقه و تصرف شده را به ندرت برای آنها شل میکرد و از دزدی های آنها نیز می دزدید. نتیجه گرد هم آیی این تبهکاران این شد که مانند هر اجتماع متشکل از یک مشت تبهکار قدرت پرست و مافیایی دیگری، مسلمانان اولیه نیز بعدها به جان یکدیگر افتادند و پس از مرگ محمد علی و معاویه و عایشه و طلحه و زبیر بر سر همین که رئیس گروه تبهکاران باید چه کسی باشد و چه کسی باید غنیمت بیشتری به دست بیاورد با یکدیگر جنگیدند، چه خونها از یکدیگر ریختند و چه توحش های اسلامی به خرج دادند، علی در نهایت باعث شد چند هزار نفر از خوارج را بر سر همین اختلاف یاد شده و البته سایر اختلافات از دم تیغ گذرانده شوند، و این تبهکاری را مدعیان اسلام تا امروز نیز ادامه داده اند و کل ماجرای این حزب تبهکار فاشیست (اسلام) چیزی جز این نیست که آنها همواره بدنبال جهاد، کسب غنائم و چپاول و مصادره اموال غیر مسلمانان و مخالفین خود و از آن مهمتر کسب قدرت سیاسی بوده اند و خدای بدبخت ناپیدا و ناموجود که به دلیل وجود نداشتن نمیتواند خودش اعلام کند که مسلمانان او را نمایندگی نمیکنند و او اهل چپاول کردن نیست را نیز همواره ابزار خود برای نیل به این هدف پلید قرار داده اند.

البته درگیری تبهکاران تنها در زمان پس از مرگ محمد برای مسلمانان حادثه نیافرید، در زمان خود محمد نیز افرادی سر غنیمت ها با او به دعوا و مجادله پرداختند.  واقعیت این است که محمد بسیار فرد دجال و مکاری بوده است، او به مسلمانان و دزدان مسلمان شده وعده غنیمت گرفتن میداد و وقتی که زمان عهد به قولش میرسید به اصطلاح امروزی دبّه در می آورد و غنیمت ها را بالا میکشید. شاید برای شما تکان دهنده باشد که پس از آن همه وعده به غنیمت گیری در آیات دیگری از قرآن هم اینچنین آمده باشد:

سوره توبه آیات 58 و 59:

وَ مِنْهُمْ مَنْ يَلْمِزُكَ فِي الصَّدَقاتِ فَإِنْ أُعْطُوا مِنْها رَضُوا وَ إِنْ لَمْ يُعْطَوْا مِنْها إِذا هُمْ يَسْخَطُونَ؛ وَ لَوْ أَنَّهُمْ رَضُوا ما آتاهُمُ اللَّهُ وَ رَسُولُهُ وَ قالُوا حَسْبُنَا اللَّهُ سَيُؤْتِينَا اللَّهُ مِنْ فَضْلِهِ وَ رَسُولُهُ إِنَّا إِلَى اللَّهِ راغِبُونَ.

و در ميان آنها كساني هستند كه در (تقسيم) غنائم به تو ايراد مي‏كنند، اگر از آن به آنها بدهند راضي مي‏شوند و اگر ندهند خشم مي‏گيرند (خواه حق آنها باشد يا نه)؛ ولي اگر آنها به آنچه خدا و پيامبرش به آنها مي‏دهد راضي باشند و بگويند خداوند براي ما كافي است و به زودي خدا و رسولش از فضل خود به ما مي‏بخشد ما تنها رضاي او را مي‏طلبيم (اگر چنين كنند به سود آنهاست).

سوره انفال (غنیمت های جنگی) آیه 1:

يَسْئَلُونَكَ عَنِ الأَْنْفالِ قُلِ الأَْنْفالُ لِلَّهِ وَ الرَّسُولِ فَاتَّقُوا اللَّهَ وَ أَصْلِحُوا ذاتَ بَيْنِكُمْ وَ أَطِيعُوا اللَّهَ وَ رَسُولَهُ إِنْ كُنْتُمْ مُؤْمِنِينَ.

از تو درباره انفال (غنائم و هر گونه مال بدون مالك مشخص) سؤ ال مي‏كنند بگو: انفال مخصوص خدا و پيامبر است، پس از (مخالفت فرمان) خدا بپرهيزيد و ميان برادراني را كه با هم ستيزه دارند آشتي دهيد و اطاعت خدا و پيامبرش را كنيد اگر ايمان داريد.

البته این آیات را محمد بعد از جنگ می سرود و هنگام پخش غنائم آنها را به اصطلاح نازل میکرد و آیاتی که وعده غنیمت میدهند مربوط به زمان قبل از جنگ میشوند. محمد همیشه یک پنجم سهم از غنائم را برای خود بر میداشت و گاهی باقی آنرا نیز بطور مساوی تقسیم نمیکرد بلکه به اشخاص مورد نظرش بیشتر از غنائم میداد و این کار او باعث درگیری هایی نیز شده بود، مثلاً:

«هنگامی که رسول خدا غنائم جنگی حدیبیه را، میان سپاه اسلام تقسیم مینمود، بنا به مصالحی به بعضی از آنان مقداری بیشتر از سهم معمولی شان از غنائم دادند، که ناگاه حرقوص بن زهیر تمیمی که بعداً از سران خوارج شد و بلکه ریشه و اساس آنان را تشکیل میداد، به شدت در مقابل رسول الله ایستاد و با لحن بسیار زننده و خشن فریاد زد «اعدل یا محمد» (ای محمد عدالت را رعایت کن!)

این جمله را چندین مرتبه تکرار کرد تا آنکه رسول خدا با ناراحتی تمام به او گفت: «وای بر تو! اگر من عدالت را رعایت نکنم پس چه کسی رعایت میکند؟» (5)

آنگونه که در تاریخ اسلام آمده است، محمد از این نامردی ها و بی عدالتی ها زیاد انجام داده است، مثلاً در واقعه خیبر به دلیل اینکه اهل خیبر در مقابل محمد تسلیم میشوند، او تمام غنائم را به بهانه اینکه جنگی در نگرفته است بالا میکشد و به مسلمانان چیزی نمیدهد. در همان ماجرای حدیبیه آنگونه که ابن هشام نوشته است گویا محمد تحت فشار بوده است زیرا غنائم را برای خریدن آدم ها و رشوه به روسای قبایل صرف کرده بود و از این رو بعد از یک سخن رانی احساسی به مسلمانان میگوید، آیا شما مرا و آخرت خود را میخواهید یا غنائم را؟! اعراب بدبخت هم که واقعا فکر میکردند او مردی آسمانی است و با خدا چایی و شیر کاکائو میخورد از روی ترس دیگر اعتراضی به او نمیکنند. محمد البته وقتی که قدرتش و موقعیتش را داشته است با این معترضان که همیشه بعد از هر جنگی وجود داشتند (چون محمد معمولاً در پخش غنائم همواره غائل به تبعیض میشده است) خیلی بد تر از این برخورد میکرده است، مثلاً مردی به نام عتبه که یکبار به دلیل اینکه محمد غنائم را بطور مساوی پخش نکرده بود به صورت او تف کرده بود، توسط علی و به دستور محمد همانجا سر بریده شد. (6)

غنیمت گرفتن آنقدر برای مسلمانان ارزش داشت که در برخی از جنگهایشان مانند جنگ خیبر و حمله به بنی مصطلق بطور ناگهانی و سرزده به دشمن حمله کردند که دشمن حتی حق تسلیم شدن و پذیرفتن اسلام را هم نداشته باشد، زیرا در آن صورت دیگر غنیمتی به دست مسلمانان نمی افتاد، اسناد و مدارک مربوط به این ماجرا را در نوشتاری با فرنام «جویریه» بیابید.

لازم به ذکر است در کنار گاو و گوسفند ها و شتر ها و سایر اموال منقول و غیر منقول که غنیمت به شمار میرفتند، در فقه اسلامی زنان و فرزندان کفار نیز جزو غنیمت ها به شمار میروند و مسلمانان این زنان و کفار را به بردگی میکشاندند، و بر اساس آموزه های قرآنی همبستر شدن با کنیز (برده زن) آزاد است و این نیز خود دلیلی برای جلوه داشتن جهاد برای اعراب بیابانگرد بوده است. البته از حق که نگذریم ترکان بعد ها دست اعراب را از پشت بستند و در غارت و چپاولگری اسلامی از اعراب نیز پیشی گرفتند و حتی به خود آنان نیز تجاوزات متعدد کردند، لذا این خوی و بربریت مسئله ای نژادی نیست، حتی امروز هم برای عده زیادی جهاد میتواند جذابیت داشته باشد، فکرش را بکنید مسلمانی که شپش از رویش می بارد به یک کافر حمله میکند، ثروت او را بدست می آورد، زن او را کنیز خود میکند، فرزندان او را برده خود میکند و از آنها کار مادام العمر رایگان میکشد و بعد از مرگش نیز به دلیل این کارهایش به مقاربت و نزدیکی با اهل بیت و خدا و مزخرفات دیگر میپردازد.

آیا جهاد تنها امری دفاعی است؟

برای جهاد (جنگ در راه خدا) در فرض دستکم دو حالت را میتوان در نظر گرفت، یکی جهاد تهاجمی و دیگری جهاد پدافندی (دفاعی). در اینکه جهاد دفاعی در اسلام وجود دارد شک و اختلافی وجود ندارد. حق طبیعی و بدیهی هر ملت و قومی است که از خود دفاع کند و در مقابل مهاجمین بایستد و از کیان و هستی خود پدافند کند. اما در مورد اینکه آیا جهاد تهاجمی نیز در اسلام وجود دارد یا نه بین مسلمانان اختلاف است. معمولاً این اختلاف نظر بین علمای اسلام و مسلمانان سکولار دیده میشود، یعنی علمای اسلام معتقدند در اسلام جهاد تهاجمی وجود دارد و مسلمانان سکولار که نمیخواهند اسلام را کنار بگذارند و در عین حال نمیخواهند به باورهای زشت و غیر انسانی آن باور داشته باشند این را رد میکنند. برخی از فقها (7) جهاد پدافندی را جهادی که برای جنگ با کفار در سرزمین های اسلامی صورت میگیرد و و جهاد ابتدایی و تهاجمی را جهادی که در سرزمین کفار صورت میگیرد تعریف کرده اند، اما روشن است که تعریف دقیقتر جهاد دفاعی آن است که طرف متخاصم کفار باشند و آنها باشند که جنگ را آغاز کرده باشند و مسلمانان در آن جنگ از خود دفاع کنند و جهاد تهاجمی، یا ابتدائی آن است که مسلمانان آغازگر جنگ باشند و به کفار یورش ببرند تا به نشر اسلام بپردازند.

پرسشی که مطرح است این است که آیا اگر جهاد تنها دفاعی میبود، لازم بود که اینقدر در قرآن مسلمانان تشویق به جهاد بشوند؟ آیا مسلمانان خودشان شعورشان نمیرسد که باید از خودشان دفاع کنند؟ روشن است که انسان نیاز به اینکه کسی به او بگوید تو باید از خودت دفاع کنی ندارد. حتی حیوانات نیز چنین چیزی را تعلیم نمی بینند، اگر موجود زنده ای در معرض تهدید قرار بگیرد بطور طبیعی و فطری از خود دفاع میکند و این امری بیولوژیکی و کاملا طبیعی است، و حتی مسلمانان نیز احتمالاً این را میفهمند که لازم نیست برای اینکه کسی را وادار کنند تا از خود دفاع  کند به او جایزه و پاداش بدهند و او را تهدید کنند، مگر مردمانی بر روی زمین هستند که در هنگام مورد هجوم و تجاوز قرار گرفتن از خود دفاع نکنند؟ آیا ایرانیان که در مقابل اعراب قرنها ایستادگی کردند قرآن داشتند و یا کسی به آنها وعده بهشت داده بود؟ آیا ویتنامی ها و روس های کمونیست از خود دفاع نمیکردند؟ بنابر از آنجا که دفاع از خود امری فطری است، وقتی در قرآن اینقدر روی جهاد تاکید شده است و از روش های مختلف برای واداشتن مسلمانان به جهاد استفاده شده است، این خود نشان میدهد که دستکم گوشه ای از این جهاد ها، تهاجمی بوده است نه تدافعی. تشویق یک شخص به دفاع از خود به دلیل فطری بودن شبیه آن است که کسی را تهدید به این کرد که اگر نفس نکشی تو را بیچاره خواهیم کرد و یا اگر نفس بکشی به تو حوری و غلمان خواهیم داد، و این دو کاملاً مسخره هستند.

افزون بر این زبانشناسان معتقدند معنی هر جمله همان  است که مخاطب آن جمله، در آن زمانیکه جمله را گفته یا نوشته است، از آن جمله فهمیده است، نه هیچ چیز دیگر! بویژه اگر سخنران خدا بوده باشد. زیرا جمله در هنگام ساخته شدن برای مخاطب زمان خودش ساخته شده است و اگر قرار بوده است آن مخاطب جمله را به غلط دریابد، ایراد از سازنده جمله است و خدا به دلیل کمالش نمیتواند ایراد هم داشته باشد. اگر قرار باشد جمله سازی به گونه ای جمله بسازد که مخاطبانش آنرا درک نکنند، کار بسیار بیهوده ای انجام داده است. و از آنجا که قرآن به نظر مسلمانان برخاسته از وحی الهی است و خداوند کار بیهوده انجام نمیدهد، هم روش فقهی و هم روش تاریخی برای بررسی اسلام این است که معانی آیات را از عکس العملی که پیامبر و سایر اعراب و مسلمانان اولیه به این آیات نشان دادند دریابیم.

در جدول رخدادنگاری (8) زیر میتوانید تاثیر آیات جنایی قرآن و عکس العمل مسلمانان نسبت به آنها را ببینید. از سال 623 تا 777 میلادی در طول 154 سال مسلمانان در بیش از 80 جنگ شرک کرده اند. یعنی بطور متوسط چیزی حدود یک جنگ در هر دو سال.

  • 570 – تولد محمد در عربستان، در قبیله عربستان
  • 577 – مادر محمد فوت می‌شود
  • 580 – عبدلمطلب پدربزرگ محمد فوت می‌شود
  • 583 – اولین مسافرت محمد به سوریه با اهداف تجارتی
  • 595 – محمد با خدیجه ازدواج می‌کند
  • 595 – مسافرت دوم به سوریه
  • 598 – پسرش، قاسم بدنیا می آید
  • 600 – دخترش زینب بدنیا می آید
  • 603 – دخترش ام کلثوم بدنیا می آید
  • 604 – دخترش رقیه بدنیا می آید
  • 605 – حجر الاسود در کنار کعبه قرار میگیرد
  • 605 – دخترش فاطمه بندیا می آید
  • 610 – محمد در غار حرا جبرئیل را ملاقات می‌کند
  • 613 – محمد ادعای پیامبری اش را بطور عمومی اعلام می‌کند
  • 615 – مسلمانان توسط قریش مورد آزار قرار میگیرند
  • 619 – با سوده و عایشه ازدواج می‌کند
  • 620 – نمازهای پنجگانه اجباری میشوند
  • 622 – محمد از مکه به مدینه مهاجرت می‌کند
  • 623 – جنگ ودان
  • 623 – جنگ صفوان
  • 623 – جنگ ذوالعشير
  • 624 – محمد و اطرافیانش آغاز به حملات پی در پی به کاروانهای تجارتی برای غارت ثروت آنها می‌کنند
  • 624 – زکات اجباری می‌شود
  • 624 – جنگ بدر
  • 624 – جنگ بنی سلیم
  • 624 – جنگ بنی قینقاع
  • 624 – جنگ سویق
  • 624 – جنگ بنی قطفان
  • 624 – جنگ بحران
  • 625 – جنگ احد
  • 625 – جنگ حمراء الاسد
  • 625 – جنگ بنی النضیر
  • 625 – جنگ ذات الرقاع
  • 626 – جنگ بدر الاخره
  • 626 – جنگ دومه الجندل
  • 626 – جنگ بنی المصطلق
  • 627 – جنگ خندق
  • 627 – جنگ بنی قریظه
  • 627 – جنگ بنی لحیان
  • 627 – جنگ غیبه
  • 627 – جنگ خیبر
  • 628 – محمد معاهده ای را با قریش امضا می‌کند
  • 630 – محمد مکه را فتح می‌کند
  • 630 – جنگ حنین.
  • 630 – جنگ تبوک
  • 632 – محمد میمیرد.
  • 632 – ابوبکر، پدرزن محمد، و عمر حرکتی نظامی را آغاز می‌کنند تا اسلام را در عربستان تحمیل کنند
  • 633 – جنگ در عمان
  • 633 – جنگ حضرموت.
  • 633 – جنگ کازیما
  • 633 – جنگ ولاجه
  • 633 – جنگ اولیس
  • 633 – جنگ عنبر
  • 634 – جنگ بصره,
  • 634 – جنگ دمشق
  • 634 – جنگ اجنادین.
  • 634 – مرگ ابوبکر و به خلافت رسیدن عمر
  • 634 – جنگ نمارق
  • 634 – جنگ سقطیه.
  • 635 – جنگ جسر.
  • 635 – جنگ بویب.
  • 635 – فتح دمشق.
  • 635 – جنگ فحل.
  • 636 – جنگ یرموک.
  • 636 – جنگ قادسیه.
  • 636 – فتح مدائن.
  • 637 – جنگ جلولاء.
  • 638 – جنگ یرموک.
  • 638 – مسلمانان رومی ها را شکست می‌دهند و وارد جارالسلام میشوند
  • 638 – فتح جزیره.
  • 639 – فتح خوزستان و حرکت به سوی مصر.
  • 641 – جنگ نهاوند
  • 642 – جنگ ری در ایران
  • 643 – فتح آذربایجان
  • 644 – فتح فارس
  • 644 – فتح خاران.
  • 644 – عمر کشته می‌شود، عثمان خلیفه می‌شود
  • 647 – فتح جزایر قبرس
  • 644 – عمر کشته می‌شود و عثمان جانشین او می‌شود.
  • 648 – حمله به بیزانسی ها
  • 651 – جنگ دریایی علیه بیزانسی ها
  • 654 – اسلام در شمال افریقا پخش می‌شود
  • 656 – عثمان کشته می‌شود، علی خلیفه میگردد
  • 658 – جنگ نهران.
  • 659 – فتح مصر
  • 661 – علی کشته می‌شود.
  • 662 – مصر به دست اسلامگرایان می افتد.
  • 666 – مسلمانان به سیسیل ایتالیا حمله می‌کنند
  • 677 – محاصره قسطنطنیه
  • 687 – جنگ کوفه
  • 691 – جنگ دیر الجلیغ
  • 700 – حملات نظامی به شمال افریقا انجام میگیرد
  • 702 – جنگ دیر الجمیرا
  • 711 – مسلمانان به جبل الطارق حمله می‌کنند
  • 711 – فتح اسپانیا
  • 713 – فتح ملتان (منطقه ای در پاکستان)
  • 716 – حمله به قسطنطنیه
  • 732 – جنگ در فرانسه.
  • 740 – جنگ نوبلز.
  • 741 – جنگ بگدورا در شمال افریقا
  • 744 – جنگ عین الجر
  • 746 – جنگ روپار ثوثا
  • 748 – جنگ ری.
  • 749 – جنگ اصفهان
  • 749 – جنگ نهاوند
  • 750 – جنگ زب
  • 772 – جنگ حنبی در شمال افریقا
  • 777 – جنگ ساراگوسا در اسپانیا

حال از روی این اصل زبانشناسی پاسخ مربوط اين پرسش را ميتوان بسادگي دريافت که آیا اسلامگرایان در مورد دفاعی بودن این آیات دروغ میگویند و از انسانیت خجالت میکشند که چنین دروغی میگویند و اسلامشان را سانسور میکنند یا نه؟  بهانه حمله مسلمانان صدر اسلام به کشورهای متعدد بیگانه که در زمان عمر با تایید و حتی شرکت امامان شیعه شروع شد چه چیز غیر از گسترش اسلام و همین آیات جنایی قرآن بوده است؟ آیا چنین دینی میتواند دین صلح آمیز و انسانگرایی باشد؟ هرگز!

آشکار است که حمله مسلمانان به کشورهای متعددی که در جغرافیای امروز جهانی هرکدام کشورهای مستقلی هستند به هیچ عنوان نمیتوانسته است حالتی دفاعی داشته باشد. اما ممکن است اسلامگرایان ادعا کنند که جنگهای پیغمبر تماماً دفاعی بوده اند. بررسی اجمالی این دروغ بزرگ و انکار تاریخ مسلم اسلام را میتوانید در نوشتاری با فرنام «جنگهای پیغمر- بخش دوم مناظره آیت الله منتظری با دکتر علی سینا.» مطالعه کنید. همچنین مطالعه نوشتارهای مربوط به قبایل یهودی و آنچه پیامبر اسلام بر سر یهودیان مدینه آورد را در بخش قتل عام یهودیان مدینه برای برطرف شدن کامل این شبهه توصیه میکنم. مسئله ای که باید به آن بسیار توجه کرد این است که ممکن است برخی از آیات جهادی قرآن صرفاً مربوط به جهاد دفاعی باشند و محمد در مقابل حمله مشرکین این آیات را آورده باشد، اما حقیقت این است که حتی این جنگها نیز به این دلیل آغاز شده اند که محمد ابتدا به آنها تجاوزی کرده است، بعنوان مثال دلیل اینکه جنگ بدر آغاز شد حملات محمد به کاروانهای تجارتی مکه بود، روشن است که با در نظر گرفتن این واقعیت حتی جنگهایی که مشرکین آنها را آغاز کردند مثل بدر و خندق را نیز نمیتوان براستی جنگهای دفاعی از جانب مسلمانان نامید. فرض کنید در شهر کرج گروهی به مسافران تهران حمله کنند و آنها را برده کنند یا اموالشان را به یغما ببرند، حال اگر اهل تهران بخاطر این ماجرا به کرج حمله کنند، مهاجم چه کسی است و مدافع چه کسی است؟ روشن است که مهاجم در اصل اهل کرج بوده اند و بانی اصلی درگیری بین مسلمانان اولیه و کفار اولیه نیز در واقع مسلمانان و شخص پیامبر اسلام بوده است.

بعد از این استدلالها و دلایل برای نشان دادن اینکه جهاد در اسلام تهاجمی نیز بوده است شایسته است اندکی در مورد کسانی که منکر این واقعیت هستند توضیح داده شود. معمولاً کسانی که منکر تهاجمی بودن جهاد میشوند را میتوان در سه دسته تقسیم کرد. دسته نخست را کسانی تشکیل میدهند که اساساً اطلاعات علمی و عینی نسبت به اسلام و قرآن و تاریخ آن ندارند و افراد عامی هستند که هرچه خود درست می پندارند را به اسلام نسبت میدهند و هرچه اسلام زشتی دارد را از اسلام جدا میدانند. متاسفانه یا خوشبختانه اکثر مسلمانان را این دسته از افراد تشکیل میدهند که معمولاً آنها را میتوان با نام مسلمان سکولار و عرفی شناخت. دسته دوم افرادی هستند که با اسلام آشنایی دارند و معتقدند جهاد تنها پدافندی است و مسلمانان حق انجام جهاد تهاجمی را ندارند این افراد معمولا بسیار نادر هستند. دسته سوم را نیز مسلمانان دانا به اسلام تشکیل میدهند، این دسته از افراد به اینکه در اسلام جهاد تهاجمی به رسمیت شناخته شده است باور دارند اما معتقدند جهاد تهاجمی نیز به دلیل اینکه در دفاع از اسلام انجام میگیرد، جهادی دفاعی است.

به نخستین گروه از این افراد که نمیتوان پاسخی جز این داد، که این دسته از افراد بهتر است بروند و اسلام را مطالعه کنند و تصورات خود از اسلام را کنار بگذارد و بدون پیشفرض و پیش رنگ به قرآن نگاه کنند تا رنگ اصلی قرآن و اسلام را ببینند و آنگاه اگر آن رنگ را پسندیدند به خود گیرند و اگر نه آنرا همچون ما کنار بگذارند.

دسته دوم نیز به گونه ای خود را به نادانی میزنند، یا اینکه واقعاً با این قسمت از اسلام آشنا نیستند و یا اینکه انسان زده هستند. انسان زدگی به این معنی است که این افراد با انسانگرایی برخورد داشته اند و به آن دل بسته اند اما بطور کامل به آن گرایش پیدا نکرده اند و هنوز نادانی اسلامی در میان آنها وجود دارد. مسلمانان راستین به این دسته افراد به خطا غربزده هم میگویند. از پاسخهای شایسته ای که به این دسته از مسلمانان داده شده است، یک مورد را که توسط یکی از آدمخوار ترین آیت الله های فعلی، یعنی آیت الله مصباح یزدی بیان شده است در اینجا می آوریم تا برخی از مسائل روشن شوند:

«آیاتی که در اینجا آوردیم (منظور برخی از آیات جنایی قرآن است) و برخی آیات دیگر نظیر آنها، برای بعضی منشا این توهم شده که جنگ در اسلام منحصر در جهاد دفاعی است و چیزی به نام جهاد ابتدایی در اسلام وجود ندارد.

در این زمینه باید بگوییم که گرچه قراینی وجود دارد که نشان میدهد آیات مذکور به جهاد دفاعی نظر دارند و ما نیز برخی از این قراین را ذکر کردیم، اما جواز جهاد ابتدایی در اسلام از ضروریات فقه اسلامی است و در اصل تشریع آن هیچ تردیدی وجود ندارد. فقهای شیعه و سنی در این امر اتفاق نظر دارند و در اصل جواز جهاد ابتدایی اختلافی بین آنان نبوده و نیست. حقیقت این است که آن چه بیشتر انگیزه شده تا امروزه برخی افراد در جواز جهاد ابتدایی در اسلام تشکیک روا دارند، ف خود باختگی در برابر فرهنگ غرب است. این حرف و مطالب دیگری نظیر آن – که همگی در نفی و تضعیف احکام و ارزشهای اسلامی اشتراک دارند – از سوی کسانی مطرح میشود که مرعوب فرهنگ غربی گشته اند و میپندارند هرچه غربیان میگویند وحی منزل است و ما برای آن که از قافله تمدن و فرهنگ عقب نمانیم، باید هرچه غربیان میگویند با آنان هم نوایی کنیم!

امروزه فرهنگ غرب که داعیه عقلانی و عقلایی بودن دارد، برخی حقوق و ارزشها را بصورت مطلق مطرح میکند.و برای مثال از دیدگاه این فرهنگ، حق آزادی، حق حیات، حق احترام و کرامت انسان مطلق اند؛ بدین معنا که «هیچگاه» و از جانب «هیچ کس» نباید نقض شوند. بدیهی است که اگر این دیدگاه را بپذیریم، در مورد «حق حیات» باید متلزم شویم که این حق مطلق است و در هیچ شرایطی و به هیچ مجوز و مستندی نمیتوان حیات هیچ انسانی را از او سلب کرد. اگر میبینیم که امروزه در برخی کشورها مجازات اعدام به کلی لغو و ممنوع گردیده، در واقع تحت تاثیر پذیرش همین فرهنگ و دیدگاه است. البته این سخنان در بسیاری از موارد تنها در قالب لفظ و شعار باقی می ماند و دولت های غربی عملاً به خصوص در ارتباط با سایر کشورها- آن ها را زیر پا میگذارند.

در هر حال، طبیعی است ک در چنین نظام ارزشی و فرهنگی، جهاد ابتدایی توجیهی نخواهد داشت، چرا که با حق «حیات مطلق» انسان منافات دارد و سبب میشود بی جهت حیات انسانهایی به مخاطره بیافتد. در این نظام ارزشی حداکثر میتوان جهاد دفاعی را موجه دانست و پذیرفت. بر همین اساس هم هست که امروزه همه زورمداران و ستم پیشگان، هر بیدادی را که بر انسان ها روا میدارند و جنگ ها و لشکر کشی هایی را که به ناحق بر ملل ضعیف تحمیل میکنند، در تبلیغات وسیع و دروغین خود سعی میکنند با استناد به عناوینی مثل «دفاع» از آزادی و حقوق آنرا توجیه کنند.

از این رو، بر اساس فرهنگ و نظام ارزشی غرب، بسیاری از احکام و قوانین و مقررات فردی و اجتماعی اسلام، و از جمله جهاد ابتدایی، توجیهی ندارند و در صورت پذیرش این فرهنگ ما باید اینگونه احکام و مقررات اسلام را کنار بگذاریم.

اما هم چنان که در برخی مباحث، و از آن جمله در نقد و بررسی اعلامیه جهانی حقوق بشر، گفته ایم، حقیقت این است که هیچ یک از ارزشهای نام برده مطلق نیستند؛ بلکه همه آنها محکوم و مقید به ارزش دیگری هستند و آن ارزش است که از دیدگاه اسلام مطلق و فراتر از همه ارزشهای حقوقی و اخلاقی دیگر ارزیابی میشود. این ارزش عبارت است از «کمال نهایی روحی و معنوی انسان» که تنها نیز با «تقرب به خدای متعال» و کسب موقعیت و منزلت ویژه در پیشگاه او حاصل میشود.

در نظام ارزشی و اعتقادی اسلام نه تنها هیچ ارزش دیگری نمیتواند در عرض این ین ارزش و برتر از آن باشد، بلکه ارزش هر چیز ارزشمند دیگری نیز به طور کامل بستگی دارد به مقدار تاثیری که در راه رسیدن به این ارزش برتر و مقصود اصلی والاتر میتواند داشته باشد. به عبارت دیگر این ارزش مطلق نه تنها هم تراز و هم سان با سیار ارزشها نیست و بر همه آنها برتری دارد، بلکه اصولا ارزش آفرین است و اساس همه ارزشهای دیگر نیز محسوب میشود و هم او است که به هریک از کارهایی که ما انجام میدهیم ارزش مثبت یا منفی خاص میبخشد.

بنابر این همه اعمال و رفتار و دیگر ارزشها تا آنجا ارج و مطلوبیت دارند که وسیله نیل انسان به کمال حقیقی او باشند و در دست یابی انسان به آن ارزش مطلق، وی را مساعدت کنند.

کسانی که اسلام را نشناخته اند یا در برابر فرهنگ غرب برخوردی انفعالی دارند، آگاهانه یا نا آگاهانه ، این بزرگ ترین ارزش را که یگانه ارزش اصیل و مطلق مکتب اسلام نیز می باشد، به دست فراموشی سپرده اند. از همینجا است که بسیاری از احکام و مقررات اسلامی که تنها بر اساس همین ارزش مطلق توجیه می گردد، از جانب این افراد انکار یا تحریف میشود. از جمله چیزهایی که تحت تاثیر همین عامل (غلفت از ارزشهای نام برده) مورد تشکیک قرار گرفته، مساله جهاد ابتدائی است و کسانی جهاد مشروع اسلام را در دفاع و قصاص منحصر دانسته و جهاد ابتدائی را انکار کرده اند. اینان تلاش دارند که همه آیات جهاد را بر جهاد دفاعی یا جنگ قصاصی تطبیق نمایند و نیز همه جنگ های زمان پیامبر اسلام را از نو جنگهای دفاعی معرفی کنند.

این همه معلول آن است که این افراد خواسته اند احکام و مقررات اسلامی را، حتی الامکان، با ارزشهای حاکم بر فرهنگ غرب هم سان و هماهنگ سازند، و هر حکمی را که نتوانسته اند با فرهنگ غرب هماهنگ کنند مورد انکار و تردید قرار داده اند.

اما همانگونه که اشاره کردیم، واقعیت این است که مشروع بودن جهاد ابتدایی از ضروریات فقه-اعم از فقه شیعیان و اهل سنت است. تردید در این که آیا در قرآن کریم آیه ای دال بر جواز یا وجوب جهاد ابتدایی وجود دارد یا نه، یا تردید در اینکه در زمان حیات رسول اکرم جهاد ابتدایی رخ داده است یا خیر، هیچ یک به اصل مشروعیت جهاد ابتدایی که از مسلمات فقه است ضربه ای وارد نمی آورد.

حتی اگر ثابت شود که در همه طول تاریخ اسلام، چه درعهد پیامبر و چه پس از آن حضرت، تاکنون هیچ گاه جنگی با ویژگیها و علایم جهاد ابتدایی رخ نداده است، با این حال باز هم در جواز آن تشکیک و خللی راه نمی یابد. سر انجام روزی فرا خواهد رسید که در آن روز به فرمان ولی عصر عجل الله تعالی فرجه الشریف جهاد ابتدایی صورت میگیرد؛ تا سراسر جهان فرمان بر حق و عدالت و حکومت واحد و جهانی آن حضرت گردند.

همچنین اختلافات فقهی که در فروع و مسایل جنبی جهاد ابتدایی وجود دارد-مثل اختلاف فقها در مشروط بودن جهاد ابتدایی به حضور امام معصوم و امثال آن-هرگز نمیتواند مستمسک انکار اصل این حکم قرار گیرد.

به هر حال، با این تلاش های مذبوحانه و بی ثمر نمیتوان جهاد ابتدایی را که اصل جواز آن از ضروریات و مسلمات فقه اسلامی است، امری نامشروع و خلاف اسلام قلمداد کرد. کسانی که به این تلاش ها دست میزنند، به جای انکار این حکم مسلم فقهی، بهتر است خود را از سلطه فرهنگ و نظام ارزشی غرب برهانند و احکام اسلام را در چارچوب نظام ارزشی خود اسلام مورد تحلیل و ارزیابی قرار دهند.

در اینجا با کمال صراحت و بدون نگرانی از تعارض و مخالفت با فرهنگ غرب، باید بگوییم، تنها ارزش اصیل و مطلق انسان، وصول او به «کمال نهایی» خود خواهد بود که چیزی جز «تقرب به درگاه الهی» و یافتن مقام و منزلت در پیشگاه خدای متعال نیست. بنابر این هرچیزی که راه این کمال جویی و منزلت خواهی و تقرب به خداوند را ببندد و در پیش پای رهروان راه حق چاهی شود که در آن سقوط کنند، و یا سنگی که با برخورد به آن سرنگون گردند، و به هر حال سدی در برابر تحقق کمالات و اهداف والای انسانی باشد باید آن را از میان برداشت.

هدف از بعثت پیامبران الهی نیز چیزی جز این نبوده است که انسان را به سوی خدای متعال دعوت کنند و راه تقرب به درگاه الهی و منزلت یابی نزد آفریدگار را به وی بیاموزند. پیامبران آمده اند تا به انسان ارائه طریق کنند و موانع را از پیش پای او بردارند تا بتواند به حرکت فطری خود در مسیر حق و حقیقت سرعت و شتاب بخشد و به کمال نهایی خود دست یابد و در جوار رحمت واسعه الهی قرار گیرد.

آری، هدف از فرستادن پیامبران تنها برقراری نظم و آرامش در جامعه و برخورداری مردم از رفاه و آسایش در زندگی مادی و دنیوی خود نیست؛ بلکه آنان فرستاده شده اند تا نظام ارزشی الهی را در جوامع بشری اقامه و احیا کنند و انسان ها را در مسیر دست یابی به اهداف معنوی و عالی انسانی راهنمایی و دست گیری کنند.

در قرآن مجید سه بار به صراحت درباره پیامبر بزرگوار اسلام حضرت محمد مصطفی چنین آمده است.

سوره توبه آیه 9، سوره فتح آیه 28، سوره صف آیه 9:

هُوَ الَّذِي أَرْسَلَ رَسُولَهُ بِالْهُدى وَ دِينِ الْحَقِّ لِيُظْهِرَهُ عَلَى الدِّينِ كُلِّهِ وَ لَوْ كَرِهَ الْمُشْرِكُونَ.

او كسي است كه رسولش را با هدايت و آئين حق فرستاد تا او را بر همه آئينها غالب گرداند هر چند مشركان كراهت داشته باشند.

این آیه به صراحت اعلام می دارد که غرض از بعثت و ارسال پیامبر گرامی اسلام این بوده است که دین او، اسلام، جهانگیر شود. آن حضرت از طرف خداوند جهان آفرین مامور بود که همه مردم جهان را به اسلام دعوت کند تا اگر جهان گیر شدن این دین در زمان حیات خود وی تحقق نیافت، دست کم، مقدمات جهان گیر شدنش برای آینده فراهم گردد و حقا که آن حضرت این ماموریت سنگین را به بهترین شکل ممکن انجام داد.

پیامبر اسلام از همان آغاز رسالت خود، در مسیر جهانی شدن و گسترش اسلام گام برمیداشت. آن حضرت در زمانی که هنوز از زمان تشکیل نخستین جامعه اسلامی در مدینه چند صباحی بیش نگذشته بود و قدرت مادی و ظاهری این جامعه نوپا و نوظهور به هیچ وجه با قدرت سایر حکومت ها و دولت های موجود در آن عصر، و از جمله دو ابر قدرت ایران و روم، قابل مقایسه نبود؛ آری در چنین شرایطی، نامه هایی برای امپراطور روم، پادشاهان: ایران، حبشه، اسکندریه، بحرین و پادشاهان کوچک و بزرگ دیگر نوشتند و آنان را به اسلام دعوت کردند.

این نامه ها همگی لحنی صریح و قاطع داشتند و در آن ها از مخاطبان خواسته شده بود که دعوت پیامبر را لبیک گویند و اسلام آورده و تسلیم حکم خدا گردند. ارسال این نامه ها سبب شد که بسیاری از افراد در اقصی نقاط جهان آن روز از ظهور اسلام مطلع شوند و در صدد تحقیق درباره آن برآیند. حتی در مواردی، برخی از افراد که طالب حقیقت بودند و اسیر هواهای نفسانی و اغراض شیطانی نبودند اسلام را پذیرفتند. در هر حال پیامبر اسلام تا آنجا که برایش میسر بود، مقدمات حرکتی مستمر و رو به رشد و کمال را در بستر تاریخ و مسیر زندگی بشر فراهم آورد. البته از همان زمان نیز اکثر قریب به اتفاق قدرت مندان و زورمداران، چون دریافتند که این آیین نوین، زندگی و منافع و ثروت و قدرت آنان را تهدید میکند، بر آن شدند تا به هر قیمت از رشد و گسترش، قوت و قدرت، و دوام و بقای آن جلوگیری کنند. این در حالی بود که بسیاری از آنان یقین داشتند که حضرت محمد همان پیامبری است که انبیای سلف، ظهورش را بشارت داده اند و دینش همان دینی است که باید تکمیل کننده و به فرجام رساننده همه ادیان گذشته باشد. خداوند در این باره در قرآن کریم میفرماید:

سوره بقره آیه 146 (آیه 20 سوره انعام)

الَّذِينَ آتَيْناهُمُ الْكِتابَ يَعْرِفُونَهُ كَما يَعْرِفُونَ أَبْناءَهُمْ وَ إِنَّ فَرِيقاً مِنْهُمْ لَيَكْتُمُونَ الْحَقَّ وَ هُمْ يَعْلَمُونَ.

كساني كه كتب آسماني به آنان داده‏ايم او (پيامبر) را همچون فرزندان خود مي‏شناسند (اگر چه) جمعي از آنان حق را آگاهانه كتمان مي‏كنند.

آری، برخی از دشمنان پیامبر اسلام با وجود آن که پی به حقانیت او برده بودند و میدانستند که او واقعاً پیامبر خدا است، با تمام قوا و با استمداد از همه نیروهای خود، تلاش کردند مانع گسترش و پیش روی اسلام در عرصه جهانی و قدرت و قوت آن شوند و راه تعالی را بر آن ببندند. هدف آنان از این تلاش ها این بود که بتوانند چند روزی بر عمر حکومت خود بیافزایند و چند صباحی بیشتر از لذت، قدرت و ثروت دنیا بهره مند گردند. امروزه در عصر ما نیز همه آن مسایل و وقایع در حال تکرار است.  (9)

توضیحات مصباح یزدی برای رد ادعای گروه دوم کافی به نظر میرسد، دسته سوم نیز در اصل مرتکب سفسطه ابهام «Equivocation Fallacy» میشوند، یعنی فراموش میکنند، یا خود را به فراموشی میزنند که منظور از تهاجمی بودن جهاد این است که مسلمانان به خود اجازه بدهند به نامسلمانان بدون اینکه آنان ابتدا تجاوزی به مسلمانان کرده باشند تجاوز کنند. حال بهانه این تجاوز هر چه میخواهد باشد، این دسته از افراد سعی میکنند نشان دهند که تهاجم به دیگران در دفاع از اسلام، تهاجم نیست، و این بازی با کلمات و خود را به کوچه علی چپ زدن است. روشن است که «در دفاع از اسلام جنگیدن» یک جنگ را «دفاعی» نمیکند، اگر اینگونه باشد تمامی جنگها را میتوان دفاعی دانست، مثلاً حمله صدام حسین به ایران را میتوان به دلیل اینکه «در دفاع از نظریات صدام حسین» بوده است جنگی «دفاعی» نامید و همچنین جنگهای هیتلر را به دلیل «در دفاع از باورهای نازیستی» جنگهای «دفاعی» نامید اما روشن است که این سخن جز سفسطه و عوامفریبی هیچ نیست.

در چه زمانی مسلمانان باید دست به جهاد ابتدائی بزنند؟

گروهی از فقهای اسلامی توحید را از حقوق اولیه انسانها میدانند و معتقدند که پیش از حقوق انسانها حقوق الهی مطرح است و حق الله هم این است که انسانها به شیوه ای که او میخواهد زندگی کنند، یعنی مطیع شریعت اسلام باشند. به عبارت دیگر تحمیل «سلطنت اسلام» به نامسلمانان و بخاطر توحید با کفار جنگیدن از نظر این افراد امری مشروع است. لازم به توضیح است که این عقیده تا به امروز در میان علمای اسلام رایج بوده است و به آن عمل نیز میشده است، اما خوشبختانه امروزه به دلیل رشد انسانگرایی و لیبرالیسم علمای اسلام مجبور به تقیه کردن هستند و از بیان این باورهای زشت اسلامی به شدت پرهیز میکنند، اما بازهم پیدا میشوند دایناسورهایی که از وحشی بودن خود شرم ندارند و باورهای اسلامی واقعی را هنوز هم بیان میکنند، بعنوان نمونه آیت الله مصباح یزدی نوشته است:

هم چنان که پیش از این و در مباحث مختلف اشاره کرده ایم، تنها حق اصیل و ذاتی در عالم، حق خدای متعال است و سایر حقوق در پرتو این حق است که معنا می یابند و توجیه میشوند. خداوند مالک حقیقی همه موجودات، و از جمله انسان، است و تمامی مخلوقات همه هستی خود را وام دار خدای متعال هستند. این رابطه مالکیت بین خداوند از یک سو و سایر موجودات از سوی دیگر، ایجاب میکند که خداوند حق داشته باشد که تمامی هستی طبق خواست و اراده او به چرخش و گردش در آید و رفتار کند.

در مورد جامعه انسانی نیز اقتضای این حق این است که در سرتاسر جوامع بشری تنها خدا پرستش شود، دین او حاکم و سخنش برتر باشد: و کلمه الله هی العلیا (سوره توبه آیه 40)، کلمه خدا است که برتر است.

حال اگر انسان هایی از پذیرش و رعایت این حق الهی سر باز زدند، علاوه بر عذاب و عقاب اخروی خداوند میتواند در همین دنیا نیز آن ها را عقوبت کند. این عقوبت میتواند به صورت عذاب و بلایی طبیعی باشد که از آسمان یا زمین بر آن افراد نازل میشود، و میتواند به این صورت باشد که خداوند از مومنان و صالحان بخواهد که بر آنان یورش برند و جلوی تباه کاری و فسان آنان را در زمین بگیرند و به آن خاتمه دهند، که این همان جهاد ابتدایی است:

سوره توبه آیه 14

قاتِلُوهُمْ يُعَذِّبْهُمُ اللَّهُ بِأَيْدِيكُمْ وَ يُخْزِهِمْ وَ يَنْصُرْكُمْ عَلَيْهِمْ وَ يَشْفِ صُدُورَ قَوْمٍ مُؤْمِنِينَ.

با آنها پيكار كنيد كه خداوند آنان را به دست شما مجازات مي‏كند و آنها را رسوا مي‏سازد و سينه گروهي از مؤ منان را شفا مي‏بخشد (و بر قلب آنها مرهم مي‏نهد).

جهاد ابتدایی جز این نیست که به منظور احقاق حقی که خدای متعال بر کل بشریت دارد، گروهی از بندگان شایسته خدای متعال ماموریت یابند بر کسانی که این حق را پایمال کرده و راه شرک و کفر و ظلم و فساد در پیش گرفته اند یورش برند و تا زمانی که دین حق و اراده خدا حاکم شود نبرد را ادامه دهند.(10)

آیت الله مطهری نیز در همین زمینه میگوید:

با اين بياني كه عرض كردم اين دو بيان بهم نزديك ميشود چون ما حتي اگر توحيد را از حقوق انساني بدانيم باز نميتوانيم با ملت ديگر بجنگيم براي تحميل عقيده توحيد ، چون خودش في حد ذاته تحميل پذير نيست بله يك چيز ديگر هست و آن اين است

اگر ما توحيد را جزء حقوق انسانها دانستيم ممكن است اگر مصلحت انسانيت ايجاب بكند و اگر مصلحت توحيد ايجاب بكند ما با قومي مشرك ميتوانيم بجنگيم نه بخاطر اين كه توحيد را بانها تحميل بكنيم و ايمان را بانها تحميل بكنيم چون توحيد و ايمان تحميل شدني نيست.

با مشركين ميتوانيم بجنگيم بخاطر اينكه ريشه فساد را اساسا بكنيم ريشه كن كردن مبدأ عقيده شرك با زور يك مطلب است و تحميل عقيده توحيد مطلب ديگر . بنابر نظر كسانيكه توحيد را جزء حقوق شخصي و حداكثر حقوق ملي ميدانند ميگويند اين كار جايز نيست ،

اغلب طرز تفكر اروپائيها كه در ميان ما هم سرايت كرده همين است. اروپائيان به اينجور مسائل بعنوان يك سلسله مسائل شخصي و مسائل غيرجدي در زندگي نگاه ميكنند مثل تقريبا رسوم كه هر ملتي حق دارد هر رسمي براي خودش ميخواهد انتخاب بكند پس و لو بعنوان قطع ريشه فساد – حق نداريم با شرك مبارزه كنيم .

زيرا شرك فساد نيست ، توحيد يك مسئله شخصي است . ولي اگر توحيد را يك مسئله عمومي و جزء حقوق انساني و از شرايط سعادت عموم بشر دانستيم جنگ ابتدائي با مشرك بعنوان حريم توحيد و دفاع از توحيد و بعنوان قطع ريشه فساد جايز است ، گو اينكه بعنوان تحميل عقيده توحيدي جايز نيست. (11)

به همین دلیل است که کشورهای اسلامی نباید آنقدر از لحاظ نظامی قوی شوند که بتوانند کشورهای غیر اسلامی را تهدید کنند، زیرا بر اساس نظرات اسلامی، مسلمانها حق دارند دیگران را در جهاد بکشند تا سلطنت اسلام را گسترش دهند. و اگر زمانی قرار باشند چنین اتفاقی بیافتد شکی وجود ندارد که مسلمانان وحشی تمام آثار مدنیت و انسانیت را از بین خواهند برد و بشر را به قرنها پیش پرتاب خواهند کرد و بعد هم به قتل و غارت یکدیگر خواهند پرداخت، و همین مسئله است که غرب و غربی ها خوب آنرا درک کنند و بفهمند که اسلام بزرگترین دشمنشان است.

در نگاهی کوتاه به آنچه مطهری گفته است باید گفت، اروپایی ها درست فکر میکنند، ادیان یک مشت مزخرفات و خرافات محلی و مضر بیش نیستند و اسلام به دلیل اینکه به خود اجازه میدهد «ریشه شرک را خشک کند» حتی از باقی ادیان نیز مزخرفتر و مضر تر است. البته این دیدگاه انسانگرایانه و واقع بینانه است و شرقی و غربی ندارد، هرکس احمق نباشد و یا خود را به حماقت نزند خوب میفهمد که اسلام دکانی برای تجاوز به دیگران است، حال این انسان ممکن است در غرب زندگی کند یا شرق.

گذشته از نمونه های آورده شده از اندیشمندان فاشیست تر مسلمان، باقی مسلمانان نیز معتقدند در صورتی باید جهاد ابتدایی را آغاز کرد که حق تبلیغ کردن برای اسلام در آن سرزمین به مسلمانان داده نشود. در این صورت مسلمانان حق دارند که دست به جهاد ابتدائی بزنند، در توضیح این حالت نیز آیت الله مطهری گفته است:

جنگ براي آزادي دعوت و رفع مانع از تبليغ

آيا جنگيدن براي آزادي دعوت جايز است و يا جايز نيست ؟ جنگيدن براي آزادي دعوت يعني چه ؟ يعني ما ميگوئيم كه ما بايد آزاد باشيم كه عقيده و فكر خاصي را در ميان هر ملتي تبليغ كنيم ، تبليغ نه بمعناي امروزي كه پروپا كاند كردن است بلكه باين معني كه بيان كنيم . چه بعنوان اينكه ما آزاديرا يك حق عمومي و انساني بدانيم

و چه بعنوان اينكه توحيد را يك حق عمومي انساني بدانيم و يا بعنوان اينكه هر دو را يك حق عمومي انساني بدانيم اين امر جايز است . حالا اگر مانعي براي دعوت ما پيدا شود ، ببينيم يك قدرتي آمده مانع ميشود و ميگويد من بشما اجازه نمي دهم

، شما ميرويد افكار اين مردمرا خراب ميكنيد ، ميدانيد كه غالب حكومتها فكر خراب را آن فكري ميدانند كه اگر پيدا بشود مردم مطيع اين حكومتها ديگر نيستند ، آيا با حكومت ها كه مانع نشر دعوت در ميان ملتها هستند جايز است

جنگيدن تا حديكه اينها سقوط بكنند و مانع نشر دعوت از ميان برود يا نه ؟ بله اين هم جايز است اين هم باز جنبه دفاع دارد اينهم جزء آن جهادهائيست كه ماهيت آن جهادها در واقع دفاع است . (12)

پراونه ي تبلیغ و گسترش را نداشتن با يک گويش ديگر برابر است با تعطیل شدن کار و کاسبی آخوندها، که چون چراي اين ممنوعيت را در خود نهفته دارد. توضیح روشن تر این است که اگر کار و کاسبی آخوندها، شبهه آخوندها و سایر مبلغین اسلام در کشوری تعطیل شود و غیر قانونی باشد، خدا از این قضیه شاکی میشود و به مسلمانان اجازه جهاد میدهد. البته کاملاً روشن است این نیز بهانه ای بیش نیست، تاریخ نشان میدهد که در زمان حمله اسلام به ایران، مسیحیت در ایران در حال رشد بوده است و مسیحیان از آزادی دینی برخوردار بوده اند، یقیناً اگر مسلمانان نیز توحش را کنار میگذاشتند و میخواستند همچون مسیحیان با بحث و استدلال و تبلیغ سالم اسلام را به ایرانیان عرضه کنند، ایرانیان مشکلی برای آنها بوجود نمی آوردند، اما محمد خود قبلاً این روش را آزموده بود، او 13 سال با همین روش های مصالمت آمیز مردم را دعوت کرده بود و حداکثر شصت نفر یاوه  های او را پذیرفته بودند، اما وقتی او شمشیر به دست میگیرد مردم به قول قرآن فوج فوج به دین اسلام وارد میشدند، این است که این سخن نیز چیزی نیست جز بهانه ای برای چپاول ملت های نامسلمان که صبورانه و بزرگوارانه وجود مسلمانان وحشی را تحمل کرده اند و میکنند. اما چیزی که مشخص است این است که اسلام نیامده است تا دیگران را تحمل کند و در کنار آنها زندگی کند اسلام میخواهد بر دیگران تسلط بیابد و دیگر ادیان را نابود کند، قرآن به صراحت این را اعلام میکند:

سوره توبه آیه 33، قتح آیه 28 و صف آیه 9

هُوَ الَّذِي أَرْسَلَ رَسُولَهُ بِالْهُدى وَ دِينِ الْحَقِّ لِيُظْهِرَهُ عَلَى الدِّينِ كُلِّهِ وَ لَوْ كَرِهَ الْمُشْرِكُونَ.

او كسي است كه رسولش را با هدايت و آئين حق فرستاد تا او را بر همه آئينها غالب گرداند هر چند مشركان كراهت داشته باشند.

بنابر این آیه که مو به مو در دو سه جای قرآن تکرار شده است و این خود نشان بر اهمیت این آیه دارد، محمد میخواسته است این مسئله را صراحتاً و کاملاً روشن کند که او برای همزیستی اسلامش را آغاز نکرده است بلکه او میخواهد بر دیگران غلبه کند، لذا قوانین اسلام و طرز تفکر اسلامی ناب همواره باید در فکر غلبه بر مشرکین باشند، مشرکین هم یعنی همه کسانی که الله را قبول ندارند، چیزی یا کسی را با او در خدایی شریک میدانند و یا چیزهای دیگری را میپرستند مثلاً مسیحیان به دلیل اینکه میگویند خدا سه گانه است مشرک هستند و قرآن به صراحت تمام دستور جنگ با مشرکین را صادر کرده است:

سوره توبه آیات 28 و 29

يَا أَيُّهَا الَّذِينَ آمَنُواْ إِنَّمَا الْمُشْرِكُونَ نَجَسٌ فَلاَ يَقْرَبُواْ الْمَسْجِدَ الْحَرَامَ بَعْدَ عَامِهِمْ هَـذَا وَإِنْ خِفْتُمْ عَيْلَةً فَسَوْفَ يُغْنِيكُمُ اللّهُ مِن فَضْلِهِ إِن شَاء إِنَّ اللّهَ عَلِيمٌ حَكِيمٌ. قَاتِلُواْ الَّذِينَ لاَ يُؤْمِنُونَ بِاللّهِ وَلاَ بِالْيَوْمِ الآخِرِ وَلاَ يُحَرِّمُونَ مَا حَرَّمَ اللّهُ وَرَسُولُهُ وَلاَ يَدِينُونَ دِينَ الْحَقِّ مِنَ الَّذِينَ أُوتُواْ الْكِتَابَ حَتَّى يُعْطُواْ الْجِزْيَةَ عَن يَدٍ وَهُمْ صَاغِرُونَ.

ای کسانی که ایمان آورده اید، مشرکان نجسند و از سال بعد نباید به مسجد الحرام نزدیک شوند، و اگر از بینوایی میترسید، خدا اگر بخواهد به فضل خوش بی نیازتان خواهد کرد. زیرا خدا دانا و حکیم است.کسانی را از اهل کتاب که به خدا و روز قیامت ایمان نمی آورند و چیزهایی را که خدا و پیامبرش حرام کرده است بر خود حرام نمی‌کنند و دین حق را نمیپذیرند بکشید، تا آنگاه که به دست خود در عین مذلت جزیه بدهند.

این آیات برای کافران 3 راه میگذارد که باید یکی از آنها را انتخاب کنند:

1- مسلمان شوند، در مسلمان شدن آنها اجباری نیست اما اگر مسلمان نشدند باید حتما یکی از دو روش زیر را انتخاب کنند!

2- جزیه بدهند،

امام ابوجعفر گفته است «جزیه عطیه مجاهدین است»  (ترجمه فارسی من لایحضره الفقیه پوشینه 2 برگ 357) یعنی جزیه همچون باجی است که به مجاهدین اسلام (مجاهد کسی است که جهاد میکند) اعطا میشود و سایرین از جزیه سهمی ندارند.

ابن خلدون و بسیاری از تاریخ نویسان اعتقاد دارند کسانی که به ایران حمله کردند اصلا قصد گسترش اسلام را نداشتند و چندان علاقه ای نداشتند که ایرانیان مسلمان شوند، آنها ترجیه میدادند ایرانیان مسلمان نباشند تا جزیه بدهند و ایرانیان نیز سر انجام به دلایل اقتصادی پس از 200 سال برای نپرداختن جزیه مسلمان شدند. در آیه ای که نقل شد آمده است که نامسلمانان باید در عین مذلت جزیه بدهند، یعنی این پول جزیه نه برای انجام خدمتی بلکه برای نشان دادن اینکه مسلمانان بر نامسلمانان سلطنت و برتری دارند از آنها گرفته میشده است و مسلمانان در اجتماع برابر با نامسلمانان نیستند بلکه از نظر قرآن نامسلمانان باید در ذلت به سر ببرند و مسلمانان در سلطه. قرآن میزان مشخصی از جزیه را بر کافران مشخص نکرده است و بر اساس فقه شیعی میزان جزیه به نظر امام ارتباط دارد یعنی در هر زمان هر مقداری که مسلمانان اراده کنند میتوانند از کفار بگیرند. (ترجمه فارسی من لایحضره الفقیه پوشینه 2 برگ 353). همچنین «اگر مردها از پرداختن جزیه امتناع کنند، پیمان شکنند، و خونشان و قتلشان حلال است. زیرا کشتن مردها در دارالشرک والذمه مباح است»  (ترجمه فارسی من لایحضره الفقیه پوشینه 2 برگ 356).

مودودی میگوید:

یهودیان و مسیحیان را باید مجبور کرد که جزیه بدهند، تا اینکه استقلالی از خود نداشته باشند و برتری نداشته باشند، تا حاکم و سلطان بر زمین نباشند. این قدرتها باید توسط پیروان واقعی ایمان از آنها گرفته شود و قدرت به صراط مستقیم سپرده شود.  (13)

عمر به مسلمانان توصیه میکرده است که اسرای رومی را به عربستان نیاورند تا مسلمانان از جزیه آنها بخورند و فرزندان مسلمانان نیز از جزیه فرزندان رومی بخورند:

سوگند به خدا که در آن صورت، ایشان کسی را برای سخن گفتن نخواهند یافت و کسی با آنان سخن نخواهد گفت و نیز از دست آورده هیچ کس، سودی نخواهند برد. ولی تا اینان زنده اند، مسلمانان از دسترنجشان خواهند خورد و آنگاه که بمیرند و ما نیز بمیریم، فرزندانمان تا زنده اند، از دست آورده فرزندان ایشان خواهند خورد، و تا آیین اسلام تواناست، آنا ن بردگان مسلمانان و اسلام خواهند بود. از این رو، بر ایشان سر گزیت بنه و از اسیر ساختن آنان دست بدار و مگذار که مسلمانان بر ایشان ستم کنند، یا زیانی رسانند و داراییشان را به ناحق بخورند. (14)

در فقه شیعی جزیه تنها در صورتی از اهل کتاب پذیرفته میشود که آنها گوشت خوک نخورند و ربا نیز نخورند، در غیر اینصورت ذمه ای بر ایشان نیست و ایشان دیگر این امکان را نیز ندارند و باید تنها یکی از دو امکان دیگر را انتخاب کنند (ترجمه فارسی من لایحضره الفقیه پوشینه 2 برگ 353). جزیه را حتی برخی از خود مسلمانان نیز باج گیری خوانده اند، یعنی نامسلمانان باید به مسلمانان باج بدهند تا مسلمانان آنها را نکشند، درست مانند دزد سر گردنه ای که باید به او پولی داد تا جان را از آدمی نگیرد. برای اطلاعات بیشتر در مورد جزیه میتوانید به دو نوشتار خراج و جزیه و اسلام و جزیه در تارنمای درفش کاویانی مراجعه کنید.

3- با مسلمانان جنگ کنند، یا به عبارت دیگر، کشته شوند.

و این اصول رفتار مسلمانان با نا مسلمانان تا همین امروز هم ادامه دارد، شایان ذکر است کسانی ادعا می‌کنند که پیامبر اسلام در مدینه نیز با بسیاری از یهودیان و مسیحیان گفتمان میکرده است و با آنان همزیستی میکرده است، باید بدانند که آن کفار جزیه پرداخته بودند و الا کسی که جزیه نپردازد و مسلمان نیز نشود حق حیات ندارد، هرچند پیامبر اسلام سرانجام تا جایی که توانست عربستان را از وجود غیر مسلمانان با نسل کشی و اجبار خالی کرد. دلیل حمله اعراب به ایران نیز همین بود، مسلمانان اگر شیعه باشند که باید بدانند این حملات زیر نظر امامانشان بويژه امام علی (در مورد دشمنی امام علی با ایرانیان نوشته ای با فرنام علی ابن ابیطالب و دشمنی با ایرانیان را بخوانید) بوده است و امام علی مشاور اصلی عمر در این جنگها بوده است و در زمان خلافت خود نیز بارها برای سرکوب شورشهای مردمی در ایران به شهر های مختلف ایران از جمله ری، خراسان، آذربايجان، سیستان و… فرستاد (شرح مختصری از آنها را در نوشتاری با فرنام کارنامه درخشان حضرت علی امام اول شیعیان بخوانید)، اگر سنی باشند نیز خواهند دانست که خلیفه اول عمر بن خطاب دستور حمله به ایران را دقیقا از روی همین استراتژی صادر کرد و گفتن اینکه حمله به ایران یک جنگ دفاعی بود کاملا مضحک است. این واقعیت را میتوان از بیان اعراب مسلمان صدر اسلام دریافت، در جنگ قادسیه مغیره فرستاده سپاه اسلام به رستم از سرداران سپاه ایران قبل از جنگ با یکدیگر گفتمانی می‌کنند، شرح این گفتمان از این قرار است:

«رستم پیامی نزد سعد فرستاد که کسی را نزد من بفرست تا با او سخن گویم. مغیره بن شعبه را فرستادند. مغیره بیامد و موی جداکرده و گیسوان چهارپاره فروهشته بود. رستم با وی گفت شما عربان در سختی و رنج بودید و نزد ما به سوداگری و مزدوری می آمدید چون نان و نعمت ما بخوردید برفتید و یاران و کسان خود را نیز بیاوردید. مثل شما و ما داستان آن مرد است که پاری ای باغ داشت روزی روباهی در آن دید گفت یک روباه را چه قدر باشد؟ و باغ مرا از آن چه زیان افتد؟ او را از آنجا نراند. پس از آن روباه برفت و روبهان جمع کرد و به باغ آورد، باغبان فراز آمد و چون کار بدان گونه دید، در باغ فراز کرد و رخنه ها بر بست و آن روباهان را تمام بکشت. گمان دارم که آنچه شما را بدین سرکشی واداشته است، سختی و رنج است، بازگردید شما را نان و امه دهیم. اکنون به دیار خود بروید و بیش موجب آزار ما نشوید. مغیره جواب سخت داد و گفت از سختی و بدبختی آنچه گفتی ما بدتر از آن بودیم تا پیغامبری در میان ما آمد و حال ما دیگر شد، ما را فرمان داد که شما را به دین حق بخوانیم یا با شما پیکار کنیم. اگر بپذیرید، بلاد شما هم شما راست جز با دستوری شما اندر آن نیاییم وگرنه باید جزیه دهید یا پیکار کنید تا فرجام کار چه شود؟ رستم را برآشفت و گفت هرگز گمان نکردمی که چنان بزیم که چنین سخنی بشنوم.» (15)

تاریخ گواه است که چنین بلایی را پیامبر اسلام در زمان حیات خود بر سر نامسلمانان آورد و پس از مرگ او نیز جانشینان او دست به چنین «فتوحاتی» زدند. در ضمن فقها انتقاد از اسلام را در بسیاری از موارد مصداقی بارزی از «حرب با خدا» میدانند و ممکن است به همین بهانه اعلام جهاد دفاعی کنند و در مقابل این «تجاوز» دشمن، جهاد را پیاده کنند، هرگاه دلیل بهتری برای چپاول و غارت وجود نداشته باشد، این نیز روش خوبی برای انجام جهاد، این فرضیه الهی است.

جهاد باید تا کجا ادامه پیدا کند؟

برای یافتن پاسخ این پرسش باید به آیه زیر در قرآن توجه کرد.

سوره بقره (ماده گوساله) آیه 192:

وَقَاتِلُوهُمْ حَتَّى لاَ تَكُونَ فِتْنَةٌ وَيَكُونَ الدِّينُ لِلّهِ فَإِنِ انتَهَواْ فَلاَ عُدْوَانَ إِلاَّ عَلَى الظَّالِمِينَ.

با آنها بجنگيد تا ديگر فتنه ای نباشد و دين تنها دين خدا شود ولی اگراز آيين خويش دست برداشتند ، تجاوز جز بر ستمکاران روا نيست.

آشکار است که قرآن میگوید مسلمانان تا زمانیکه «دین همه دین خدا شود» باید با نامسلمانان جنگ کنند. البته در ادامه نیز میگوید تجاوز جز بر ظالمین روا نیست، این جمله به این معنی است که از نظر قرآن «تجاوز بر ظالمین» روا است و از این آیه همچنین میتوان فهمید که نامسلمان از نظر الله ظالم است،  قرآن در چندین جای دیگر نیز نامسلمانان را ظالم نامیده است (16) و نتیجه منطقی آنکه از دیدگاه اسلامی تجاوز بر نامسلمان رواست! آیت الله مصباح یزدی نیز در پاسخ به پرسش بنیادین این بخش گفته است:

اگر به این حقیقت توجه داشته باشیم که غرض از بعثت پیامبر اسلام تسلط دین او بر همه ادیان است: «هُوَ الَّذِي أَرْسَلَ رَسُولَهُ بِالْهُدى وَ دِينِ الْحَقِّ لِيُظْهِرَهُ عَلَى الدِّينِ كُلِّهِ وَ لَوْ كَرِهَ الْمُشْرِكُونَ» (سوره توبه آیه 33، قتح آیه 28 و صف آیه 9) نیز اگر توجه داشته باشیم که هدف از قتال با کفر پیشگان، بر افتادن همه فتنه ها و اختصاص یافتن دین به خدای متعال است: «وَقَاتِلُوهُمْ حَتَّى لاَ تَكُونَ فِتْنَةٌ وَيَكُونَ الدِّينُ لِلّهِ فَإِنِ انتَهَواْ فَلاَ عُدْوَانَ إِلاَّ عَلَى الظَّالِمِين» (انفال آیه 39)، به ویژه اگر توجه کنیم به این نکته که در روایات ما، «فتنه» که در این آیه آمده است به «شرک» تفسیر شده است، آن گاه در میابیم که جهاد ابتدایی با کفار و مشرکان باید تا آن جا دوام پیدا کند که زمین از آلودگی های کفر و شرک و فساد پاک شود و حکومت الهی و توحیدی در سراسر عالم برقرار گردد.

ناگفته نگذاریم که مقصود از بر افتادن کفر و شرک این نیست که همه انسانهای روی زمین مسلمان و موجود شوند، چرا که با جبر و زور نمیشود در دل ها نفوذ کرد و ایمان و اعتقاد که به دل مربوط می شود از دسترس اکراه و الزام به دور است: لا اکراه فی الدین (بقره 256) بلکه منظور این است که نظام حاکم بر جهان، نظامی الهی و توحیدی باشد و حاکمیت از آن خدا گردد. (17)

ناگفته نماند مسلمانان در هنگان جنگ علاوه بر کشتن نامسلمانان میتوانند:

1- درخت ها را قطع کنند.

محمد در زمانی که در مدینه بود و به قبیله یهودی بنی نضیر حمله کرد (شرح این حمله را در نوشتاری با فرنام حمله به بنی نضیر بخوانید.) و آنها را به مدت 15 روز محاصره کرد، سپس شروع به نابود کردن درختان نخل آنان کرد تا به آنها فشار بیشتری بیاید و تسلیم شوند، سر انجام بنی نضیر تسلیم میشوند، تمام دارایی آنها توسط مسلمانان چپاول میشود، زنانشان برده میشوند و گروهی از آنها به خیبر میروند و البته بعد ها محمد به خیبر نیز حمله میکند و اعمال مشابهی را انجام داد. آیه 5 ام سوره حشر این کار زشت و غیر اخلاقی او را توجیه میکند:

ما قَطَعْتُمْ مِنْ لِينَةٍ أَوْ تَرَكْتُمُوها قائِمَةً عَلى أُصُولِها فَبِإِذْنِ اللَّهِ وَ لِيُخْزِيَ الْفاسِقِينَ.

هر درخت باارزش نخل را قطع و يا آن را به حال خود واگذار كرديد، همه به فرمان خدا بود، و هدف اين بود كه فاسقان را خوار و رسوا كند.

این تاکتیک ضد انسانی اسلامی به آن معنی است که مسلمانان مجازند در جنگ منابع غذایی دشمنان خود را از بین ببرند، و محمد خود این کار را دستکم دو بار انجام داده است، در تاریخ گفته شده است که او در جنگ بدر نیز منابع آبی را بسوی مشرکین قطع کرده بود، قطع کردن آب بر روی امام حسین نیز استفاده از همین حق الهی غیر انسانی بوده است.

2- خانه ها را خراب کنند.

محمد در همان ماجرا خانه های قبیله بنی نضیر را نیز نابود میکند، آیه زیر به این واقعیت اشاره میکند:

سوره حشر آیه 2

هُوَ الَّذِي أَخْرَجَ الَّذِينَ كَفَرُوا مِنْ أَهْلِ الْكِتابِ مِنْ دِيارِهِمْ لأَِوَّلِ الْحَشْرِ ما ظَنَنْتُمْ أَنْ يَخْرُجُوا وَ ظَنُّوا أَنَّهُمْ مانِعَتُهُمْ حُصُونُهُمْ مِنَ اللَّهِ فَأَتاهُمُ اللَّهُ مِنْ حَيْثُ لَمْ يَحْتَسِبُوا وَ قَذَفَ فِي قُلُوبِهِمُ الرُّعْبَ يُخْرِبُونَ بُيُوتَهُمْ بِأَيْدِيهِمْ وَ أَيْدِي الْمُؤْمِنِينَ فَاعْتَبِرُوا يا أُولِي الأَْبْصارِ.

او كسي است كه كافران اهل كتاب را در اولين برخورد (با مسلمانان) از خانه‏هايشان بيرون راند، گمان نمي‏كرديد آنها خارج شوند، و خودشان نيز گمان مي‏كردند كه دژهاي محكمشان آنها را از عذاب الهي مانع مي‏شود، اما خداوند از آنجا كه گمان نمي‏كردند به سراغشان آمد، و در قلب آنها ترس و وحشت افكند، به گونه‏اي كه خانه‏هاي خود را با دست خويش و با دست مؤ منان ويران مي‏كردند، پس عبرت بگيريد اي صاحبان چشم!

بنابر این روشن است که مومنین! میتوانند در جنگ خانه های دشمنان اسلام را نیز خراب کنند، یعنی آبادانی های آنها را تخریب کنند.

3- به زنان تجاوز کنند.

زنانی از کفار که در جنگ بدست مسلمانان می افتند، بر مسلمانان حلال هستند یعنی مسلمانان میتوانند با آنها همبستر شوند، البته از نظر مسلمانان این یکی از حقوق الهی آنان است اما از دیدگاه انسانگرایانه این چیزی جز تجاوز نیست! برای اسناد و جزئیات بیشتر به نوشتاری با فرنام «برده داری در اسلام» مراجعه کنید. این حق در آیه زیر به مسلمانان داده شده است:

سوره نساء آیه 24

وَ الْمُحْصَناتُ مِنَ النِّساءِ إِلاَّ ما مَلَكَتْ أَيْمانُكُمْ كِتابَ اللَّهِ عَلَيْكُمْ وَ أُحِلَّ لَكُمْ ما وَراءَ ذلِكُمْ أَنْ تَبْتَغُوا بِأَمْوالِكُمْ مُحْصِنِينَ غَيْرَ مُسافِحِينَ فَمَا اسْتَمْتَعْتُمْ بِهِ مِنْهُنَّ فَآتُوهُنَّ أُجُورَهُنَّ فَرِيضَةً وَ لا جُناحَ عَلَيْكُمْ فِيما تَراضَيْتُمْ بِهِ مِنْ بَعْدِ الْفَرِيضَةِ إِنَّ اللَّهَ كانَ عَلِيماً حَكِيماً.

و زنان شوهردار (بر شما حرام است) مگر آنها را كه مالك شده‏ ايد (در جنگ به تصرف شما در آمده اند)، اينها احكامي است كه خداوند بر شما مقرر داشته و زنان ديگر غير از اينها (كه گفته شد) براي شما حلال است، كه با اموال خود آنها را اختيار كنيد در حالي كه پاكدامن باشيد و از زنا خودداري نماييد، و زناني را كه متعه مي‏كنيد مهر آنها را، واجب است بپردازيد و گناهي بر شما نيست نسبت به آنچه با يكديگر توافق كرده‏ايد بعد از تعيين مهر، خداوند دانا و حكيم است.

روزی با یکی از جانبازان دوران جنگ گفتگو میکردم، از او پرسیدم که در زمان جنگ آیا شنیده است که عراقی ها به زنان ایرانی در قصر شیرین و جاهای دیگر تجاوز بکنند؟ او پاسخ داد، من ندیدم، فکر هم نمیکنم اینکار ها را کرده باشند، چون آنها هم مسلمان بودند. برایش توضیح دادم که اتفاقاً چون مسلمان بوده اند اینکار ها را میکرده اند، بعد این آیه را نشانش دادم، او که ادعا میکرد بخاطر ایران و البته اسلام به جنگ رفته است، از دیدن این آیه که هرگز یا آنرا ندیده بود یا ترجمه اش را نخوانده بود و مانند ابله ها فقط عربی آنرا خوانده بود، واقعاً شگفت زده شد و گفت این ترجمه لابد غلط است، صهیونیستی است، به او نشان دادم که ترجمه مکارم شیرازی است، او حرف مفت دیگری زد و من تنها بر حماقتش افسوس خوردم و دلم برایش سوخت.

در صورت پیروز شدن مسلمانان در جهاد چه اتفاقی خواهد افتاد؟

بعد از اینکه مسلمانان در جنگ فاتح میشوند حقوق زیر را خواهند داشت:

1) اموال و غنائم را بین خود پخش کنند.

البته باید به این نکته توجه داشت پیامبر اسلام یک پنجم تمام غنائم را به خود اختصاص میداد و او از طریق همین 20% اموال بود که میتوانست خانه اش را با چندین زن خود بگرداند، محمد این حق اختصاصی را با نازل کردن آیه ای برای مسلمانان روشن کرده است:

سوره انفال آیه 41

وَ اعْلَمُوا أَنَّما غَنِمْتُمْ مِنْ شَيْ‏ءٍ فَأَنَّ لِلَّهِ خُمُسَهُ وَ لِلرَّسُولِ وَ لِذِي الْقُرْبى وَ الْيَتامى وَ الْمَساكِينِ وَ ابْنِ السَّبِيلِ إِنْ كُنْتُمْ آمَنْتُمْ بِاللَّهِ وَ ما أَنْزَلْنا عَلى عَبْدِنا يَوْمَ الْفُرْقانِ يَوْمَ الْتَقَى الْجَمْعانِ وَ اللَّهُ عَلى كُلِّ شَيْ‏ءٍ قَدِيرٌ.

و بدانيد هر گونه غنيمتي به شما رسد خمس آن براي خدا و براي پيامبر و براي ذي القربي و يتيمان و مسكينان و واماندگان در راه است، اگر شما به خدا و آنچه بر بنده خود در روز جدائي حق از باطل، روز درگيري دو گروه (با ايمان و بيايمان يعني روز جنگ بدر) نازل كرديم، ايمان آورده‏ايد، و خداوند بر هر چيزي قادر است.

شیعیان معتقدند این خمس غنائم بعد از مرگ محمد نیز به امام تعلق میگیرد و بعد از امام هم لابد به آخوندها. به نظر میرسد همین پنج درصد بتواند به خوبی نشان دهد که انگیزه محمد از پیامبری چه بوده است. انگیزه مهم مسلمانان از حمله به نامسلمانان کسب اموال آنان بوده است، در قرآن به صراحت دیده میشود که مسلمانان اموال کاروانها را میخواستند!

سوره انفال آیه 8

وَ إِذْ يَعِدُكُمُ اللَّهُ إِحْدَى الطَّائِفَتَيْنِ أَنَّها لَكُمْ وَ تَوَدُّونَ أَنَّ غَيْرَ ذاتِ الشَّوْكَةِ تَكُونُ لَكُمْ وَ يُرِيدُ اللَّهُ أَنْ يُحِقَّ الْحَقَّ بِكَلِماتِهِ وَ يَقْطَعَ دابِرَ الْكافِرِينَ.

و (به ياد بياوريد) هنگامي را كه خداوند به شما وعده داد كه يكي از دو گروه (كاروان تجاري قريش يا لشكر آنها) براي شما خواهد بود اما شما دوست مي‏داشتيد كه كاروان براي شما باشد (و بر آن پيروز شويد) ولي خداوند مي‏خواهد حق را با كلمات خود تقويت و ريشه كافران را قطع كند (لذا شما را با لشگر قريش درگير ساخت).

2) زنان و کودکان را نیز بعنوان غنیمت بین خود بصورت برده پخش کنند.

یکی دیگر از راه هایی که بواسطه آن مرتبه یک شخص از آزاد به برده تقلیل می یابد اسیر شدن در جنگ است. یکی از مهمترین انگیزه های مسلمانان از جهاد کردن دست یافتن به زنان و دختران سایر ملل از جمله ایرانیان و رومیها بوده است. در اسلام برده باید تا حدی که اربابش از او کار میکشد برای او کار کند و تماس جنسی برقرار کردن با برده زن نیز برای مرد همچون زنان رسمی اش آزاد است (برای اسناد و مدارک و بررسی جزئیات به نوشتاری با فرنام برده داری در اسلام مراجعه کنید).

وقتی مسلمانان در جنگ پیروز میشوند در کنار اموال و گاو و گوسفند ها و دارایی های نامسلمانان، زنان آنها نیز همردیف با اموال آنها به مسلمانان تعلق میگیرد. برخی از مسلمانان همچنان چشم به زنان کفار دارند، در این ویدئو یک شخص اسلامگرا را میبینید که در اعتراض با قائله کشیده شدن کاریکاتور محمد توسط دانمارکی ها، در خطاب به دانمارکی ها فریاد میزند «به الله سوگند مسلمانان به شما حمله خواهند کرد و زنانتان را به غنیمت خواهند برد!».

3) مردان اسیر شده یا برده میشوند، یا کشته میشوند، یا به فدیه آزاد میشوند.

از دیدگاه خدای وحشی مسلمانان، اختیار جان نامسلمانان در دست مسلمانان است، یعنی در زمان اسارت مردان کافر، مسلمانان میتوانند یا آنها را بعنوان برده نگاه دارند، یا بکشندشان یا با فدیه (پولی که اطرافیان یک اسیر به مسلمانان میدهند تا آن اسیر آزاد شود.) آزادشان کنند و یا اینکه در ازای هر فعالیت دیگری آزادشان کنند. محمد در دوران حیات خود در ماجرای بنی قریظه حدود 700 نفر از اسرای مرد را سر میبرد (ماجرای دقیق و شرح کامل این واقعه را در نوشتاری با فرنام در ماجرای بنی قریظه واقعا چه اتفاقی افتاد؟  بیابید) آیه زیر به این قتل عام وحشیانه اشاره دارد:

سوره احزاب آیات 26 و 27

وَ أَنْزَلَ الَّذِينَ ظاهَرُوهُمْ مِنْ أَهْلِ الْكِتابِ مِنْ صَياصِيهِمْ وَ قَذَفَ فِي قُلُوبِهِمُ الرُّعْبَ فَرِيقاً تَقْتُلُونَ وَ تَأْسِرُونَ فَرِيقاً؛ وَ أَوْرَثَكُمْ أَرْضَهُمْ وَ دِيارَهُمْ وَ أَمْوالَهُمْ وَ أَرْضاً لَمْ تَطَؤُها وَ كانَ اللَّهُ عَلى كُلِّ شَيْ‏ءٍ قَدِيراً.

خداوند گروهي از اهل كتاب را كه از آنها (مشركان عرب) حمايت كردند از قلعه‏هاي محكمشان پائين كشيد، و در دلهاي آنها رعب افكند (كارشان به جائي رسيد كه) گروهي را به قتل مي‏رسانديد و گروهي را اسير مي‏كرديد؛ و زمينها و خانه‏هايشان را در اختيار شما گذاشت و (همچنين) زميني را كه هرگز در آن گام ننهاده بوديد و خداوند بر هر چيزي قادر است.

به نظر میرسد محمد با این آیات، آن واقعه وحشتناک و قتل عام و چپاول اموال نامسلمانان را جشن میگرفته است و بر سر مسلمانان دزد منت میگذاشته است که باعث شده مسلمانها به ثروت باد آورده ای دست یابند، و همچنین روشن است که مسلمانان میتوانند از لحاظ شرعی از این روش زندگی پیامبرشان پیروی کنند.

4) سلطنت اسلامی آغاز میگردد

یعنی قوانین و حکومت اسلامی در آن منطقه مفتوح اعمال میشوند و کفار اگر جزیه بدهند به اهل ذمه تبدیل میشوند و اگر ندهند هم که کافر حربی حساب میشوند و کشته خواهند شد. اهل ذمه به کافرانی گفته میشود که در حمایت مسلمانان زندگی میکنند.

نکته جالب اینجا است که در قرآن از مسلمانان خواسته شده است در جنگ تعدی (تعدی یعنی تجاوز و ظلم) نیز نکنند:

سوره بقره (ماده گوساله) آیه 190:

وَقَاتِلُواْ فِي سَبِيلِ اللّهِ الَّذِينَ يُقَاتِلُونَكُمْ وَلاَ تَعْتَدُواْ إِنَّ اللّهَ لاَ يُحِبِّ الْمُعْتَدِينَ.

با کسانی که با شما جنگ می کنند ، در راه خدا بجنگيد و تعدی مکنيد زيرا خدا تعدی کنندگان را دوست ندارد.

نتیجه منطقی آن است که، برده داری، تجاوز به زنان، قصب اموال، جزیه و کشتن مردان هیچکدام تعدی حساب نمیشوند، از الله واقعاً باید پرسید منظورش از تعدی چیست؟ این سخن درست مانند این است که به یک شخص بگوییم برو و فلان کس را بکش و به زنش تجاوز کن و اموالش را نیز بردار اما مبادا به او ظلمی کنی! شاید منظور از این آیه این بوده است که وقتی نامسلمانان و مسلمانانی که شک گرا بوده اند از محمد میپرسیده اند چطور تو میتوانی از طرف خدا باشی و چنین قوانین وحشیانه ای را تبلیغ کنی، او بتواند بگوید خدا ما را از تعدی نهی کرده! و تعدی تجاوز و برده داری و قصب مال و کشتن برده و باجگیری و غیره نیست!

آیا بین جهاد ابتدایی و آیات صلح آمیز قرآن ناسازگاری وجود دارد؟

از آنجا که اسلام دینی بی در و پیکر و تق و لق است و هر ننه قمری میتواند تفسیر خودش را به اسلام به چسباند و قرآن بر خلاف ادعایش کتابی مبین نیست و به نظر مسلمانان خدای جهان قرار است آخرین دینش را طوری نازل کرده باشد که هزار جور بتوان آنرا فهمید و فهم های متناقض از آن داشت حتی در پاسخ به این پرسش بسیار روشن و اساسی نیز دو نظریه کلی مخالف یکدیگر در میان دانشمندان اسلام وجود دارد، برخی معتقدند آیات قتال و جنایت قرآن ناسخ آیات صلح آمیز پیشین قرآن هستند و آنها را منسوخ کرده اند و برخی معتقدند که چنین نیست و این دو دسته آیات به دلیل اینکه مقید هستند و مطلق نیستند در تناقض با یکدیگر نیستند و هرکدام برای شرایط خاصی آورده شده اند.

برای پرداختن به این مسئله باید قضیه ای با فرنام ناسخ و منسوخ را اندکی بررسی کنیم. همانطور که میدانیم محمد برای برداشتن مشکلات از سر راه خود آیات قرآنی را بصورت تدریجی می آورد. و بنا به میل خود و شرایط روز آیات قرآنی جدیدی را معرفی میکرد، بعنوان مثال وقتی در مورد اسیران جنگی پس از جنگ بدر توسط مسمانان اختلافی پیش آمده بود که آیا باید اسیر را در جنگ کشت یا اینکه با پرداخت فدیه آنها را آزاد کرد، پیامبر اسلام با زیرکی آیه 67 سوره انفال را میسازد،

مَا كَانَ لِنَبِيٍّ أَن يَكُونَ لَهُ أَسْرَى حَتَّى يُثْخِنَ فِي الأَرْضِ تُرِيدُونَ عَرَضَ الدُّنْيَا وَاللّهُ يُرِيدُ الآخِرَةَ وَاللّهُ عَزِيزٌ حَكِيمٌ.

برای هیچ پیامبری نسزد که اسیران داشته باشد تا که در روی زمین کشتار بسیار کند. شما متاع این جهانی را می‌خواهید و خدا آخرت را می‌خواهد. و او پیروزمند و حکیم است.

به همین دلیل که محمد قبل از تولید بخشی از آیات تازینامه، پردازش و تعقل چندانی نمیکرد، در قرآن دستورات متناقضی پیش می آمد، مثلا جایی میگفت فلان کار را بکنید و جای دیگر میگفت آنکار را دیگر نکنید. یا مثلا آیات مضحکی تولید میکرد و بعدا پشیمان میشد و می‌خواست که آنها را باطل کند. برای پوشش این تضادهای قرآن و اینکه چرا بعضی از آیات قرآنی ضد دیگر آیات قرآن هستند، پیامبر اسلام قضیه ناسخ و منسوخ را معرفی کرد؛ به آیاتی که باطل شده اند منسوخ و به آیاتی که باطل می‌کنند ناسخ میگویند. در واقع برای پوشاندن این تناقضات محمد تلاش کرد این مفهوم را جای بیاندازد تا جلوی مخالفت ها را بگیرد، وقتی که محمد با اعتراضات در مورد اینکه چرا حرف خدا باید تناقض داشته باشد و این ناسخ و منسوخ دیگر چه صیغه ای است، آیه 106 سوره بقره  (ماده گوساله) را می آورد:

مَا نَنسَخْ مِنْ آيَةٍ أَوْ نُنسِهَا نَأْتِ بِخَيْرٍ مِّنْهَا أَوْ مِثْلِهَا أَلَمْ تَعْلَمْ أَنَّ اللّهَ عَلَىَ كُلِّ شَيْءٍ قَدِيرٌ.

هیچ آیه ای را منسوخ یا ترک نمیکنیم مگر آنکه بهتر از آن یا همانند آن را می آوریم. آیا نمیدانی که خدا بر هر کاری تواناست؟.

این است که در قرآن هرگاه تضادی بین دستورات وجود داشته باشد، آن دستورات را با توجه به قاعده ناسخ و منسوخ باید بررسی کرد، و این امر کاملا منطقی است، در همه جا آخرین دستور، معمولا دستوریست که باید اجرا شود، نه دستورهای قدیمی.

حال با روشن شدن قضیه ناسخ و منسوخ که عالمان دینی بحث های بسیار مفصلی در این مورد دارند، میتوان به بررسی آیات تازینامه در قبال برخورد با کافران و مشرکان و منافقین پرداخت.

همانطور که میدانیم، سوره های تازینامه به دو دسته مدنی و مکی تقسیم میشوند، محمد در مکه تنها مردم را به نیکی دعوت میکرد و حتی قوانین و شریعت مشخصی را مدعی نشده بود. رفتاری که محمد در قبال مخالفان در این دوران پیش گرفته بود را میتوان از آیات زیر یافت:

انعام  از سوره های مکی 108:

وَلاَ تَسُبُّواْ الَّذِينَ يَدْعُونَ مِن دُونِ اللّهِ فَيَسُبُّواْ اللّهَ عَدْوًا بِغَيْرِ عِلْمٍ كَذَلِكَ زَيَّنَّا لِكُلِّ أُمَّةٍ عَمَلَهُمْ ثُمَّ إِلَى رَبِّهِم مَّرْجِعُهُمْ فَيُنَبِّئُهُم بِمَا كَانُواْ يَعْمَلُونَ.

چیزهایی را که آنان به جای الله می‌خوانند، دشنام مدهید که آنان نیز بی هیچ دانشی، از روی کینه توزی به الله دشنام دهند. اینچنین عمل هر قومی را در چشمشان آراسته ایم. پس بازگشت همگان به پروردگارشان است و او همه را از کارهایی که کرده اند آگاه می سازد.

سوره مزمل  از سوره های مکی  آیات 10 تا 12:

وَاصْبِرْ عَلَى مَا يَقُولُونَ وَاهْجُرْهُمْ هَجْرًا جَمِيلًا؛وَذَرْنِي وَالْمُكَذِّبِينَ أُولِي النَّعْمَةِ وَمَهِّلْهُمْ قَلِيلًا؛إِنَّ لَدَيْنَا أَنكَالًا وَجَحِيمًا.

بر آنچه میگویند صبر کن و به وجهی پسندیده از ایشان دوری جوی، تکذیب کنندگاه صاحب نعمت را به من واگذار و اندکی مهلتشان ده، نزد ماست بندهای گران و دوزخ.

سوره مومنون از سوره های مکی آیه 96:

ادْفَعْ بِالَّتِي هِيَ أَحْسَنُ السَّيِّئَةَ نَحْنُ أَعْلَمُ بِمَا يَصِفُونَ.

سخن بد آنان را به هرچه نیکوترت می آ ید پاسخ گوی. ما به سخن آنان آگاه تر هستیم.

اما بعد از فرار محمد از مکه به مدینه، در رفتار محمد تغییر شگرفی حاصل می‌شود، محمد دیگر از تحمل و احترام و همزیستی دم نمیزند، محمد از جنگ و جهاد و کشتن و آواره کردن سخن میگوید. (تغییر رفتار محمد از مکه به مدینه در نوشته ای بافرنام بررسی سوره های مكی ومدني از مدافع حقوق انساني  با دقت بالاتری انجام گرفته است). دلیل این تغییر رفتار محمد در قبال کافران و مشکران و مخالفانش چه بود؟

منطقی ترین دلیل، که علی دشتی نیز در کتاب 23 سال به آن به خوبی اشاره می‌کند وضعیت اقتصادی محمد و یارانش مهاجرش است. محمد و مهاجرین در مکه صاحب ملک و کار و یا تجارت بودند اما در مدینه هیچ ثروت و کاری نداشتند و زندگی سختی را میگذراندند، زندگی در کنار انصار که متملک بودند و کار و زندگی و خانوانده داشتند برای مسلمانانی که باید خود را برای جنگ با مشکرین مکه آماده میکردند بسیار دشوار بود، از این رو محمد نیاز به انجام اموری داشت که بتواند ثروت باد آورده ای را برای مسلمانان مهاجر دست و پا کند، محمد دو کار مهم را در این باب انجام داد.

1) غزوه، غزوه یعنی حمله ای که به قصد بدست آوردن غنائم انجام میگیرد، مثلاً حمله به کاروان های تجارتی. محمد به شغل ناشریف حمله به کاروان  و دزدی و غارت اموال آنها و به اسارت کشیدن زنان و فرزندان آنان با عنوانین برده و کنیز پرداخت، و جنگ بدر اولی اینگونه آغاز شد که پیامبر اسلام به کاروان تجاری ابوجهل که از شام به مکه میرفت حمله کرد و آنرا غارت کرد. برای اطلاعات دقیق تر در مورد غزوات محمد به نوشتاری با فرنام «غزوه چگونه جنگي بود و به چه كسي شهيد مي گفتند؟» و همچنین «جنگهای پیغمر- بخش دوم مناظره آیت الله منتظری با دکتر علی سینا.» مراجعه کنید.

2) در یثرب سه قبیله یهودی وجود داشتند که پیامبر اسلام هر 3 این قبایل را به بهانه هایی یا قتل عام کرد یا آنها را مجبور کرد پراکنده شوند و مهاجرت کنند و اموال آنان را به غارت برد، قبیله بنی قریظه را که قتل عام کرد و 800 نفر یهودی را در یک روز سر برید (شرح کامل را در نوشته ای با فرنام «بر سر بنی قریظه واقعا چه آمد؟» بخوانید)، رئیس قبیله بنی نضیر را ترور کرد (ماجرای کامل را در نوشته ای با فرنام محمد اولین تروریست اسلامی، ترور کعب بن الاشرف از دانشمندان یهودی توسط محمد از تاریخ طبری و همچنین کعب بن اشرف بخوانید ) و بعد آنها را محاصره کرد و دستور داد نخلستانشان را آتش بزنند، بنی نضیر اعتراض کردند که تو خود را آدم خیر خواهی می‌خوانی پس چرا نخلستانهای مارا آتش زدی؟ وی محمد آیه  3، 4 و 5 سوره حشر را تولید کرد:

وَلَوْلَا أَن كَتَبَ اللَّهُ عَلَيْهِمُ الْجَلَاء لَعَذَّبَهُمْ فِي الدُّنْيَا وَلَهُمْ فِي الْآخِرَةِ عَذَابُ النَّارِ؛ ذَلِكَ بِأَنَّهُمْ شَاقُّوا اللَّهَ وَرَسُولَهُ وَمَن يُشَاقِّ اللَّهَ فَإِنَّ اللَّهَ شَدِيدُ الْعِقَابِ؛ مَا قَطَعْتُم مِّن لِّينَةٍ أَوْ تَرَكْتُمُوهَا قَائِمَةً عَلَى أُصُولِهَا فَبِإِذْنِ اللَّهِ وَلِيُخْزِيَ الْفَاسِقِينَ.

اگر بر آنها ترک دیار نوشته نشده بود در این جهان دچار عذاب میشدند، و در آن جهان هم در آتشند. اگر شما نخلی را قطع کنید یا آنرا سر پای نگاه دارید خداوند شما را مخیر می‌کند ولی قطع آن برای مجازات فاسقین است.

بنی نضیر پس از 20 روز تسلیم محاصره شدند و به واسطه شفاعت بعضی از سران خزرج بنا شد سالم از مدینه خارج شوند، اما تمام ثروت و دارایی آنها توسط پیامبر اسلام غارت شد. شرح کامل ماجرای بنی قریظه را در نوشتاری با فرنام «حمله به بنی نضیر» بخوانید.  قبیله سوم یهودی که پیامبر اسلام غارت کرد قبیله بنی قینقاع بودند که پیامبر اسلام به بهانه هایی آنها را مجبور کرد تا از یثرب کوچ کنند و جز اثاث و اشیاء منقول خود، که قابل حمل باشند چیزی با خود نبرند، و ثروت آنان نیز به پیامبر و دار و دسته اش رسید، شرح کامل ماجرای بنی قینقاع را در نوشتاری با فرنام «حمله به بنی قینقاع» بخوانید، پیامبر دقیقاً کار مشابهی را با مردمان دیگری در سایر جنگهایش همچون حمله به خیبر و بنی مصطلق نیز انجام داده است.

با در نظر داشتن این دو مقدمه اکنون آسانتر میتوان به ادعای مسلمانان در مورد دفاعی بودن آیات جنایی تازینامه پرداخت. آیات جنایی تازینامه بدون استثناء همگی از آیات مدنی هستند، و اینجاست که با در نظر گرفتن تغییر شگرفی که در زندگی و روش زندگی محمد بوجود آمد بهتر میتوان فهمید چرا لحن قرآن و دستورات آن پیرامون رفتار با مشرکین تغییر میکند. این آیات به نظر هواداران نخستین نظریه پیرامون سازگاری یا ناسازگاری آیات جهادی قرآن با آیات صلح آمیزش در واقع آیات مکی در مورد رفتار نیک با مخالفان اسلام را نسخ می‌کنند، سوره توبه آخرین سوره ای است که پیامبر اسلام تولید کرد (18). در هنگام نزول سوره توبه مسلمانان در جنگ نبودند و سوره توبه آخرین دستور العملی است که در قرآن برای مسلمانان برای روش برخورد آنان با غیر مسلمانان، پس از اسلام وجود دارد، زیرا هیچ سوره دیگری بعد از آن وجود ندارد که بخواهد مفاهیم آنرا منسوخ کند! سوره توبه از خشن ترین سوره های تازینامه نیز محسوب می‌شود تاجایی که گویا محمد یا هر کس دیگر که قرآن را دیکته میکرده است یا مینوشته است از فرط خشم حتی آنرا با بسم الله الرحمن  الرحیم آغاز نکرده است. امام علی گفته است بسم الله الرحمن الرحیم با خود رحمت می آورد، این درحالی است که این سوره با آیه شمشیر نازل شده است (19)، به این سوره، سوره برائت به معنی بیزاری نیز میگویند، محمد در این سوره استراتژی اصلی و ابدی رفتار مسلمانان با نا مسلمانان را بیان می‌کند،  هیچ کجای آن از جنگ صحبت نمی‌شود! یعنی اینها مربوط به شرایط جنگی نیستند بلکه مسلمانان در شرایط عادی نیز باید آنها را رعایت کنند!

به عقیده بزرگترین مفسران قرآن همچون ابن کثیر با نازل شدن سوره توبه تمامی پیمانهای صلح و معاهده ها بین مسلمانان و نامسلمانان منسوخ شدند و دیگر هیچ غیر مسلمانی در امان نبوده است (20). تفسیر جلالین نوشته است این سوره امنیت کفار را با شمشیر از میان برداشت (21). المودودی گفته است:

سوره توبه بعد از ماجرای صلح حدیبیه نازل شد. نتیجه سروده شدن این سوره یکی زیر پا گذاشتن معاهده صلح حدیبیه و دیگری حمله به تبوک و تصرف آن بود. مودودی شرح میدهد که سوره توبه در مورد چهار مسئله نازل شده است.

1- تمام عربستان را به یک دارالاسلام کامل تبدیل کند. برای این منظور آشکارا اعلام می‌کند که تمامی عهدنامه ها و پیمانها بین مسلمانها و مشرکین باطل هستند و هیچ تعهدی میان مسلمین و مشرکین بعد از پایان آمدن چهار ماه نیست (آیات 1 تا 3)، اینکار برای نابودی شرک ضروری بود تا اینکه مبادا تهدیدی برای اسلام باشد. (آیات 12 تا 18) کعبه را منحصر به مسلمانان می‌کند و انجام تمامی مراسم مشرکین در آنرا ممنوع می‌کند. مشرکین حتی نباید به کعبه نزدیک بشوند (آیه 28).

2- نفوذ اسلام را در کشورهای همسایه گسترش دهد. (آیه 29) برای اینکه مسلمانان بتوانند نفوذ اسلام را در کشورهای همسایه افزایش دهند، به آنها اجازه داده شد تا جهاد کنند و با شمشیر به همسایگان حمله کنند تا این همسایگان سلطنت اسلام را قبول کنند، از آنجا که روم و ایران همسایگان پر قدرت آنها بودند، درگیری بین مسلمانان و آنان امتناع ناپذیر بود. هدف جهاد این نبود که آنها را مجبور به پذیرش اسلام شوند، بلکه این بود که آنها مردم خود را مجبور از رها کردن اسلام نکنند و جلوی مردم و نسلهای بعدیشان را از گرویدن به اسلام نگیرند. آنها میتوانستند عقاید دینی خود را تا هنگامی که جزیه میپردازند برای خود حفظ کنند.

3- منافقین نافرمانبردار را نابود کند. از آنجا که دیگر تهدیدی از خارج مسلمانان را تهدید نمیکرد، مسلمانان میتوانستند منافقین را که در میان خودشان بودند نابود کنند (آیه 73) پیامبر خانه سوالیم را که مکان تجمع و مشورت منافقان بود را آتش زد.

4- مسلمانان را برای جهاد علیه جهان غیر مسلمان آماده کند. (آیات 81 تا 96) لازم بود تا تقویت ایمان در میان مسلمانان شکل بگیرد زیرا اسلام قرار بود چهره ای جهانی به خود بگیرد و در درگیری میان کفر و اسلام خطرناکترین چیز کم ایمانی مسلمانان بود. بنابر این آیات هرکس حاضر نباشد از جان، زمان، مال و نیروی خود در راه اسلام بگذرد، در ایمان خود ناخالص است و مسلمانان باید در راه اسلام جهاد کنند و الا در ایمان آنها باید شک کرد. (22)

حال با در نظر گرفتن این جزئیات در مورد سوره توبه، باید به آیات آن پرداخت، شاید مهمترین آیه سوره توبه، آیه پنجم آن باشد، که معروف به آیه شمشیر یا «آية السيف» است.

سورهُ توبه آیه 5

فَإِذَا انسَلَخَ الأَشْهُرُ الْحُرُمُ فَاقْتُلُواْ الْمُشْرِكِينَ حَيْثُ وَجَدتُّمُوهُمْ وَخُذُوهُمْ وَاحْصُرُوهُمْ وَاقْعُدُواْ لَهُمْ كُلَّ مَرْصَدٍ فَإِن تَابُواْ وَأَقَامُواْ الصَّلاَةَ وَآتَوُاْ الزَّكَاةَ فَخَلُّواْ سَبِيلَهُمْ إِنَّ اللّهَ غَفُورٌ رَّحِيمٌ.

پس چون ماههاي حرام به سر آمد  آنگاه مشركان را هر جا يافتيد به قتل رسانيد. و آنها را دستگير و محاصره كنيد . و هر سو در كمين آنها باشيد. چنانچه توبه كردند و نماز به پاي داشتند و زكات دادند پس از آنها دست بداريد. كه خدا آمرزنده و مهربان است.

آیا در این آیه کلمه ای میبینید که بتوان از آن دریافت که این آیات تنها مربوط به شرایط جنگی هستند؟ پیامبر اسلام در مورد جنگ این آیه را مطرح نکرده است. بزرگترین مفسرین قرآن معتقدند آیه پنجم سوره توبه ناسخ حدود 124 آیه قبلی است که در مورد سازش و بردباری در مقابل کافران آمده است یعنی این آیه تمام آنچه در مورد مدارا با نامسلمانان پیش از سروده شدن این آیه در قرآن آمده است را کاملا نسخ می‌کند. این آیه به روشنی میگوید که مسلمانان باید بعد از چهارماه مشرکین را هرکجا که یافته میشوند به قتل برسانند. چگونه این آیه میتواند دفاعی باشد؟ آیا مسلمانان برای دفاع  از خود باید چهار ماه صبر کنند؟  آشکار است که این آیه متجاوزانه است و دفاعی در کار نیست، همین آیه برای اثبات دروغ بودن ادعای اسلامگرایان برای دفاعی بودن آیات جنایی قرآن کافی است.

علامه طباطباعی در المیزان پیرامون این آیه افاضه کرده اند:

«جمله فاقتلو المشرکین حیث وجدتموهم نشاندهنده براعت و بیزاری از مشرکین است و می‌خواهد احترام را از جانهای کفار برداشته و خونهایشان را هدر سازد و بفرماید: بعد از تمام شدن آن مهلت دیگر مانعی نیست از اینکه آنان را بکشید نه حرمت حرم و نه احترام ماههای حرام، بلکه هروقت و هرکجا که آنان را دیدید، باید به قتلشان برسایند…..تشریع این حکم بر این بوده که کفار را در معرض فنا و انقراض قرار داده و به تدریج صفحه زمین را از لوث وجودشان پاک کند، و مردم را از خطرهای معاشرت و مخالطت با آنها نجات دهد…اگر به آنان كسى دست يافت و توانست ايشان را بكشد بايد كشته شوند، و اگر نشد دستگير شوند و اگر اين هم نشد در همان جايگاههايشان محاصره شوند و نتوانند بيرون آيند و با مردم آميزش و مخالطه كنند، و اگر معلوم نشد در كجا پنهان شده اند، در هر جا كه احتمال رود كمين بگذارد تا بدين وسيله دستگيرشان نموده يا به قتلشان فرمان دهد و يا اسيرشان كند.»  (23)

شایان ذکر است که پاک کردن تدریجی زمین از وجود یک جمعیت دقیقاً معنی کلمه «نسل کشی» است، آشکار است که این علامه نیز همچون ما به انسان ستیز بودن دین اسلام اعتراف می‌کند، حقیقت این است که اسلام در پی نسل کشی نامسلمانان است. آیت الله روح الله خمینی در یکی از سخنرانیهای خود میفرمایند «اسلام در عین حالی که یک مکتب تربیت است، لکن آنروزی که فهمید قابل تربیت نیست، 700 نفرشان را در یکجا در یهود بنی قریظه را میکشند، گردن میزنند به امر رسول الله» (24) آیا شما نیز از میزان دفاعی بودن و صلح آمیز بودن این آیات در کلام متخصصان و بزرگترین عالمان اسلام در تحیر هستید؟ اگر هنوز با ماجرای نسل کشی وحشتناک یهودیان ساکن یثرب توسط پیامبر اسلام آشنایی ندارید حتماً بخش نسل کشی یهودیان مدینه به دست پیامبر اسلام را مطالعه کنید. آیت الله خمینی به درستی جنایات انجام شده در جمهوری اسلامی را با جنایت پیامبر قتل عامگر اسلام مقایسه می‌کند.

همانگونه که مودودی و اسلامشناسان سرشناس دیگر اعلام داشته اند، بخش پایانی آیات سوره توبه مربوط به کشورگشایی های اسلامی می‌شود. در این آیه نیز به مسلمانان دستور داده می‌شود تا به کشورهای همسایه خود حمله کنند و اسلام را به آنجا نیز ببرند. البته محمد به اندازه کافی به حیات ننگین خود ادامه نداد اما اطرافیان او بعد از مرگ مشکوکش راه و روش وی  را ادامه دادند و به کشورهای همسایه حمله کردند و مردان را کشته زنان و کودکانشان را به اسارت کشیدند، برای اسناد تاریخی این حملات مرگبار به بخش  مختصری از مقاومتهای مردم ایران در مقابل اعراب مسلمان مراجعه کنید.

اما طرفداران اندیشه دوم را خرده اندیشمندانی همچون آیت الله مطهری تشکیل میدهند، آیت الله مطهری گفته است:

بعضي از مفسرين آمده اند مسئله ناسخ و منسوخ را در اينجا طرح كرده اند يعني گفته اند كه در بسياري از آيات قرآن همانطور كه شما ميگوئيد جنگيدن با كافران را مشروط كرده است ولي در بعضي از آيات ديگر آمده همه آن دستورات را يكجا نسخ كرده بنابر اين در اينجا صحبت از ناسخ و منسوخ است آيات اول برائت كه فرمان جهاد را بطور كلي ميدهد و تبري ميجويد از مشركين و يك مهلت براي مشركين مقرر ميكند و بعد از آن مهلت ميگويد ديگر اينها حق ندارند باقي بمانند ، بكشيد اينها را ، در حصارشان قرار بدهيد ،  و در كمينشان بنشينيد اين آيات كه سال نهم هجري هم آمده است تمام دستورهاي گذشته را يكجا نسخ كرده است . آيا اين حرف درستي است ؟

اين حرف حرف نادرستي است . به چه دليل ؟ به دو دليل ، يك دليل اين است  كه ما در يكجائي مي توانيم يك آيه اي را ناسخ آيه اي ديگر بدانيم كه درست بر ضد او باشد مثلا اگر فرض كنيد كه يك آيه بيايد بگويد كه اصلا با مشركين نجنگيد ، آنگاه يك آيه ديگري بيايد اجازه بدهد كه بعد از اين بجنگيد خوب اين معنايش اين است كه آن دستوريكه ما قبلا داده ايم آن دستور را لغو كرديم و يك دستور ثانوي بجاي آن آورديم . معني ناسخ و منسوخ اين است كه دستور اول لغو بشود و يك دستور ثانوي بجاي آن بيايد پس دستور دوم بايد جوري باشد كه صد درصد بر ضد دستور اول باشد كه بشود اين دومي را لغو آن تلقي كرد اما اگر دومي و اولي مجموعشان با يك ديگر قابل جمع باشند يعني يكيشان توضيح دهنده ديگري باشد اينجا كه ناسخ و منسوخ ندارد كه بگوئيم يكي براي لغو ديگري آمده است.

آيات سوره برائت جوري نيست كه بگوئيم لغو آياتيست كه قبلا آمده و جهاد را مشروط كرده است ، چرا ؟ چون همين سوره برائت هم وقتيكه ما تمام آن آيات را با يكديگر ميخوانيم مي بينيم كه در مجموع ميگويد ، باين دليل با اين مشركان بجنگيد كه اينها بهيچ اصل انساني ، به وفاي به عهد ، كه يك امري فطري و وجداني است و حتي اگر يك قومي قانون هم نداشته باشند بحكم فطرتشان درك ميكنند كه به پيمان بايد وفادار بود ، پايبند نيستند با آنها اگر پيمان هم ببنديد و فرصت ببينند نقض ميكنند اينها هر لحظه فرصت پيدا كنند كه شما را محو و نابود كنند محو و نابود ميكنند . حالا اينجا عقل چه ميگويد ؟ ميگويد اگر شما درباره قومي قرائني بدست آورديد كه اينها درصدد هستند كه در اولين فرصت شما را از بين ببرند آيا ميگويد صبر كن كه او اول تو را از بين ببرد بعد تو او را از بين ببر ! اگر ما صبر كنيم او ما را از بين ميبرد …. (25)

ما در اینجا فرصت نقد این دیدگاه را نداریم اما بطور خلاصه باید بگویم که  برخلاف ادعای مطهری هیچ قرائن و شواهدی مبنی بر اینکه یهودیان مدینه قصد نابودی مسلمانان را داشتند یا مشرکین مکه چنین قصدی داشتند یا ایرانیان و رومی ها و سوریه ای ها و عراقی ها قصد نابودی مسلمانان را داشته باشند در تاریخ وجود ندارد، بنابر این توجیه جنایات مسلمانان و پیامبر اسلام کاملاً بی پایه است، رابرت اسپنسر از اسلامشناسان سرشناس میگوید:

پیش از اینکه ده سال از مرگ محمد بگذرد، ارتش مسلمانان سوریه، مصر، و ایران را فتح کرده بود. ارتش مسلمانان دمشق را در 635 تسخیر کرد، تنها سه سال بعد از مرگ محمد. قسمت های زیادی از عراق را در 636، جارالسلام را در 638، قیصریه را در 641، ارمنستان را در 643. فتح مصر نیز در همان دوران اتفاق افتاد. مسلمانان همچنین در جنگهای بسیار حساسی علیه بیزانسی ها در تونس در سال 647 پیروز شدند، و این پیروزی ها باعث فتح شمال افریقا شد. بر پارسی ها در نهاوند در سال 642 پیروز شدند و در سال 709 آنها کنترل کامل بر روی شمال افریقا داشتند. در سال 711 آنها اسپانیا را مطیع خود کرده بودند و به سمت فرانسه میرفتند. مسلمانان ابتدا «شهر قیصر» را که محمد به آنها وعده داده بود یعنی قسط‌نط‌نيه‌ (استانبول فعلی) را تسخیر کردند، برای یک سال که از آگوست 716 آغاز شد؛ اما علی رغم تلاش های مدام آنها، استانبول تا 700 سال بعد به دست مسلمانان نیافتاد. در همان هنگام سیسیل در سال 827 سقوط کرد. در سال 846 روم در معرض نابود شدن توسط مسلمانان مهاجم قرار گرفت. مسلمانان که موفق به چنین کاری نشدند کلیساهای جامع (کتدرال) های سینت پال را به آتش کشیدند و به قبور پاپ های پیشین بی احترامی کردند.

این جنگها، جنگهای دفاعی نبودند. مسلمانان در عربستان هرگز توسط این دو قدرت بزرگ که همسایه آنها نیز بودند، یعنی ایران و روم تهدید نشده بودند، مگر اینکه همسایه بودن با امپراطوری های بزرگ را به خودی خود یک تهدید بدانیم. این همسایه ها آنقدر مشغول درگیری با یکدیگر بودند که فرصت توجه کردن به سعود امپراطوری جدید محمد را نداشتند.

این جنگها حتی جنگهای عربی نیز نبودند، بعد از فتح، مسلمانان جامعه ای را برقرار میکردند که مبتنی بر استیلای مسلمانان بود نه اعراب. شخصی که از میان مردمان شکست خورده در جنگ به اسلام تغییر دین میداد از حقوق بیشتری نسبت به هم میهنان مسلمان نشده خود برخوردار میشد. ارتش های مسلمانان در روحیه ای که محمد خود آنرا به آنها دیکته کرده بود، یعنی «مسلمان شو یا با جنگ روبرو شو» بسیار پیشرفت کرده بودند. (26)

لازم به ذکر است بر اساس منطق آیت الله مطهری حال که کفار میدانند مسلمانان به قول آیت الله طباطباعی قصد دارند به تدریج زمین را از لوث وجود کفار پاک کنند، باید حق داشته باشند که مسلمانان را نابود کنند! اگر اینگونه است چرا مسلمانان که گمان میکنند امریکا قصد نابودی آنها را دارد به این نظر امریکا  اعتراض میکنند؟ اگر امریکا اینگونه فکر بکند تازه میشود مانند آیت الله مطهری و هم فکرانش! مگر اینکه این حق در انحصار مسلمانان و سایر تروریست های عالم باشد.

اما چه گروه اول درست بگویند چه گروه دوم، واقعیت این است که جهاد مسلمانان در زمان حضور محمد بسیار مرگبار بود و عربستان را از وجود نامسلمانان خالی کرد و بعد از مرگ آن خبیث نیز مسلمانان با جهاد به حمله و چپاول غیر مسلمانان پرداختند و آتش جهاد بعدها به دامن خود مسلمانان نیز افتاد.

گوشه ای از حملات مسلمانان به کشورهای دیگر و سایر قبایل را میتوان در جدول رخدادنگاری که پیشتر در همین نوشتار آمد تا به اروپا کشیده شد، و اگر جنگهای صلیبی رخ نمیداد و مسیحیان مسلمانان را از کشورهایشان بیرون نمیریختند، اسلام همانگونه که خاور میانه را به گند کشید، ممکن بود اروپا و در نتیجه تمام جهان را نیز به گند بکشد. باید از صلیبیون بخاطر خدمتی که به بشریت کردند سپاسگزار بود.

سوره توبه آیه 123

يَا أَيُّهَا الَّذِينَ آمَنُواْ قَاتِلُواْ الَّذِينَ يَلُونَكُم مِّنَ الْكُفَّارِ وَلِيَجِدُواْ فِيكُمْ غِلْظَةً وَاعْلَمُواْ أَنَّ اللّهَ مَعَ الْمُتَّقِينَ.

ای کسانیکه ایمان آورده اید، با کافرانی که در اطراف شمایند بجنگید! تا در شما درشتی و شدت را بیابند. و بدانید که خداوند با پرهیزکاران است!

علامه طباطباعی افاضه فرموده اند:

«در اين آيه شريفه دستور جهاد عمومى داده شده تا از هر طرف در دنيا، اسلام گسترش يابد، چون وقتى مى فرمايد: هر طائفه از مؤ منين بايد با كفار هم جوار خود كارزار كنند معنايش همان گسترش دادن اسلام و برقرار كردن سلطنت اسلام است بر دنيا، و بر تمامى ساكنين ربع مسكون» (27)

آیا در قبول دین اسلام اجباری وجود دارد؟

عبارت لا اکراه فی الدین (سوره بقره آیه 256) یکی از عباراتی است که معمولاً بسیار برداشت غلطی از آن می‌شود. تابحال دیده نشده است کسی این آیه را منسوخ اعلام کرده باشد.  در این نوشتار به توضیح این برداشتهای غلط پرداخته نخواهد شد، بلکه تنها نشان داده خواهد شد که وجود این آیه با جهاد ابتدائی، تناقضی ندارد.

سوره بقره (ماده گوساله) آیه 256

لاَ إِكْرَاهَ فِي الدِّينِ قَد تَّبَيَّنَ الرُّشْدُ مِنَ الْغَيِّ فَمَنْ يَكْفُرْ بِالطَّاغُوتِ وَيُؤْمِن بِاللّهِ فَقَدِ اسْتَمْسَكَ بِالْعُرْوَةِ الْوُثْقَىَ لاَ انفِصَامَ لَهَا وَاللّهُ سَمِيعٌ عَلِيمٌ.

در دين هيچ اجباری نيست هدايت از گمراهی مشخص شده است پس هر کس که به بت کفر ورزد و به خدای ايمان آورد ، به چنان رشته استواری چنگ زده که گسستنش نباشد خدا شنوا و داناست.

حمله کردن به کشورهای دیگر به معنی این نیست که مسلمانان غیر مسلمانان را بطور مستقیم مجبور به اسلام آوردن کنند، بلکه همانطور که گفته شد بر اساس شریعت اسلام اگر جهاد علیه کفار اهل کتاب باشد (یهودیان، مسیحیان و شاید زرتشتیان) مسلمانان سه امکان جنگ، پرداختن جزیه و اسلام آوردن را در مقابل آنها میگذارند و اگر جنگ علیه کفار دیگری باشد، آنها تنها حق جنگیدن و یا مسلمان شدن را خواهند داشت. از نظر قرآن و اسلام، جزیه خواستن از غیر مسلمانان و تحمیل حکومت و سلطه اسلام بر آنان، مجبور کردن آنها به قبول اسلام نیست. بنابر این از نظر قرآن اجباری در دین آوردن نیست اما همانگونه که گفته شد بسیاری از فقها و مسلمانان برقراری سلطنت اسلام و نابودی هر چیزی که جایگزین اسلام و الله شود (یعنی طاغوت) ضروری و واجب است و مسلمانان حق دارند برای برقراری یا در دفاع از حکومت اسلامی کفار را بکشند.

پرداختن جزیه به این معنی است که مرتبه کفار به اهل ذمه تبدیل میشود. اهل ذمه کفاری هستند که زیر سلطه اسلام زندگی میکنند. تاریخ نشان میدهد که زندگی زیر سلطه اسلام برای نامسلمانان از دردناکترین و وحشتناکترین انواع همزیستی ها است، بسیاری از قوانین حاکم بر غیر مسلمانان در کشورهای اسلامی بعد از حمله اعراب به آن کشورها بر اساس سندی تاریخی با نام وثیقه (سند) عمر مشخص شده است، غیر مسلمانان باید این قوانین را قبول میکردند و عدم قبول این شرایط غیر انسانی برای آنها برابر با امضاء کردن حکم مرگشان بوده است. یعنی به عبارت دیگر درست است که تیغ را بر گردن کافر اهل کتاب بگذارند و بگویند یا مسلمان شو یا بمیر، بلکه او را به نوعی برده در سرزمین خود تبدیل میکنند که در دراز مدت مجبور میشود برای اینکه بتواند مانند بقیه زندگی کند خود اسلام  را با زبان خوش قبول کنند، لذا اسلام بطور مستقیم خود را به کسی تحمیل نمیکند، اما بطور غیر مستقیم چیزی جز نسل کشی و نابودی دگر اندیشان را نتیجه نمیدهد، تنها بعد از یکی دو نسل، مردم اهل ذمه یا تصمیم میگیرند که از دیارشان مهاجرت کنند و در جاهای دیگر سکنی گزینند و یا اینکه مفلوکانه در شرایط نژاد پرستانه، نابرابر و غیر انسانی که مسلمانان بوجود می آورند زندگی کنند و به تدریج نسلشان منقرض شود.

اما ا گر جهاد علیه کفار غیر اهل کتاب باشد، مثلاً علیه هندو ها، بودائی ها و بیخدایان باشد، آنان از آن سه انتخاب یکی را از دست خواهند داد و آنهم جزیه دادن و اهل ذمه شدن است. یعنی این افراد یا باید اسلام را قبول کنند یا بمیرند. نمونه ای از این برخورد را پیامبر اسلام در زمان خودش با مشرکین مکه انجام داده است. لذا از نظر اسلام در جهاد، کافری که اهل کتاب نیست یا باید مسلمان شود و یا بمیرد، حال قضاوت با شماست، اگر به کسی بگویید فلان کار را بکن و یا تو را میکشم، آیا او را مجبور به انجام آنکار کرده اید یا نه؟

نتیجه آنکه بنابر این از دیدگاه اسلامی به این پرسش باید پاسخی منفی داد و از لحاظ تاریخی و واقعی پاسخی مثبت، اسلام اگر توانایی اش را داشته باشد و قدرتمند باشد خود را بطور مستقیم و غیر مستقیم به دیگران تحمیل خواهد کرد.

نتیجه گیری

گمان نمیکنم  با توجه به داده هایی که در این نوشتار به آنها اشاره شده است، شکی وجود داشته باشد که در اسلام جهاد به رسمیت شناخته میشود و جهاد تنها امری دفاعی نیست و کسانی که این مسئله را رد میکنند یا نادان و بی اطلاع هستند یا بی صداقت و انسانزده.

زشتی و پلیدی جهاد اسلامی آنقدر زیاد است که شایسته است یک انسان خردگرا و اخلاقمدار تنها به همین دلیل اسلام را کنار بگذارد و خط بطلان بر روی این نظام سیاسی انسان ستیز و متجاوز به حقوق بشر و آزادی های دینی که هر انسانی بر اساس اطلاعیه جهانشمول حقوق بشر سازمان ملل متحد حق برخورداری از آن را دارد بکشد.

منابع و توضیحات

1) توبة 24، حج 78، فرقان 52 ، ممتحنة 1 ، نساء 95 ، محمد 31 ، بقرة 218 ، آل‌عمران 142 ، نساء 95 ، مائدة 35 ، مائدة 54 ، أنف 72 ، أنف 74 ، أنف 75 ، توبة 16 ، توبة 19 ، توبة 20 ، توبة 41 ، توبة 44 ، توبة 73 ، توبة 81 ، توبة 86 ، توبة 88 ، نحل 110 ، عنكبوت 6 ، عنكبوت 8 ، عنكبوت 69 ، لقمان 15 ، محمد 31 ، حجرات 15 ، صف 11 ، تحريم 9.

2) Bell’s Introduction to the Quran, Revised by Montgomery Watt Chapter 1.

3) شریعتی، علی، جهت گیری طبقاتی اسلام، شرکت انتشارات قلم، تهران 1380، برگ 15.

4) محقق فریدنی، عباس، خوارج از دیدگاه امام علی (ع)؛ انتشارات انصاریان، قم 1383، برگ 47.

5) همانجا برگ 31.

6) تاریخ طبری، پوشینه 5، برگ 1103.

7) عبدالله یوسف اعظم، در اینجا

8) جدول تهیه شده ترجمه ای است از نوشتار در این صفحه، نام برخی از شهر ها به دلیل باستانی بودنشان تنها از روی ترجمه تحت اللفظی انگلیسی یا تلفظ آن نوشته شده است در حالی که ممکن است معادل فارسی یا عربی نیز برای آنها وجود داشته باشد.

9) مصباح یزدی، محمد تقی، جنگ و جهاد در قرآن، مرکز انتشارات موسسه آموزشی و پژوهشی امام خمینی، قم 1383، برگ 139.

10) همانجا برگ 151.

11) مطهری، مرتضی، جهاد، انتشارات صدرا، تهران بهمن 84، برگ 58.

12) همانجا برگ 81.

13) Mawdudi, S. Abul A’la, The Meaning of the Qur’an, (Islamic Publications Ltd., Lahore, 1993 edition), vol 2, page 183.

14) نامه ها و پیمانهای سیاسی حضرت محمد و اسناد صدر اسلام، تحقیق و گرد آورده دکتر محمد حمیدالله ترجمه دکتر سید محمد حسینی. کتاب سال 1375 چاپ انتشارات سروش 1377. صفحه 529.

15) دو قرن سکوت، چاپ جدید صفحه 65-66 برگرفته از البدء و التاریخ، ج 5، ص 173 – و طبری، حوادث سنه 14.

16) سوره بقره (ماده گوساله) آیه 254، سوره بقره (ماده گوساله) آیه 229.

17) http://www.islam101.com/quran/maududi/i009.htm

18) در واقع سه نظر مختلف در این مورد که آخرین سوره به اصطلاح «نازل» شده قرآن کدام است وجود دارد. برخی سوره توبه، برخی سوره نصر یا مائده را آخرین سوره های قرآن دانسته اند، اما حتی درصورتیکه سوره توبه آخرین سوره قرآن نباشد نیز به احتمال بسیار بالا از آخرین سوره های قرآن است و سوره مهمی بعد از آن نیامده است که بخواهد آنرا نسخ کند، اما اکثر علمای اسلامی معتقدند این سوره آخرین سوره نازل شده بر محمد است.

19) ترجمه ناشناس تفسیر جلالین http://ourworld.compuserve.com/homepages/ABewley/tawba1.html

20)  ابن کثیر، جلد چهارم، صفحه 377.

21) ترجمه ناشناس تفسیر جلالین http://ourworld.compuserve.com/homepages/ABewley/tawba1.html

22) Mawdudi, S. Abul A’la, The Meaning of the Qur’an, Entry on Surah Al-Tawbah.

23)  ترجمه تفسیر المیزان جلد 9 صفحه 202 سطر 14.

24) سخنان آیت الله خمینی در مورد یهود بنی قریظه

25) مطهری، مرتضی، انتشارات صدرا، جهاد برگ 90.

26) اسپنسر، رابرت، «چگونه جهاد اسلامی هنوز امریکا و غرب را تهدید میکند»، Regnery Publishing, Inc., 2003، برگ 168.

27)  ترجمه تفسير الميزان جلد 9 صفحه 552.

از کجا میدانید خدا وجود ندارد؟

نویسنده – آرش بیخدا

پاسخ کوتاه:

به دلیل اینکه دلیل معتبری برای وجود خدا وجود ندارد و دلایل معتبری برای عدم وجود خدا وجود دارند. بنابر این اعتقاد داشتن به وجود خدا نامعقول است.

پاسخ بلند:

پاسخ روشن و درست به این پرسش رایج، نیازمند طرح چند پیشگفتار است:

پیشگفتارها

پیشگفتار نخست، تعریف خدا

پیش از هر بحثی پیرامون خدا بایسته است که تعریفی از خدا ارائه شود، خدایی که در این نوشتار در مورد آن بحث میکنیم در نوشتار دیگری با فرنام خداوند چیست؟ معرفی و تعریف شده است.

پیشگفتار دوم، تفاوت باور و دانش

میان دانستن چیزی و باور داشتن به چیزی تفاوتی مهم وجود دارد. تفاوت در این است که ممکن است کسی به گزاره ای غلط  (گزاره چیست؟) باور داشته باشد، اما کسی نمیتواند دانش به چیز غلطی داشته باشد. برای نمونه میتوان باور داشت که زمین گرد نیست، اگرچه این باور غلط است. اما نمیتوان دانست که زمین گرد نیست.

بعبارت دیگر وقتی گفته میشود:

شخص A به p باور دارد.

درباره خود p هیچ چیز گفته نشده است، ولی وقتی گفته میشود:

شخص A نسبت به p دانش دارد یا p را میداند

در واقع بصورت نهانی گفته ایم که «p» درست است.

پیشگفتار سوم، تفاوت نفی و انکار

در زبان عامیه معمولاً از واژه «رد» هم برای «نفی» و هم برای «انکار» استفاده میشود ولی این واژه به اندازه کافی گویا نیست زیرا میان «نفی» و «انکار» در فلسفه تفاوت وجود دارد، هرچند هم به انکار کردن و هم به نفی کردن، رد کردن گفته میشود.

فرق میان نفی و انکار این است که انکار تنها به معنی نپذیرفتن یک گزاره است ولی نفی افزون بر نپذیرفتن یک گزاره اثبات عکس آنرا نیز شامل میشود. برای نمونه فرض کنید شخصی به نزد شما می آید و به شما میگوید که پزشک است و مایل است به شما در مسئله ای پزشکی کمک کند و شما برای اثبات پزشک بودن از وی مدرکی میخواهید. او نیز مدرکی به شما ارائه میدهد، حال دو سناریوی زیر را تصور کنید.

  1. سناریوی نخست انکار – شما مدارک طرف را بررسی میکنید ولی احتمال میدهید که این مدرک را خود طرف چاپ کرده باشد و مدرکی اصل نباشد، به همین دلیل به دلیل کمبود شواهد پزشک بودن او را رد میکنید، یعنی در اصل پزشک بودن وی را انکار میکنید.
  2. سناریوی دوم نفی- شما مدارک طرف را بررسی میکنید و علاوه بر اینکه احتمال میدهید که این مدرک را خود طرف چاپ کرده باشد و مدرکی اصل نباشد، یک غلط روشن نیز در این مدرک پیدا میکنید، مثلاً متوجه میشوید که مدرک از دانشگاهی است که میدانیم وجود ندارد، یا اینکه مدارکی دال بر اینکه این فرد در آن دانشگاه حضور نداشته پیدا میکنید. در این حالت نه تنها شما پزشک بودن طرف را انکار کرده اید بلکه آنرا نفی نیز کرده اید یعنی عکس آنرا اثبات کرده اید و قادر بودید اثبات کنید که مدرک تحصیلی وی معتبر نیست.

همانطور که گفته شد در زبان عامیانه به هر دو سناریوی بالا «رد کردن» گفته میشود.

پیشگفتار چهارم – انواع دیدگاه ها در مورد وجود یا عدم خدا

در مورد خدا افراد مختلفی میتوانند ادعای عدم یا وجود کنند، یعنی ممکن است افرادی بگویند خدا وجود دارد، و افرادی بگویند خدا وجود ندارد، اما وقتی از آنها پرسیده شود که این ادعای آنها مبتنی بر باور است یا دانش، چون دو متغییر پدید می آیند بر اساس جبر بولی چهار حالت مختلف قابل تصور است، لذا چهار موضع نسبت به وجود خدا قابل تصور است.

این چهار حالت از در جدول زیر معرفی شده اند:

دیدگاه وجود یا عدم؟ (بیخدایی یا خداباوری؟) دانش یا باور؟ (ندانمگرایی یا دانمگرایی)
وجود خدا قطعی، ممکن یا محال؟
نام باور
1- خدا وجود دارد و ما میدانیم که خدا وجود دارد وجود دانش به وجود خدا قطعی خداباوری (Gnostic Theism)
2- خدا وجود دارد ولی ما نمیدانیم که خدا وجود دارد وجود باور به وجود خدا ممکن خداباوری ضعیف (Agnostic Theism)
3- خدا وجود ندارد و ما میدانیم که خدا وجود ندارد عدم دانش به عدم خدا محال بیخدایی مثبتگرا، بیخدایی قوی  (Gnostic Atheism)
4- خدا وجود ندارد ولی ما نمیدانیم که خدا وجود ندارد عدم باور به عدم خدا ممکن ندانم گرایی، بیخدایی منفی گرا، بیخدایی ضعیف (Agnostic Atheism)

باورمندان هر یک از این چند گروه در طول تاریخ تفکر ادله و استدلالهایی برای اثبات باورهای خود بر جای گذاشته اند،‌ این مجموعه تفکرات و اندیشه یا براهین را نیز میتوان به چهار دسته تقسیم کرد:

  1. براهین خداباوری،‌ براهینی که در دفاع از وجود خدا گفته میشوند
  2. براهین بیخدایی، براهینی که در دفاع از عدم خدا گفته میشوند

پیشگفتار پنجم – بار اثبات هریک از دیدگاه ها در مورد وجود یا عدم خدا

بر اساس این اصل که بار اثبات هر گزاره بر گردن مدعی آن گزاره هست، هر فردی که یکی از مواضع چهارگانه نسبت به وجود یا عدم خدا را اتخاذ کند بار اثباتی بر گردن دارد. از آنجا که هریک از مواضع چهارگانه با سه موضع دیگر از یک سو بر سر وجود یا عدم و از سوی دیگر بر سر دانش یا باور متناقض هستند، منطقاً تنها یکی از آنها میتواند درست باشد. حال بر اساس این تفاوت هریک از مدعیان چهارگانه بارهای اثبات مختص خود را بر گردن دارند:

هواداران دیدگاه 1- کسانی هستند که میگویند خدا وجود دارد و ما میدانیم که خدا وجود دارد، باید عدم خدا را نفی کنند یعنی وجود خدا را اثبات کنند. پس باید از براهین خداباوری دفاع کنند و براهین بیخدایی را رد کنند.

هواداران دیدگاه 2- کسانی هستند که میگویند خدا وجود دارد ولی ما نمیدانیم که خدا وجود دارد. باید وجود و عدم خدا را انکار کنند، و دلیلی ارائه دهند که به فرض ناممکن بودن اثبات وجود یا عدم خدا چرا باید به وجود خدا باور داشت، پس باید براهین بیخدایی و براهین خداباوری را رد کنند.

هواداران دیدگاه 3- کسانی هستند که میگویند خدا وجود ندارد و ما میدانیم که خدا وجود ندارد. باید وجود خدا را نفی کنند یعنی عدم خدا را اثبات کنند. باید از براهین بیخدایی دفاع کنند و براهین خداباوری را رد کنند.

هواداران دیدگاه 4- کسانی هستند که میگویند خدا وجود ندارد ولی ما نمیدانیم که خدا وجود ندارد. باید وجود و عدم خدا را انکار کنند، و دلیلی ارائه دهند که به فرض ناممکن بودن اثبات وجود یا عدم خدا چرا باید به عدم خدا باور داشت، پس باید براهین بیخدایی و براهین خداباوری را رد کنند.

اکنون روشن است که بیخدایی دو گونه دارد

  1. بیخدایی مثبت گرا
  2. بیخدایی منفی گرا

در تارنمای زندیق دیدگاه های هردو موضع مطرح میشوند.

دفاع از بیخدایی منفی گرا

خداناباوران منفی گرا منکر وجود خدا هستند اما لزوماْ‌ وجود او را نفی نمیکنند،‌ زیرا باور دارند برهان خداباور درستی وجود ندارد. باور به عدم وجود یک چیز در صورتی که اثبات درستی برای آن چیز وجود نداشته باشد رفتاری خردپسندانه است. برای نمونه:

فرض کنید شخصی ادعا کند که در جهان «اسب شاخدار نامرئی» وجود دارد. آیا کسی میتواند عدم وجود چنین موجودی را ثابت کند؟ اما بیهوده نیست اگر اشخاصی که مخاطب این ادعا قرار میگیرند، به دلیل عدم وجود دلایل منطقی و اسناد و یا شواهد معتبر وجود چنین پدیده ای را انکار کنند.

برای انکار وجود یک چیز اقامه برهان ضرورتی ندارد همین که برهان درستی برای اثبات آن چیز وجود نداشته باشد معمولاْ کافی است که باور به وجود آن چیز را غیر معقول دانست. بنابر این خداباوران منفی گرا بار اثباتی بر گردن ندارند مگر اینکه اثبات کنند براهین خداباوری درست نیستند.

همانطور که در مثال «اسب شاخدار نامرئی» بر منکر شایسته است که اگر کسی دلیل و مدرک و یا برهان درستی برای اثبات وجود چنین موجودی کند به سخن او گوش کند و برهان او را رد یا قبول کند.

در تارنمای زندیق بخشی با فرنام رد براهین اثبات وجود خدا وجود دارد که در آن به نقد و رد براهین معروف خداباوری پرداخته میشود، اگر کسی تمامی براهین خداباوری را باطل بداند آنگاه وی را میتوان یک بیخدای منفی گرا دانست.

دفاع از بیخدایی مثبت گرا

خداناباوران مثبت گرا منکر وجود خدا را نفی میکنند. بیخدایان مثبت گرا باور دارند که نه تنها براهین اثبات وجود خدا همگی نادرست هستند بلکه میتوان دلایل معتبری را در اثبات عدم وجود خدا اقامه کرد. بنابر این بار اثبات بیخدایی مثبت گرا سنگین تر است چون شامل اقامه براهینی برای اثبات عدم وجود خدا نیز میشود.

گاهی پرسیده میشود که آیا اثبات عدم وجود یک چیز ممکن است؟ بلی گاهی ممکن است،‌ برای نمونه:

فرض کنید شخصی از شما بپرسد که آیا در جهان «اسب شاخدار نامرئی صورتی» وجود دارد؟‌ شما شاید ندانید که اسب شاخدار وجود دارد یا نه،‌ اما میدانید بین نامرئی بودن و رنگ داشتن تناقض است بنابر این معقول است که موضع نفی را اتخاذ کنید. چنین اسب متناقضی محال است همانطور که مثلثی چهارگوش وجود ندارد.

براهین بیخدایی مثبت گرا معمولاْ‌ بر اصل تناقض تکیه میکنند، یعنی نشان میدهند وجود خدا در تناقض با حقایق دیگری است. تارنمای زندیق بخشی با نام براهین اثبات عدم وجود خدا را به بیان و تقریر براهین بیخدایی اختصاص داده است.

اگر قصد دارید با بیخدایی بیشتر آشنا شوید از بخش بیخدایی گام به گام تارنمای زندیق دیدن کنید.

شما حق ندارید به عقاید مردم توهین کنید!

نویسنده – آرش بیخدا

آیا باید به مقدسات مردم احترام گذاشت؟

پیشگفتار

اینکه نباید به مقدسات توهین کرد و نباید به دین مردم کاری داشت سخنی است که شبانه روز از مسلمانان، اسلامگرایان و سمپاتهای ایشان میتوان شنید. قبل از نوشتن این نوشتار واژه «توهین» را در گوگل جستجو کردم، از 20 مورد نخست، 9 مورد در مورد «توهین به مقدسات» بود.  البته بیشتر اوقات وقتی کسی میگوید به مقدسات مردم توهین نکنید منظورش این است که به مقدسات من توهین نکنید، برخی آدمها علاقه دارند خود را پشت نامهای بزرگتر مخفی کنند. افزون بر این باید توجه داشت که دین مال التجاره طبقه ملایان است و آنان نیز همانند دیگر کسبه مایل نیستند کسی به محصولشان اهانت کند چرا که این اهانت ممکن است رونق را از بازار کار ایشان بگیرد.

هدف من در این نوشتار نقد این ایراد و انتقاد است، من معتقدم درخواست احترام به مقدسات درخواست بیجایی است و اساساً احترام به مقدسات اسلامی کاری غیر اخلاقی و نادرست است. افزون بر این معتقدم مسلمانان در پس این درخواست چیزهای دیگری را میطلبند که کاملاً نابجا و نا عادلانه هستند. در این نوشتار ابتدا مفاهیم قداست و اهانت را بطور مختصر معرفی خواهم کرد، سپس به این پرسش پاسخ خواهم داد که آیا باید به مقدسات اهانت کرد یا نه، در بخش بعدی توضیح خواهم داد که چرا این مسئله برای مسلمانان اینقدر اهمیت دارد، پس از آن نشان خواهم داد که مسلمانان خود احترامی برای دیگران قائل نیستند، و در پایان توضیح خواهم داد که در چه صورتی مسلمانان میتوانند برای خود احترام کسب کنند.

پیش از آغاز نوشتار بد نیست به این مسئله اشاره شود که اینطور باید و نباید ها یا میتوانند حقوقی باشند یا اخلاقی. بنابر این از کسی که میگوید به مقدسات نباید توهین کرد باید پرسید که این باید حقوقی است یا اخلاقی؟ به این معنی که آیا او میگوید بر اساس قوانین نباید به مقدسات توهین کرد یا اینکه میگوید از نگر اخلاقی خوب نیست که به مقدسات توهین کرد یا خوب است که به مقدسات احترام گذاشت. در کشوری که من در آن زندگی میکنم اهانت به اسلام جرم نیست، و در بیشینه کشورهای متمدن نیز همینگونه هست. اما در دیدگاه من اخلاق جایگاه بالاتری از قانون دارد یعنی اگر کاری اخلاقی باشد بهتر است اگرچه خلاف قانون باشد آنکار را یک حق شمرد، و اگر کسی کاری را انجام داده است، این توجیه که «اینکار حق من بوده است» کافی نیست، بلکه باید دلیلی اخلاقی نیز ارائه شود. فرض کنید قانوناً در کشوری موظف باشید گردن کسی که در جمع خمیازه میکشد را بزنید، آیا از این قانون پیروی خواهید کرد؟ در چنین مواردی بحث اخلاقی در مورد این باید و نباید ها اهمیت پیدا میکند و موضوع این نوشتار نیز از همان دست موارد است. لذا روشن شد که قانوناً اهانت به اسلام حق من و سایر ساکنین کشورهای متمدن است، ولی بر اساس قوانین کشورهایی که قوانین اسلامی در آنها رواج دارند اهانت به اسلام جرم است و چنین حقی وجود ندارد و این موضوع نسبتاً ساده ای است. اما بحث اخلاقی کمی پیچیده تر است و در اصل این نوشتار به بررسی اخلاقی این قضیه میپردازد. روشن است که اگر اخلاقاً اهانت به اسلام خوب باشد و یا احترام گذاشتن به اسلام بد باشد (این دو گزاره لزوماً یکسان نیستند)، من توصیه میکنم که اگر حتی اینکار غیر قانونی باشد، یک حق فرض شده و به آن احترام گذاشته شود، یعنی من اگر ساکن ایران هم بودم تنها به دلیل اینکه قانون میگوید به اسلام باید احترام گذاشت، حاضر به احترام به اسلام نمیشدم. همانطور که توصیه میکنم گردن کسی را به علت خمیازه کشیدن نباید زد حتی اگر در قوانین کشوری باشد که در آن ساکنید.

من متوجه این واقعیت هستم که بسیاری از خوانندگان حوصله خواندن مطالب بلند را ندارند، از این رو به چنین خوانندگانی توصیه میکنم تنها بخش «آیا اسلام و مسلمانان هم به دیگران احترام میگذارند؟» از این نوشتار را مطالعه کنند.

مقدسات چه هستند؟ اهانت چیست؟

به نظر میرسد هم مقدسات هم اهانت ها هردو مسائل فرهنگی هستند که هر اجتماعی برای خود مصداقهای متفاوتی از آنها را تعریف میکند. بنابر این هردو این مقوله ها تابع جای و گاه هستند و نمیتوان تعریفی از آنها ارائه داد که تابع یک جمعیت مشخص نباشد. البته این به خودی خود به آن معنی نیست که نمیتوان مصادیقی از چیزهای مقدس و رفتار یا گفتار اهانت آمیز پیدا کرد که همه جا کسری از مردم آنها را مقدس یا اهانت آمیز میدانند.

مقدسات چه هستند؟  به نظر نمیرسد تعریف جهانشمول و دقیقی از مقدسات وجود داشته باشد که تابع جای و گاه نباشدد. یک نویسنده مسلمان نیز به همین واقعیت اینگونه اشاره کرده است:

قانونگذار از مقدسات تعریفی ارائه نداده است و در منابع فقهی و حقوقی نیز غیر از ذکر مصادیق، تعریفی روشن بیان نگردیده است. در کتب لغت نیز تعریف مقدسات در هاله ای از ابهام است و فقط به تعریف از مفرد ان اکتفاء شده است.  (1)

با این حال روشن است که مقدسات تنها برای مسلمانان موضوعیت ندارد بلکه دیگران نیز مقدساتی دارند، لذا نزدیک ترین تعریف قابل تصور به مقدسات چنین است:

H برای جمعیت P مقدس است اگر آن جمعیت برای H ارزش و احترام فوق العاده قائل باشند و خواستار بزرگداشت و رفتارهای ویژه در قبال H باشند

به نظر میرسد هریک از اجتماعات انسانی برای خود مقدساتی داشته اند، برای نمونه گاو در میان سایر حیوانات برای برخی هندوها موجودی مقدس است، یعنی آنها برای گاو ارزش و احترام خاصی قائل هستند و خواستار احترام ویژه به گاو هستند، یعنی خواستار این هستند که با گاو مانند دیگر حیوانات برخورد نشود. نمونه های دیگر را نیز میتوان در بسیاری از اقوام و نژادها و فرهنگ ها یافت، سرخپوستهای آزتک ذرت را مقدس میدانستند، برخی سلت ها آب را مقدس میدانستند و ماهی نمیخوردند، مصریان باستان هم گربه ها را مقدس میدانستند. در بیشتر جاها پرچم کشور و سمبل های ملی برای کسری از مردم بخشی از مقدسات هستند.

ممکن است تصور کنید آنچه برای اجتماع ما مقدس است واقعاً ارزشی بالاتر از مقدسات جوامع دیگر دارند، ولی خوب این تصور در جوامع دیگر نیز نسبت به مقدسات ما وجود دارد.  پرسشی که در اینجا مطرح میشود این است که از نظر مسلمانان مقدسات اسلام چه چیزهایی هستند؟ یک نویسنده مسلمان به این پرسش اینگونه پاسخ داده است:

نخستین چیزی که از مقدسات اسلام در ذهن می‌اید «اشخاص و مفاهیمی است که بايستي محترم شمرده شده و از گزند استهزاء و اهانت در امان و مصون باشند» بدون شک ذات باری تعالی اولین مصداق روشنی است که پاکتر و منزه‌تر از او در آموزهای دینی وجود ندارد «سبحان الله عما یصفون» پیامبران و پیشوایان دین و دیانت و سمبل های بشری نیز در زمره‌ی مقدسات دینی قرار می‌گیرند که باید از هرگونه تحقیر و توهین در امان باشند. هم چنین مقدسات، شامل اماکن نیز می‌گردد همانند کعبه، مزار امامانك قرآن، نهج البلاغه و شخصیت‌های مورد احترام همچون حضرت ابوالفضل العباس، علی اکبر، حمزه و… هم‌چنين شخصیت‌های سایر مذاهب که از نظر مسلمانان واجب التعظیم اند همانند حضرت هاجر، مریم مقدس و… (2)

تجربه شخصی من نشان میدهد که هرگاه چیزی مقدس خوانده میشود آن چیز «بو دار» و مشکوک است و دارای ضعف های بسیار است از همین رو میخواهند با تقدیس، آنرا از انتقاد و رسوایی مصون دارند. قانون جاذبه برای هیچ کس مقدس نیست، چون مسئله دو دو تا چهارتا است، کسی نیاز ندارد روزی هزار بار بگوید جاذبه صحیح است! و حرکات مسخره از خود نشان بدهد و مثلاً روزهای سه شنبه ماتحت خود را به سوی آسمان بگیرد و به خود تلقین کند که «جاذبه اکبر»! اما وقتی چیزی تقدیس میشود و اهمیت و بزرگی آن مکرراً تکرار میشود و مدافعان آن در بیان باور خود به آن بسیار تظاهر میکنند و برای پاسداشت آن حرکات غیر عادی و مسخره انجام میگیرد انسان هوشمند باید بداند که در اینجا کاسه ای زیر نیم کاسه است! کسی دارد چیزی را پنهان میکند و کسانی دارند از این پنهانکاری سود میبرند! واقعیت غیر قابل انکار یا دستکم اثبات پذیر و محکم نیازی به تقدیس و تظاهر ندارد! بنابر این تقدیس و شیادی معمولاً همراه هم هستند.

اهانت چیست؟ همچون مقدسات تعریف اهانت نیز دقیق و جهانشمول نیست و تابع جای و گاه است، نزدیک ترین تعریف قابل تصور برای اهانت چنین است:

رفتار یا گفته B برای جمعیت P اهانت آمیز است، اگر بر اساس آداب و سنن و نرمهای رایج در میان آن جمعیت، B غیر محترمانه باشد یا به عبارت دیگر در شان چیزی که به آن اهانت میشود نباشد

هر اجتماعی برای خود اهانت  های مختلفی دارد. در میان چینی ها آروغ نزدن بعد از غذا خوردن اهانت به میزبان است، در میان ایرانیان نشستن با پاهای دراز روی زمین در جمع اهانت آمیز است، در میان ایرانیان نشان دادن انگشت شست به دیگران اهانت آمیز است، در میان برخی از فرهنگ ها نشان دادن کف دست به طرف مقابل اهانت آمیز است. در میان آنگلوساکسونها نشان دادن انگشت میانه به طرف مقابل بسیار اهانت آمیز است. افزون بر این نمونه ها، نمونه هایی هم وجود دارند که همه جا اهانت حساب میشوند، مثلاً تف انداختن یا فحش دادن در هر جامعه ای دستکم برای کسری از مردم اهانت محسوب میشود.

حال پرسش این است که چه چیزی در نظر مسلمانان توهین به مقدسات محسوب میشود؟ نویسنده مسلمان در این مورد نوشته است:

اهانت در ماده‌ی فوق، اعم است از نسبت دادن صریح الفاظ رکیک و یا هر فعل و ترک فعلی که در نظر عرف موجب وهن و تحقیر طرف گردد. توهین شامل گفتار، کردار، کتابت و حتی اشاره‌ی صریح است. به طور مثال اگر کسی در عاشورا لباس شادی به تن کند و یا به شادی و هلهله بپردازد مشمول ماده مزبور قرار می‌گیرد.

اما در مورد ترک فعل مثلا صلوات نفرستادن بر پیامبر از روی عمد و توهین، ایا مشمول ماده، قرار می‌گیرد یا خیر؟ در این جا بین حقوقدانان تفاوت نگاه و نظر وجود دارد؛ نظر برخی بر این است که برای ترک فعل، نمی‌توان مجازات، قایل شد، هر چند که به قصد توهین باشد. (3)

روشن است که اگر کسی حرفهای بسیار رکیک جنسی به پیامبر اسلام بزند این کار او هم از نظر مسلمانان هم از نظر هر انسان منصف دیگری فحاشی و در نتیجه اهانت حساب میشود، ولی آنچه عجیب است این است که مسلمانان استانداردهای عجیب و غریبی برای اهانت در میان خود دارند. همانطور که خواندید برای نمونه لباسی با رنگ شاد پوشیدن در ماه محرم اهانت به مقدسات حساب میشود (!)، تحقیر مقدسات نیز مصداقی از اهانت به مقدسات است، یعنی یک نامسلمان نباید حقارت و پستی و نقصانی را به مقدسات اسلامی نسبت بدهد. شوربختانه تعریف اهانت گویا در میان مسلمانها به این استاندارد مسخره و کاملاً غیر عادلانه نیز محدود نیست، حتی خود مسلمانان نیز گاهی تنها بخاطر بیان یک دیدگاه به اهانت به اسلام محکوم شده اند.  برای نمونه مجتهد شبستری یکی از متفکرین مسلمان و اصلاح طلب در یکی از سخنرانی های خود مسئله عصمت پیامبران و امامان را انکار کرده بود (4) و اسلامگرایان به همین سبب وی را متهم به اهانت به پیامبر اسلام کردند، برای نمونه آیت الله خاتمی به نقل از روزنامه حکومتی کیهان مورد وی گفته است:

آیت الله سیداحمد خاتمی نماینده مردم کرمان در مجلس خبرگان رهبری سه شنبه گذشته در جمع هیئت های مذهبی و اقشار مختلف مردم و عزاداران پیامبراعظم این شهر با اشاره به توهین محمدمجتهد شبستری از روشنفکران دوم خردادی به ساحت مقدس پیامبر(ص) و ائمه اطهار(ع) گفت: این فرد سابقه اظهارات نادرست زیادی دارد و در گذشته گفته بود برای رشد و تعالی کشور راهی جز روی آوردن به دمکراسی غرب نداریم و باید دست از مبانی فقهی اسلام برداریم. وی که سابقه طلبگی داشت، خودش را خلع لباس کرد. خاتمی در ادامه با اشاره به گفته این روحانی نمای دوم خردادی در دانشگاه اصفهان که معصومیت پیامبر(ص) و ائمه اطهار (ع) را رد کرده است بیان داشت: جای بسی تعجب است، فردی که سابقه طلبگی دارد این چنین سست حرف می زند، عصمت پیامبر(ص) و ائمه اطهار (ع) از بدیهیات دینی است و این را آیات قرآن تصریح می کنند و از اعتقادات شیعه است. (5)

خبرگزاری حکومتی فارس در مورد خبری مرتبط نوشته است:

در پی تجمع اعتراض‌آمیز دانشجویان دانشگاه صنعتی اصفهان در واکنش به سخنان موهن مجتهد شبستری، دفتر انجمن اسلامی این دانشگاه که محل هتک حرمت به ساحت مقدس پیامبر اعظم(ص) بود پلمب شد. به گزارش خبرگزاری فارس از اصفهان، در پی هتاکی بی‌شرمانه محمد مجتهد شبستری در ظهر امروز جلسه انجمن اسلامی دانشگاه صنعتی اصفهان، در مسجد این دانشگاه سخنان وی با واکنش اعتراض‌آمیز تشکل‌های مختلف دانشجویی و نماز‌گزاران روبرو شد. در میان دو نماز بیانیه اعتراض آمیز معترضان به هتک حرمت پیامبر(ص) توسط یکی از دانشجویان قرائت شد و دانشجویان با امضا کردن متن این بیانیه خواستار واکنش فوری مسئولان دانشگاه به این مسئله شدند. (6)

همان خبرگزاری باز از قول امام جمعه دیگری میگوید:

حجت‌الاسلام و المسلمين مهدي رحماني امروز در گفتگو با خبرنگار فارس در اراك افزود: شبستري بايد مطالب و ادعاهاي خود را در جمع عالمان ديني كه هم اكنون در تخصص‌هاي گوناگون و در حوزه علميه قم و مشهد مقدس مشغول فعاليت هستند بيان مي‌كرد. وي با محكوم كردن سخنان مجتهد شبستري در توهين به ساحت مقدس پيامبر اكرم(ص) گفت: ايجاد شبهه و ترديد در ذهن دانشجويان جوان كار ناپسند و نادرستي است. امام جمعه كميجان با اشاره به مناظره شبستري با استاد مصباح يزدي خاطرنشان كرد: سخنان توهين‌آميز شبستري نشان مي‌دهد كه ايشان از مناظره با مصباح درس عبرت نگرفته و بايد با دقت افكار و كتب شهيد مطهري، حضرت امام (ره) را مطالعه كرده و در افكار خود تجديد نظر كنند. (7)

خبرگزاری حکومتی آفتاب در مورد خبری مرتبط نوشته است:

مجتهد شبستری همزمان با رحلت پیامبر گرامی‌اسلام با حضور در جمع دانشجویان دانشگاه صنعتی اصفهان با توهین به عصمت پیامبر گرامی ‌اسلام اظهار داشته بود که تنها رسالت پیامبر دعوت مردم به سمت خدا بوده و آنان تنها در این امر عصمت داشته‌اند و از لحاظ گناهان باتوجه به روایات معتبر و سخنان بر جای مانده از آنان نمی‌توان عصمت برایشان در نظر گرفت. وی همچنین در بخشهایی از سخنان خود پای را از این امر فراتر گذاشته بود و حتی قرآن و جنبه علمی ‌بودن آن را نیز زیر سوال برده بود. (8)

روشن است که اسلامگرایان با شدید ترین الفاظ شبستری را که خود مسلمان است به اهانت و هتک حرمت متهم کرده اند، اما آنچه از متن سخنرانی بر می آید همانطور که قابل پیشبینی است این است که کوچکترین واژه زشت یا تندی در آن بکار گرفته نشده است، بنابر این سخنان وی فحاشی نبوده است اما از نظر افراد یاد شده اهانت بوده است. این نمونه از رفتار اسلامگرایان نشان میدهد که مفهوم اهانت در میانشان وسیع تر از فحاشی است و فحاشی تنها یک نمونه اهانت است. روشن است که هرگونه انتقاد حتی نه به خود اسلام، بلکه به برداشت یک عده از اسلام از نظر ایشان یک اهانت حساب میشود.

نمونه دیگر سخنرانی پاپ بنديکت شانزدهم ، رهبر کاتوليک های جهان،در روز سه شنبه۱۲ سپتامبر ۲۰۰۶ ، در دانشگاه رگنزبورگ آلمان بود که وی در آن سخنرانی به نقل از سندی تاریخی از زبان يک امپراتور مسيحی قرن چهاردهم  به نام مانوئل دوم قسطنطنیه خطاب به یک مسافر ایرانی گفته بود:

محمد برای جهان فقط شرارت و اعمال غيرانسانی به ارمغان آورده و از جمله دستور داده که دين را با زبان شمشير گسترش دهيد.

این دیدگاه یک اهانت نیست، هیچ واژه زشتی در آن دیده نمیشود بلکه انتقادی است که هرکس مخالف با اسلام است ممکن است داشته باشد، ولی تنها «نقل» این جمله توسط پاپ باعث شد که بسیاری از مسلمانان پاپ را محکوم به اهانت به اسلام کنند. برای نمونه: دبير كل علماي مسلمان انگليس اهانت پاپ را عمدي دانست  (9) ، ائمه مساجد سني عراق اهانت پاپ به اسلام را محكوم كردند (10) طلاب حوزه علميه قم در اعتراض به اهانت پاپ به اسلام، تجمع كردند (11) و احمد الطیب رییس دانشگاه الازهر گفت: اظهارات موهن به قرآن از سوی پاپ بندیکت شانزدهم یکی از دلایل اصلی کند شدن روند مذاکرات و تعاملهای حسنه علمای اسلامی با واتیکان می باشد (12).

یکی دیگر از ماجراهای اخیر و مرتبط با این بحث در پاکستان اتفاق افتاد، ملایی با نام اسرار احمد حدیثی از یکی از معتبر ترین کتابهای اهل تسنن را خوانده بود تفسیر کرده بود و همین عمل او اهانت به امام علی و شیعیان تلقی شده بود و موجب اعتراضات گسترده شده بود. ماجرا به نقل از یک سایت شیعی از این قرار بود:

اسرار احمد كه خود را جانشين «ابوالاعلي مودودي» و حتي بالاتر از وي aمي‌داند و در عين حال، هيچ گونه تحصيلاتي در زمينه قرآن، حديث و تقسير ندارد، با استناد به حديثي جعلي در كتاب «سنن ترمذي» در يك برنامه تلويزيوني پيرامون آيه «ولا تقربوا الصلاة و انتم سكاري» گفت: روزي علي (ع) [نعوذ بالله] در حالت مستي در مسجد بر رسول‌الله (ص) وارد شد. حضرت از اين وضع ناراحت شد و آنگاه اين آيه نازل شد كه مسلمانان نبايد در حالت مستي نماز بخواند.  (13)

یعنی شیعیان اینکه علی قبل از تحریم شراب، شراب خورده است را اهانت به تشیع میدانند، حال آنکه این تنها یک دیدگاه تاریخی و مستند است. ممکن است بپرسید پس چرا این دسته از مذهبیون میگویند «به مقدسات ما توهین نکنید» و بجای آن نمیگویند «از برداشت و کاسبی ما از دین انتقاد نکنید»، این پرسش مرا متعجب خواهد کرد و از شما خواهم پرسید مگر نمیدانید که مبنای اسلام بر دروغ و دغل کاری و تغییر معنی کلمات و لفاظی و یاوه گویی و دو رویی است؟  اگر نمیدانید همین مسئله باید شما را از این واقعیت آگاه کند و اگر میدانید هم که نباید این پرسش برایتان مطرح شود.

تعریف کردن آنچه مقدس است و تعریف کردن دقیق اهانت، احترام و توضیح اینکه چرا باید به مقدسات احترام گذاشت موضوعی بسیار گسترده و پیچیده است و مسلمانان از تعریف آن همواره سر باز میزنند، برای نوشتن این نوشتار از آیت الله صانعی مرجع تقلید شیعه، ملایی که گمان همه بر آن بود که جانشین آیت الله خمینی شود ولی با دخالت باند رفسنجانی ولی فقیه نشد و یک ملای معمولی که حتی آیت الله هم نبود (خامنه ای) را جانشین او کردند، استفتاء کردم (14) و پرسیدم:

س- تعريف دقيق اهانت در شريعت چيست؟ چه زماني ميتوان گفت شخصي به پيامبر يا ائمه اهانت كرده است؟ آيا انكار نبوت، وارد كردن اتهام، طنز پردازي، انكار عصمت مصداق اهانت هستند يا خير؟ آيا منبعي كه بطور مشخص و دقيق اهانت را تبيين كرده باشد وجود دارد؟

پاسخ آیت الله این بود:

بسمه تعالي
با عرض سلام،
ج- موضوع اهانت، همانند بقيه موضوعاتي است كه تشخيص آن با عرف و مردم است و لذا هر عملي كه عرفاً مصداق اهانت نسبت به پيامبر و ائمه عليهم السلام محسوب شود، حرام و معصيت است و از گناهان كبيره مي باشد.

روشن است که آیت الله بخش دوم پرسش من را یا عمداً یا سهواً کاملاً نادیده گرفته است و توضیح نداده است که انکار نبوت، طنز پردازی و غیره مصداق اهانت هستند یا نیستند، بلکه این مسئله را به عرف نسبت داده اند، حتی در این قضیه نیز توضیح نداده اند که عرف چیست و چه کسی مرجع این است که بگوید عرف جامعه چیست؟ برای نمونه فرض کنید در کشور مراکش انتقاد کردن اهانت به شمار بیاید، حال بر اساس این دیدگاه انتقاد از اسلام در مراکش اهانت به اسلام خواهد بود، یا مثلاً فرض کنید راه رفتن بر روی چیزی در جایی اهانت نباشد، آنگاه راه رفتن روی قرآن در آنجا اهانت نخواهد بود! روشن است که عرف جوامع با یکدیگر بسیار متفاوت هستند و واگذاشتن چیزی که مجازاتش مرگ است به عرف کار بسیار ابلهانه ای است.

عرف جوامع مسلمان در دست آخوند است، اگر آخوند مسلمانان را تحریک کند آنها هر انتقاد و هر ایرادی به اسلام و حتی هر دگر اندیشی را میتوانند اهانت تلقی کنند، به همین جهت ملایان ترجیح میدهند بجای تعریف دقیق مقدسات، اهانت، و بی احترامی، این واژه ها را بطور کیلویی مصرف کنند چه اگر تعریف دقیقی از آنها ارائه دهند این تعریف دست و پا گیر خواهد بود و درخواست احترام به اسلام نابخردانه و ناعدلانه جلوه خواهد نمود. آنها ترجیح میدهند که بتوانند بطور دلخواه هرکسی را که مایلند محکوم به اهانت به اسلام کنند و هواداران خود را به جان او بیاندازند، این کار از لحاظ سیاسی برای آنها بهتر است تا اینکه معیار و خط کش دقیقی برای مسئله احترام و اهانت در اختیار همگان قرار دهند. افزون بر این، تعریف این مسائل بسیار دشوار و نیازمند تحلیل هایی است که بنیان دین و ایمان را زیر سوال خواهد برد از همین سو ملایان این سطحی نگری و یاوه گویی را ترجیح داده اند و توضیح دقیقی در مورد اهانت نداده اند. اما با اینکه باور کردن این قضیه سخت است (!) ملایان واقعاً معتقد هستند کسی حق ندارد علیه اسلام چیزی بگوید، چیزی بنویسد یا تبلیغی بکند! نه تنها کسی حق چنین کاری را ندارد بلکه در بلاد اسلامی کسی حق تبلیغ دین دیگری را نیز ندارد! آیا میتوان تصور کرد در قرن 21 ام جمعیتی اینقدر وحشی باشند؟! ملایان از گفتن اینکه کسی حق ندارد چیزی علیه اسلام بنویسد شرم ندارند! برای نمونه به سخنان آیت الله خمینی «تحریف واژه ها توسط خمینی، منظور از آزادی چه بوده است؟» نگاه کنید، منتها چون ملایان و اوباش تحت نفوذشان توانایی بیان صریح این مطلب را در این دوره و زمانه ندارند پشت این بهانه که «نباید به مقدسات توهین شود» مخفی میشوند، و الا دیدگاه آنان این است که کسی حق ندارد چیزی علیه اسلام بگوید یا بنویسد.

آیا باید به مقدسات توهین کرد؟

افزون بر مجتهد شبستری که شرحی کوتاه در مورد قائله آن در بالا آمد، ملایان و اسلامگرایان دیگری نیز محکوم به توهین به مقدسات شده اند، برای نمونه عبدالله نوری وزیر کشور رفسنجانی و خاتمی نیز در دادگاه به توهین به مقدسات محکوم شده بود (15). این واقعیت نشان میدهد که اسلامگرایان از اتهام «توهین به مقدسات» بدون اینکه در واقع اهانتی صورت گرفته باشد بصورت ابزاری برای خاموش کردن منتقدانشان استفاده میکنند. تجربه شخصی من نیز همین موضوع را تایید میکند، بارها برای من پیش آمده است که اسلامگرا یا مسلمانی به من معترض شده است که شما به مقدسات توهین میکنید. من نیز به آنها گفته ام که اگر به من نشان بدهند در کجای نوشتار من اهانتی صورت گرفته است ممکن است آنرا ویرایش کنم، در بیشینه موارد این معترضین طفره رفته اند و به دلیل اینکه حتی نوشتار من را نخوانده بودند قادر به نشان دادن واژگان توهین آمیز نبودند، در برخی موارد نیز البته مواردی ذکر شد که در بیشینه آنها بازهم آن واژه واقعاً توهین آمیز نبود. برای نمونه یکبار آخوندی اعتراض کرد که در نوشتار «آیا محمد دیوانه نیست؟» از واژه «دیوانه» برای محمد استفاده کرده ای، به او پاسخ دادم که این واژه را قرآن انتخاب کرده است و در چندین جا گفته است محمد تو «مجنون» نیستی، برگردان مجنون به پارسی نیز دیوانه است، با اینحال اگر واژه مناسبتری در ذهن داری میتوانی پیشنهاد کنی و من ممنکن است بپذیرم! در این مورد بخصوص هم آن شخص پاسخی نداشت. نتیجه آنکه اتهام توهین به مقدسات در بسیاری از موارد تنها یک بهانه بی مورد است برای پاک کردن صورت مسئله و خفه کردن منتقد اسلام.

باید به این واقعیت نیز توجه داشت که مسلمانان عادت به شنیدن سخنان منتقدین ندارند، چون اساساً تابحال مجالی برای مخالفت با اسلام وجود نداشته است، به دلیل توحش بالای مسلمانان منتقدین همواره دست به خود سانسوری میزده اند یا اینکه اگر لب به سخن باز میکردند، مرگ  پاسخ سخنان ایشان بوده است، به پاس وجود اینترنت و تکنولوژی غربی است که اکنون میتوان نسبتاً آزادانه تر از اسلام دفاع کرد. به همین جهت دلیل گوش مخاطبین مسلمان با سخنان انتقادی آشنا نیست و همواره و در تمام عمر خود تنها مدح و ستایش و چاپلوسی شخصیتهای دینی خود را شنیده اند و بیشینه مسلمانان اساساً اگر دسترسی به منابع منتقد اسلام هم داشته باشند آنقدر خرد و آزاد اندیشی ندارند که حتی آنها را مطالعه بکنند، لذا هر سخن انتقادی را اهانت میدانند.

اما در پاسخ به پرسش مطرح شده در این بخش باید گفت که بستگی به مقدسات و شیوه توهین دارد. فرض کنید برای افرادی گاو چیز مقدسی است، و خوردن گوشت گاو در آن فرهنگ اهانت محسوب میشود. آیا دیگران باید به این مقدسات احترام بگذارند و به آن توهین نکنند؟ به نظر نمیرسد هیچ انسان عاقلی پاسخی مثبت به این پرسش بدهد. حال فرض کنید همان جمعیت باورهای مضری برای اجتماع نیز داشته باشد، مثلاً افراد را بخاطر باورهای دینیشان تبعیض کنند و یا اینکه بخاطر جرائمی انسانهایی را زنده زنده بپزند، برای نمونه هندو ها که احترام خاصی برای گاو قائل هستند در گذشته بر اساس باورهای دینیشان همسر مردی که فوت میشد را زنده زنده میسوزاندند، این عمل که ساتی نام دارد عملی مقدس بود و هنوز هم برخی زنان هندو خود اینکار را انجام میدهند یعنی بدون دخالت دیگران بعد از مرگ همسر خود را به آتش میکشند (16). در اینصورت چطور؟ آیا باید به این جمعیت و مقدساتش اهانت نکرد و مثلاً گوشت گاو را بخاطر آنها نخورد؟ روشن است که پاسخ منفی است.

جمعیتی را فرض کنید که برای هویج احترام ویژه ای قائل هستند و آنرا مقدس میپندارند. تا اینجای کار ممکن است شما برای این جمعیت و افکارش احترام قائل باشید، البته من چنین احترامی را قائل نیستم چون من برای افکار نادرست احترامی قائل نیستم، ولی حال فرض کنید که افزون بر مقدس پنداشتن هویج، خوردن هویج را جرم میدانند و هویج خوران را میکشند. حالا چطور؟ آیا باید به این گروه و عقیده اش احترام گذاشت؟ هرگز!

در مورد اسلام هم قضیه از نظر برخی نامسلمانان همینگونه است. اسلام شامل یک سری باورهای مسخره و نابخردانه است، مثلاً باور به امام زمان، باور به داستانهای مسخره قرآن همچون طوفان نوح، قصه آدم و حوا، ماجراهای سلیمان، یونس، صالح و غیره مشتی باورهای نابخردانه و گاهی مضحک است، به همان میزان که احترام به هویج از نظر افرادی که عضو جمعیت فرضی بالا نیستند نابخردانه است، احترام گذاشتن به این مزخرفات نیز برای نامسلمانان نابخردانه است و احترام گذاشتن به اسلام یعنی احترام گذاشتن به حماقت. ممکن است برخی حاضر باشند برای مزخرفات و باورهای مسخره کودکانه که جدی گرفته میشوند احترام بگذارند ولی شوربختانه مسئله به اینجا ختم نمیشود. افزون بر نابخردانه بودن و مسخره بودن باورهای بالا این باورها مضر هم هستند؛ مسلمانان بخاطر همین مجموعه باورها دست به جنایات و کارهای زشت متعددی میزنند و روزگار خود و دیگران را بخاطر همین باورهای چرت است که سیاه کرده اند. احترام گذاشتن به اسلام و «مقدسات مردم» در صورتی که این مردم مسلمان باشند یعنی احترام گذاشتن به سنگسار، قصاص، جهاد، اعدام، زن ستیزی، همنجسگرا ستیزی، تبعیض دینی، تبعیض جنسی، و برده داری، و در یک کلام، بربریت، توحش و حماقت و نادانی آیا شما حاضرید به چنین چیزهایی احترام بگذارید؟ پاسخ به میزان مدنیت شما باز میگردد اگر مدنیت شما در حد مسلمانان باشد آنگاه شما میتوانید به این مفاهیم و مروج آن یعنی اسلام احترام بگذاری، ولی اگر میزان مدنیت شما بالاتر از مسلمانان است آنگاه شما همچون من هرگز حاضر نخواهید شد که به اسلام  که بخشی از مقدسات مردم مسلمان است احترام بگذارید چون احترام گذاشتن به اسلام یعنی بی احترامی به خرد، و بدتر از آن بی احترامی به انسانیت.

نتیجه آنکه من هرگز احترام به مقدسات مردم در صورتی که این مردم باورهای غیر منطقی و بدتر از آن مضر داشته باشند را نه تنها توصیه نمیکنم بلکه شدیداً نکوهش کرده و آنرا عملی غیر اخلاقی و غیر انسانی میدانم، کسانی که به اسلام احترام میگذارند یا دچار نادانی هستند و نمیدانند که اسلام چیست، یا اگر از آن آگاهند همانقدر بزهکار و بدکاره و پلید هستند که مجریان اسلام هستند. من برای خود چنین آدمهایی که یا نادان هستند یا جنایتکار احترامی قائل نیستم هر انسانی از نگر من یا اسلام ستیز است یا انسان ستیز. این انسان ستیزی البته در بیشینه موارد نا آگاهانه و از روی نادانی نسبت به اسلام و قوانین کثیف و متعفنش است.

افزون بر آنچه در بالا آمد باید توجه داشت که اسلام تنها یک مجموعه باورهای خرافی شخصی نیست بلکه به ادعای اسلامگرایان کامل است و یک ایدئولوژی سیاسی است، احترام گذاشتن به یک ایدئولوژی سیاسی کاری احمقانه است، اسلام را باید براستی در کنار کمونیسم، فاشیسم، نازیسم، بعثیسم و غیره آورد، به چه دلیل یک شخص باید به یک ایدئولوژی سیاسی احترام بگذارد؟ بخصوص اینکه این ایدئولوژی مسئله ای کاملاً غیر خصوصی است و در تمام زوایای زندگی هر انسانی دخالت میکند. درخواست احترام به اسلام همانقدر ابلهانه است که درخواست احترام به کمونیسم، فاشیسم، و نازیسم، یا حتی سایر ایدئولوژیها، دیدگاه ها و نظامهای سیاسی مثل لیبرالیسم، دموکراسی، آریستوکراسی، جمهوریت، پادشاهی و غیره… کدام انسان عاقلی اهانت به این موضوعات را جرم میداند؟ روشن است که این تفکر و ایدئولوژی سیاسی میخواهد ارزشی بالاتر از سایر ایدئولوژی های سیاسی برای خود دست و پا کند، تا جایی که کسی حق اهانت به آنرا هم نداشته باشد، حال آنکه از نظر من همانطور که هرکس میتواند به درست یا غلط بگوید کمونیسم و نازیسم مزخرف هستند، باید بتواند بگوید اسلام نیز مزخرف است و کسی نباید به او خرده بگیرد که چرا اهانت کرده ای!  تابحال دیده اید کسی از شما بخواهد به ایده دموکراسی احترام بگذارید؟

به دو دلیل بالا روشن شد که احترام به اسلام کاری غیر اخلاقی و غیر انسانیست، اما احترام نگذاشتن به چیزی برابر با بی احترامی کردن به آن نیست. شما به باورهای قبیله زولو احترامی نمیگذارید چون اساساً نمیدانید این باورها چه هستند ولی به آنها بی احترامی هم نمیکنید، بنابر این میان احترام نگذاشتن و بی احترامی کردن نیز باید فرقی قائل شد، پرسشی که اینجا مطرح میشود این است که آیا باید به مقدسات مسلمانان بی احترامی کرد یا نه؟

بازهم پاسخ باز میگردد به اینکه بی احترامی یا اهانت یعنی چه؟ در نمونه هایی که قبلاً آورده شد اثبات شد که مسلمانان انتقاد از دین را در بسیاری از موارد اهانت به اسلام تلقی میکنند، اگر میخواهید مسلمانان را راضی نگه دارید باید تمام باورهای ضد اسلامی خود را مخفی نگه دارید و «خفه» شوید، منظور بسیاری از مسلمانان از احترام گذاشتن همین است.  اما اگر اهانت یعنی انتقاد، آنگاه باید به اسلام اهانت کرد! مسلمانان از دماغ فیل نیافتاده اند که حق مصونیت از انتقاد داشته باشند، هیچ باور و اندیشه ای نباید این امتیاز را داشته باشد که کسی نتواند از آن ایراد بگیرد، انتقاد کند و نقصانی را به آن نسبت بدهد. اگر مسلمانانی اینرا درک نمیکنند و یا نمیپذیرند بخاطر توحش و فاشیست  بودن آنهاست، دیگران چرا باید به چنین حماقت و خفتی تن در دهند؟ انتقاد از اسلام و انتساب نقصان به اسلام و وارد کردن اتهام به اسلام و مسلمانان و شخصیت های اسلامی به دلیل مضر بودن اسلام برای بشریت نه تنها امری جایز بلکه از نگر من برای هر نامسلمان فهیمی که اسلام را میشناسد امری بایسته و واجب است. اگر نامسلمانی منتقد اسلام نیست یا نسبت به اسلام نادان است یا شخصی بی وجدان و درونگراست که سرنوشت خود و دیگران برایش اهمیتی ندارد، چرا که اگر کسی در مقابل جنایت سکوت کند خود جنایتکار است. نتیجه آنکه اگر انتقاد کردن از اسلام برابر با اهانت به اسلام است که ظاهراً از نظر بسیاری از مسلمانان تندرو اینگونه است، آنگاه باید به اسلام اهانت کرد.

ولی خوب گروهی فهمیده تر نیز در میان مسلمانان وجود دارند که انتقاد را اهانت نمیدانند بلکه معیار منطقی تر و متمدنانه تری برای اهانت در ذهن دارند. مثلاً این گروه معتقدند فحاشی اهانت است و به مقدسات مسلمانان نباید کسی فحاشی کند، اینکه فحاشی اهانت است مسئله ای مسلم به نظر میرسد که نمیتوان در آن شک کرد، اما پرسش بعدی که پیش می آید این است که آیا باید به اسلام و مقدسات آن فحاشی کرد یا نه؟

به نظر من بطور کلی فحاشی آنقدر امر مهمی نیست، کسی که دهانش را باز میکند و کلمات زشت از دهانش خارج میشود نمیتواند آسیبی جدی به کس دیگری بزند، طرف مقابل همواره میتواند گوش نکند یا نخواند به همین دلیل بعنوان یک لیبرال معتقدم حق فحاشی نسبت به هر کس و هر چیزی برای انسانها باید محفوظ باشد، مگر در صورتی که خساری به شخص اهانت شده انجام گیرد در اینصورت آن شخص میتواند به دادگاه برود و از اهانت کننده شکایت کند. من خود بعنوان منتقد اسلام روزی نیست که فحشهای بسیار زننده و رکیک از مسلمانان دریافت نکنم ولی این فحشها برای من آنقدر اهمیتی ندارند من به سادگی آنها را نادیده میگیرم و اگر روزی این افراد فحاش را ببینم نیز کینه ای از آنها به دل ندارم و بدون اینکه آنها بخواهند، به دلیل سفاهتشان آنها را میبخشم. مسلمانان نیز باید همین کار را بکنند، اگر از این اهانت ها ناراحت هم میشوند باید آنها را نادیده بگیرند. اینگونه ممکن است مسلمانان برای خود احترامی کسب کنند، و الا با تهدید و خشونت مسلمانان نمیتوانند برای اسلام احترام کسب کنند. گواه این مدعا این واقعیت است که بر اساس دیدگاه بسیاری از فقهای اهل تسنن هرکس به خلفای راشدین اهانت کند باید کشته شود، آیا این حکم خشن و وحشیانه جلوی اهانت شیعیان به سه خلیفه اول را گرفته است؟ البته که نه.

اما این در مورد کسانی است که به خود من فحاشی میکنند، ولی اهانت به اسلام و پیامبر اسلام و خدا و فرشتگان اهانت به یک شخص مسلمان نیست، هیچ مسلمانی هم وکالتی از پیامبر یا خدای کائنات ندارد که از او دفاع کند، دفاع از خدا کاری احمقانه به نظر میرسد اگر خدا میخواست خود میتوانست منتقدانش را در لحظه ای خاموش کند، خدا نیازی به دفاع بشر از او ندارد، مگر اینکه خدا نباشد و یک توهم باشد، خدایی که به دفاع بشر نیاز دارد دیگر خدا نیست. آیا براستی دفاع یک مسلمان کوچک که سر تا پای خود و باورهایش اهانت به دیگران است از قدرتمند ترین موجود قلچماق قابل تصور مضحک نیست؟

نتیجه آنکه اهانت به مقدسات از نظر من یک حق برای همه انسانها باید به شمار برود و هیچکس نباید بخاطر بی احترامی یا اهانت به مقدسات دینی هیچ جماعتی مجرم شناخته شود. ولی حق طبیعی بودن هم برای انجام کاری دلیل موجهی نیست، برای نمونه سیگار کشیدن هم حق طبیعی همه آدمها است ولی بهتر است مردم از این حق طبیعی استفاده نکنند یا اگر میکنند کمتر استفاده کنند.

روشن شد که اهانت به مقدسات از نگر من حق هر انسانی است، اما به پرسش «آیا باید به مقدسات توهین کرد یا نه؟» هنوز پاسخی داده نشده است. به این پرسش از دیدگاه سودمندگرایانه باید پاسخ داد، آیا توهین به مقدسات سبب خیر میشود و یا جلوی وقوع شرّی را میگیرد؟ فکر نمیکنم پاسخ قطعی بتوان به این پرسش داد که در همه سناریوها صادق باشد، برای نمونه گاهی استفاده از کلمات رکیک بصورت طنز آمیز میتواند ذهن مخاطب را نسبت به دین روشن کند و تاثیر مثبتی روی او بگذارد. برای نمونه اگر به دوست صمیمی خود بگویید از نظر شما محمد قرآن را برای آلت تناسلی خود نازل کرده یا اینکه امام زمان معلوم نیست کی میخواهد از لانه خود بیرون بیاید، این گفته ها ممکن است تاثیر مثبتی در دوست شما بگذارد و سبب تغییر در وی شود، چنین توهینی نتیجه خوبی دارد لذا از نظر سودمندگرایانه اینکار خوب به نظر میرسد. اما در مقابل فرض کنید یک استاد دانشگاه که با شما روابط صمیمانه خاصی هم ندارد بطور بسیار رسمی نظر شما را در مورد اسلام میپرسد، اگر در پاسخ به او بگویید از نظر من اسلام یک دین آشغال است، فکر میکنید برداشت آن استاد دانشگاه چه خواهد بود؟ آیا این برخورد مناسب خواهد بود؟ روشن است که چنین برخورد اهانت آمیزی فقط آبروی شما را خواهد برد و نتیجه مثبتی نخواهد داشت. یا فرض کنید در شهر قم به سر میبرید و یک دسته آخوند از مقابل شما در حال رژه رفتن هستند، اگر در چنین حالتی فریاد بزنید درود بر یزید، و مرگ بر امام زمان، چه نتیجه ای رخ خواهد داد؟

در دو نمونه بالا هم به سناریویی اشاره شد که در آن اهانت کردن بی ضرر و حتی سودمند و در نتیجه خوب است، و هم به سناریو هایی اشاره شد که در آنها اهانت کردن نتایج خوبی ندارد. حال پرسش این است که چه مشترکاتی بین سناریوهایی که در آنها اهانت کردن بد است وجود دارد؟ به عبارت دیگر چه زمانی نباید به مقدسات اهانت کرد؟  پیش از پاسخ به این پرسش شایسته است مسئله دیگری را مطرح کنیم. پرسش فرعی این است که آیا برقراری گفتمان و همنشینی با مسلمانان به نفع منتقدان اسلام است یا به ضرر آنها؟ به عبارت دیگر در همنشینی مسلمانان با منتقدان اسلام کدام طرف موضع ضعیف تری دارد و کدام طرف موضع قوی تری دارد؟

از نگر من موضع منتقدان دین بسیار بسیار قوی تر است، چرا که برای دفاع منطقی از اسلام یک شخص باید درست بودن تمامی گزاره هایی که اسلام مدعی درستی آنها است را با موفقیت اثبات کند و الا باور او به اسلام غیر عقلایی و نابخردانه است. در مقابل برای رد کردن اسلام تنها کافیست که یک گزاره نادرست در اسلام پیدا شود، در صورتی که تنها یک خطا و ایراد در اسلام وجود داشته باشد اسلام بطور کلی باطل خواهد بود، مسلمانان معمولاً از این واقعیت قافل هستند و فکر میکنند باید عکس باورهای دینیشان اثبات شود تا دینشان رد شود! قوی بودن موضع منتقدان اسلام نسبت به اسلام طبیعتاً این نتیجه را میدهد که گفتمان و مراودات فکری و مناظرات بین مسلمانان و منتقدان اسلام به نفع منقدان اسلام و به ضرر مسلمانان است. به همین دلیل است که مسلمانان به شدت از انتقاد هراس دارند و از بحث و مناظره فرار کرده و در یک کلام دشمنان جامعه آزاد و باز هستند.

با مقدمه ای که در بالا آمد به این پرسش که «چه زمانی اهانت کردن به مقدسات مسلمانان نادرست است» بهتر میتوان پاسخ داد. زمانی این اهانت کردن بد است که موجب از میان رفتن گفتمان و بحث شود و این بهانه را به مسلمانان بدهد که فرار کنند و خود را به حاشیه بکشانند. بازگشت مسلمانان به پناهگاهشان نتیجه ای مثبت برای آنها دارد. البته باید توجه داشت که در بیشینه موارد وقتی با کسی بحث میکنید نمیتوانید نظر او را عوض کنید ولی این بحث کردن اغلب باعث میشود دیگران به موضوعاتی که تابحال به آنها فکر نکرده اند فکر کنند. خود این نتیجه بحث کردن ارزش بسیار بالایی دارد.

بنابر این من توهین کردنی به مقدسات را که نتیجه خوبی ندهد اگرچه حق هر انسانی میدانم ولی توصیه میکنم که به دنبال فحاشی و استفاده از کلمات رکیک در برخورد با مسلمانان نباید بود و معمولاً بهتر است این ضعف و خشم را با دانش گستری و استدلال و برخورد آرام و منطقی جایگزین کرد.

چرا مسلمانان نگران اهانت شدن به باورهایشان هستند؟

کسی که به محمد رسول الله اهانت کند و با وی به دشمنی بپردازد حکمش از نظر علمای اسلامی مرگ است و خونش حلال است، البته حکم کسی که به امامان، خدا و حتی به فرشته ها نیز توهین کند باید به سرعت کشته شود و پیاده شدن این حکم نیاز به دادگاه و قاضی ندارد، یک مسلمان خود میتواند این حکم را در هر شرایطی پیاده کند و فقها در این مسئله با یکدیگر «اجماع» دارند، ماده 513 قانون مجازات اسلامی ایران در این مورد میگوید:

اگر توهینی مشمول ساب النبی باشد، مجازات آن اعدام است و در این مورد هر که بشنود براو کشتن واجب است و نیازی به اذن امام و رهبر شرعی نیست، مسئله مورد اجماع، فقیهان، و از جرائم غیر قابل گذشت است. و اگر مشمول حکم ساب النبی نباشد، به حبس از یک تا پنج سال محکوم می‌گردد، و این جرم، بازهم غیر قابل گذشت است و مشمول ماده‌ی (727) نیست.

باورهای دینی بقیه مردم و دینداران نیز گاهی مورد اهانت قرار میگیرد، مثلاً چند سال پیش در نیویورک امریکا مردی مجسمه ای شکولاتی از بدن عریان مسیح  ساخته بود، او که خود یک مسیحی بود میگفت مسیح چیزی شیرین است و شکولات هم چیزی شیرین است و من فکر میکنم این اثر هنری خیلی مناسب باشد. مسیحیان زیادی از این کار او دلخور و ناراحت شدند ولی نه کسی دستور قتل برای او صادر کرد نه به او فحشی داده شد نه کسی او را تهدید به مرگ کرد. کمترین خشونتی نسبت به او از جانب یک مسیحی وارد نشد، کاری که تندرو ترین مسیحی ها انجام دادند این بود که تلاش کردند پشتیبانان مادی او را بایکوت کنند. سرانجام نیز این مجسمه در موزه ای به نمایش در آمد و کسی هم تنوانست جلوی آنرا بگیرد (17). همه روزه اشعار و آهنگها و فیلمها و کلیپها و کتابهایی که در آنها مستقیم یا غیر مستقیم به مسیحیت، مسیح و مسیحیان توهین میشود در غرب منتشر میشود ولی مسیحیان با متانت و بزرگواری تمام آنها را نه تنها تحمل میکنند بلکه این اهانت ها را حق هر کسی میدانند. آیا مسیحیان از این اهانت ها ناراحت نمیشوند؟ البته که میشوند! ولی هیچکس از مسیحیان خشونت ویژه ای در این زمینه نمیبیند، چرا مسلمانان نیز در این مورد مانند مسیحیان رفتار نمیکنند؟

براستی دلیل این همه توحش و حساسیت شدید در میان مسلمانان چیست؟ به فرض اینکه خدایی وجود داشته باشد و نبوت محمد نیز قابل دفاع باشد آیا این قابل دفاع است که مسلمانان بخواهند از اهانت به خدا و پیامبر و دینشان آزرده شوند و به دفاع از آنها بپردازند؟ به نظر نمیرسد خداوندی قدیر و علیم که همه چیز را میداند و همه کاری را میتواند انجام دهد از اهانت یک انسان به خود ناراحت شود، و یا اینکه از انسان دیگری کمک بخواهد، اگر خدا از اهانت ناراحت شود میتواند خودش از خودش دفاع کند نیاز به دفاع انسانها ندارند، پس برای پرسش بالا باید پاسخهایی غیر از اینکه مسلمانان در حال دفاع از خدا و پیامبر و غیره هستند را جستجو کرد. چند پاسخ قابل تصور را در زیر مرور میکنیم.

یکم – به نظر میرسد مسلمانان باورهای دینیشان را بیش از حد جدی میگیرند، برای شخصیتهای مقدسشان از جمله خدا، پیامبران و امامان قدرتهای ماوراء طبیعی بسیار زیادی توهم میکنند و انتظار یاری زیادی از آنها دارند. شخصیت های مقدس مذهبی برای مسلمانان همانند بت برای بت پرستان هستند، وقتی کسی به بتهای آنها اهانت میکند انگار بتهای آنها را شکسته است، مسلمانان تمام عمر خود را در ترس از قدرت این بتها زندگی میکنند، ولی وقتی میبینند شخصی به این بت ها اهانت میکند و این بتها نمیتوانند از خود دفاع کنند طبیعتاً متوجه عجز و بی خاصیتی این بت ها میشوند یا دستکم ایمانشان تضعیف میشود. این است که روحانیون برای جلوگیری از وقوع این شک، اهانت به اسلام را جدی میگیرند، چون اهانت به اسلام، حال آنکه باوری که با اهانت دیگران سست شود مسلماً باور سست مایه و بیهوده ایست و ما میدانیم که اسلام حقیقتاً چنین است. وقتی مادربزرگ شما ببیند که شما بعد از اهانت به اسلام به سوسک تبدیل نمیشوید در دین خود و درستی اراجیفی که به آنها اعتقاد داشته است رفته رفته شک میکند. شاید اگر من هم قرار بود از یک مشت اراجیف مانند اراجیف قرآن دفاع کنم مجبور بودم دست به خشونت ببرم.

این خود مارا یاد داستان ابراهیم و نابود کردن بتهای قوم خود می اندازد، ابراهیم بت هارا میشکند و میگوید ببینید این بتها حتی از خود نمیتوانند دفاع کنند، پس نیرویی ندارند، به عبارت دیگر ابراهیم از بتها یک عمل را انتظار داشت و میخواست از آنها امتحان بگیرد، در مورد مسلمانان نیز دقیقا همین مسئله است. بت نامرئی و آسمانی آنها الله چون موجودی خیالی و غیر حقیقی است هیچ کاری را در واقع نمیتواند انجام دهد و حتی قدرت دفاع از خود را نیز ندارد. اگر کسی به او توهین کند او نمیتواند هیچ  کاری بکند. این مسلمانان هستند که باید به یاری الله بیایند و از او دفاع بکنند و دشمنانش را بکشند، و این خود بسیار مضحک است. بنابر این توهین کردن به اسلام، یک خدا شکنی است که شباهت بسیاری با بت شکنی ابراهیم سامی دارد، روشن است که از نگر ما فرق چندانی میان بت پرستی و خداباوری نیست، و همانگونه که خداباوران، خداباوری را برتر از بت پرستی میدانند ما نیز بیخدایی را برتر از خداباوری میدانیم. هردو در جهت مبارزه با خرافات و جهل انجام میگیرند و هردو یک نتیجه میدهند، اگر مسلمانان کار ابراهیم را تایید میکنند، این منافقانه است که کار اهانت کنندگان به اسلام را تقبیح کنند!

دوم – اسلام مروج فرهنگ مرگ و ستیزه جوییست، به همین دلیل برای زنده نگه داشتن خود همواره به دشمن نیاز دارد. در فرم شیعی اسلام حتی زمانی که این دشمن وجود ندارد هم یاد دشمنان پیشین (معاویه، یزید، بنی امیه و…)  زنده نگه داشته میشود تا این فرهنگ مرگ و تنفر زنده بماند. همانطور که نشان داده شد اهانت به اسلام جرمی است که به سادگی میتوان هر کسی را به آن محکوم کرد. بنابر این «اهانت به مقدسات» ابزاریست که به درد روحانیت میخورد. چون همواره میتوانند هر عملی را اهانت تلقی کرده و دشمنان فرضی برای خود بوجود بیاورند که بتوانند خود را مشغول به جنگ با دشمنان نشان داده و مقلدانشان را بیشتر بچاپند.

سوم – ملایان انتقاد از خود را در بسیاری از موارد دشمنی و اهانت به اسلام میدانند و میتوانند از این روش منتقدین خود را ساکت کنند. این شیوه را خود محمد بنیانگذاری کرد، خلفای بعدی نیز آنرا ادامه دادند و هنوز هم تداوم دارد. رژیم جنایتکار اوباش اسلامی «محارب با خدا» را در لیست اتهامات بسیاری از قربانیان خود آورده بود. در میان روحانیون هم رایج است که روحانیون ادامه دهنده رسالت هستند و اهانت به یک روحانی (توسط یک جسمانی!) در صورتی که رسالت را زیر سوال ببرد همانند اهانت به پیامبر و در نتیجه مجازاتش مرگ است.

چهار- فرهنگ استبدادی و عقب مانده مسلمانان تفکر انتقادی و اساساً انتقاد را برنمی‍‌‍ تابد و همواره آنرا مضر می پندارد. البته اگر منصفانه به این قضیه نگاه کنیم بقیه طیف های مردم خاور میانه نیز همینگونه هستند. تشبیه انتقاد به اهانت و در نتیجه امتناع از پاسخگویی به انتقاد روشی رایج در فرهنگهای خاور میانه ای است و نامسلمانان نیز همواره از آن استفاده میکنند.

پنجم- مسلمانان در کل شاید به دلیل اینکه دینشان وسط بیابان شکل گرفته است و زندگی بیابانی در مقابل زندگی در دشتهای سر سبز و آب و هوای خوب زندگی بسیار خشنی است به نظر میرسد در تمامی موارد خشن و وحشیانه برخورد میکنند، این نخستین توحش و خشونت از جانب مسلمانان نیست که ما شاهد آن هستیم، مسلمانان در کل فرهنگی خشن و وحشی دارند، روحی که در کالبد جامعه اسلامی وجود دارد روحیه خشونت و ستیز و توحش را ترویج میدهد، از همین رو سم هریس یکی از اندیشمندان غربی اسلام را «فرقه مرگ» نام نهاده است. من فکر میکنم این خشونت ذاتی اسلام که هم ریشه جغرافیایی دارد هم ریشه تاریخی از آنرو که محمد یک فرد نظامی و جنگجو بوده است، میتواند پاسخ خوبی به پرسش مطرح شده در ابتدای این بخش بدهد.

آیا اسلام و مسلمانان هم به دیگران احترام میگذارند؟

از حق که نگذریم، دعوت به احترام در بیشینه موارد دعوت خوبی است، کسی که شما را به احترام دعوت میکند شما را به کاری نیک و بهتر بودن فرا میخواند، به همین دلیل هرگاه کسی از من میخواهد که به  چیزی توهین نکنم من درخواست او را جدی میگیرم چون دعوت او، دعوت به نیکیست! اما این دعوت یا صادقانه و خیر خواهانه است یا موزیانه و منافقانه و زیاده خواهانه است. حال دعوت مسلمانان به احترام به مقدسات و اسلام از کدام دسته است؟  آیا مسلمانان میگویند «بیایید به یکدیگر و مقدسات یکدیگر احترام بگذاریم؟» یا میگویند «بیایید به مقدسات ما بدون توجه به اینکه ما به شما و مقدسات شما و دیگران احترام میگذارند احترام بگذارید؟». برای پاسخ به این پرسش باید به رفتار خود مسلمانان نگاه کرد، آیا مسلمانان نیز بطور متقابل به مقدسات دیگران و یا باورهای افراد دیگر احترام میگذارند؟ از نگر من روشن است که مسلمانان چنین نمیکنند و به همین دلیل دعوت مسلمانان به احترام یک دعوت صادقانه و خیر خواهانه نیست بلکه مسلمانان بخاطر دو رویی و از روی نفاق و پلیدی است که چنین انتظاری از دیگران علی رغم بی احترامیشان به آنها دارند. در اثبات این ادعا در این بخش به سه موضوع خواهم پرداخت، نخست اهانت های قرآن و حدیث به نامسلمانان، دوم  رفتار محمد با دگر اندیشان و سوم خشونت اسلام نسبت به نامسلمانان.

همانطور که گفته شد، باید دید آیا مسلمانان خود به دیگران احترام میگذارند یا نه؟ برای یافتن پاسخ این پرسش یک راه نگاه به رفتار مسلمانان است، اما هر مسلمانی که به دیگران و مقدسات دیگران اهانت کند را اگر ملاک تشخیص قرار دهیم ممکن است به حق یا ناحق گفته شود که او مرجع اسلام نیست، و کار او لزوماً به اسلام ربطی ندارد. اما از آنجا که کسی نمیتواند بگوید قرآن به اسلام ربطی ندارد، بهتر است بجای رفتار مسلمانان قرآن را بررسی کنیم، آیا قرآن به دیگران و مقدساتشان احترام میگذارد؟

فرض کنید روزی در خیابان در حال قدم زدن هستید که اعلامیه ای از شخصی دریافت میکنید. این اعلامیه مربوط به گروه «پیروان» است و در آن از شما دعوت میشود که شما هم به این گروه با سابقه و قدیمی بپیوندید. در این اعلامیه همچنین شرح مختصری از باورهای مشترک این گروه آمده است که از این قرار هستند:

  1. مسلمانان همانند خرهایی هستند که کتاب حمل میکنند
  2. مسلمانان نجس هستند
  3. مسلمانان بدترین جنبندگان روی زمین هستند
  4. خدا مسلمانان را بکشد
  5. لعنت خدا و فرشتگان بر مسلمانان باد
  6. مسلمانان مانند حیواناتی هستند که کسی در گوششان چیزی بگوید و آنها جز بانگی نشنوند، مسلمانان کر و کور و لالند و هیچ نمیفهمند
  7. اکثر مسلمانان مثل چهارپایان یا بدتر از آنها هستند، نه میفهمند نه میشنوند
  8. اکثر مسلمانان فاسق (نافرمان، تبهکار، زناکار، گناهکار) هستند
  9. مسلمانان مثل حیوان غذا میخورند
  10. مسلمانان مانند خران وحشی هستند که از شیر میگریزند
  11. مسلمانان حرامزاده هستند
  12. تف بر مسلمانها!
  13. مسلمانان بیمار هستند
  14. مسلمانان ابله هستند ولی خودشان نمیدانند
  15. مسلمانان شعور ندارند
  16. طرفداران گروه پیروان بهترین مردم هستند، بین مسلمانها هم آدم خوب به ندرت پیدا میشود ولی اکثرشان آدمهای عوضی و تبهکاری هستند

نظر شما راجع به گروه «پیروان» پس از آگاهی از افکارشان چه خواهد بود؟ آیا به نظر شما این گروه به مسلمانان اهانت کرده است؟ شما این 15 مورد را یا بخشی از آنها را فحش و اهانت میدانید یا نه؟ آیا این گروه، گروهی فاشیست و ستیزه جو نیست؟ مهمتر از اینها، آیا مسلمانان باید به این گروه و پیروانش احترام بگذارند؟ فکر نمیکنم هیچ انسان عاقلی، بالغ و منصفی به این پرسش آخری پاسخ مثبت بدهد. با توحش و بربریتی که از اسلام و مسلمانان سراغ داریم، اگر دست مسلمانان به پیروان این گروه برسد با آنها چکار خواهند کرد؟ از همه اینها جالب تر، اگر پیروان از مسلمانان بخواهند که به عقاید و باورهای گروه پیروان و خود ایشان احترام بگذارند، به نظر شما هواداران گروه پیروان زیاده خواه، دو رو و حتی دیوانه نیستند؟ آیا مسلمانان باید این درخواست گروه پیروان را از روی حسن نیت بدانند؟

ممکن است بپرسید نقل این داستان تخیلی چه سودی دارد؟ پاسخ این است که این داستان کاملاً تخیلی نیست بلکه مبتنی بر واقعیتی انکار ناشدنی است، تمامی 15 مورد بالا در قرآن آمده است با این تفاوت که مخاطب این دشنامها در قرآن نامسلمانان یا دگراندیشان از زمینه های فکری مختلف هستند، با این اوصاف آیا مسلمانانی که خدایشان اینگونه همانند انسانی فرومایه و دهن دریده زشت ترین دشنامها را به دیگران داده است از دیگران انتظار احترام داشته باشند؟ در ادامه منبع این فحاشی ها به ترتیب همان شماره ای که در اعلامیه بالا آمد، از قرآن ذکر خواهم کرد:

  1. آيه 5 سوره الجمعة (62:5)

    مَثَلُ الَّذِينَ حُمِّلُوا التَّوْراةَ ثُمَّ لَمْ يَحْمِلُوها كَمَثَلِ الْحِمارِ يَحْمِلُ أَسْفاراً بِئْسَ مَثَلُ الْقَوْمِ الَّذِينَ كَذَّبُوا بِآياتِ اللَّهِ وَ اللَّهُ لا يَهْدِي الْقَوْمَ الظَّالِمِينَ

    مثل کساني که تورات بر آنها تحميل گشته و بدان عمل نمي کنند مثل آن خراست که کتابهايي را حمل مي کند بد داستاني است داستان مردمي که آيات خدا را دروغ مي شمرده اند و خدا ستمکاران را هدايت نمي کند (ترجمه آیتی).

  2. آيه 28 سوره التوبة (9:28)

    يا أَيُّهَا الَّذِينَ آمَنُوا إِنَّمَا الْمُشْرِكُونَ نَجَسٌ فَلا يَقْرَبُوا الْمَسْجِدَ الْحَرامَ بَعْدَ عامِهِمْ هذا وَ إِنْ خِفْتُمْ عَيْلَةً فَسَوْفَ يُغْنِيكُمُ اللَّهُ مِنْ فَضْلِهِ إِنْ شاءَ إِنَّ اللَّهَ عَلِيمٌ حَكِيمٌ

    اي کساني که ايمان آورده ايد ، مشرکان نجسند و از سال بعد نبايد به مسجدالحرام نزديک شوند و اگر از بينوايي مي ترسيد ، خدا اگر بخواهد به فضل خويش بي نيازتان خواهد کرد زيرا خدا دانا و حکيم است (ترجمه آیتی)

  3. آيه 55 سوره الانفال (8:55)

    إِنَّ شَرَّ الدَّوَابِّ عِنْدَ اللَّهِ الَّذِينَ كَفَرُوا فَهُمْ لا يُؤْمِنُونَ

    هر آينه بدترين جنبندگان در نزد خدا آنهايند که کافر شده اند و ايمان نمي آورند : (ترجمه آیتی)

  4. آيه 30 سوره التوبة (9:30)

    وَ قالَتِ الْيَهُودُ عُزَيْرٌ ابْنُ اللَّهِ وَ قالَتِ النَّصارى الْمَسِيحُ ابْنُ اللَّهِ ذلِكَ قَوْلُهُمْ بِأَفْواهِهِمْ يُضاهِؤُنَ قَوْلَ الَّذِينَ كَفَرُوا مِنْ قَبْلُ قاتَلَهُمُ اللَّهُ أَنَّى يُؤْفَكُونَ

    يهود گفتند که عزير پسر خداست ، و نصاري گفتند که عيسي پسر خداست اين ، سخن که مي گويند همانند گفتار کساني است که پيش از اين کافر بودند خدا بکشدشان به کجا باز مي گردند ؟ (ترجمه آیتی)

  5. آيه 161 سوره البقرة (2:161)

    إِنَّ الَّذِينَ كَفَرُوا وَ ماتُوا وَ هُمْ كُفَّارٌ أُولئِكَ عَلَيْهِمْ لَعْنَةُ اللَّهِ وَ الْمَلائِكَةِ وَ النَّاسِ أَجْمَعِينَ

    بر آنان که کافر بودند و در کافري مردند لعنت خدا و فرشتگان و همه مردم باد (ترجمه آیتی)

  6. آيه 171 سوره البقرة (2:171)

    وَ مَثَلُ الَّذِينَ كَفَرُوا كَمَثَلِ الَّذِي يَنْعِقُ بِما لا يَسْمَعُ إِلاَّ دُعاءً وَ نِداءً صُمٌّ بُكْمٌ عُمْيٌ فَهُمْ لا يَعْقِلُونَ

    مثل کافران ، مثل حيواني است که کسي در گوش او آواز کند ، و او جز بانگي و آوازي نشنود اينان کرانند ، لالانند ، کورانند و هيچ در نمي يابند (ترجمه آیتی)

  7. آيه 22 سوره الانفال (8:22)

    إِنَّ شَرَّ الدَّوَابِّ عِنْدَ اللَّهِ الصُّمُّ الْبُكْمُ الَّذِينَ لا يَعْقِلُونَ

    بدترين جانوران در نزد خدا اين کران و لالان هستند که در نمي يابند (ترجمه آیتی)

  8. آيه 59 سوره المائدة (5:59)

    قُلْ يا أَهْلَ الْكِتابِ هَلْ تَنْقِمُونَ مِنَّا إِلاَّ أَنْ آمَنَّا بِاللَّهِ وَ ما أُنْزِلَ إِلَيْنا وَ ما أُنْزِلَ مِنْ قَبْلُ وَ أَنَّ أَكْثَرَكُمْ فاسِقُونَ

    بگو : اي اهل کتاب ، آيا ما را سرزنش مي کنيد ؟ جز اين است که ما به خدا و آنچه بر ما نازل شده و آنچه پيش از اين نازل شده است ايمان آورده ايم و شما بيشترين نافرمان هستيد ؟ (ترجمه آیتی)

  9. آيه 12 سوره محمد (47:12)

    إِنَّ اللَّهَ يُدْخِلُ الَّذِينَ آمَنُوا وَ عَمِلُوا الصَّالِحاتِ جَنَّاتٍ تَجْرِي مِنْ تَحْتِهَا الأَْنْهارُ وَ الَّذِينَ كَفَرُوا يَتَمَتَّعُونَ وَ يَأْكُلُونَ كَما تَأْكُلُ الأَْنْعامُ وَ النَّارُ مَثْوىً لَهُمْ

    خدا کساني را که ايمان آورده اند و کارهاي شايسته مي کنند ، به ، بهشتهايي که نهرها در آن جاري است داخل خواهد کرد ولي کافران از اين جهان متمتع مي شوند و چون چارپايان مي خورند و جايگاهشان آتش است (ترجمه آیتی)

  10. آيه 50 سوره المدثر (74:50) (به آیات 48 و 49 نیز نگاه شود)

    كَأَنَّهُمْ حُمُرٌ مُسْتَنْفِرَةٌ

    مانند خران وحشي (ترجمه آیتی)

  11. آيه 13 سوره القلم (68:13)

    عُتُلٍّ بَعْدَ ذلِكَ زَنِيمٍ

    كسانى كه متكبر و سركشند و اصل و نسب خود را بديگران منسوب ميسازند. (حرام زاده- اند).  (ترجمه کاویانپور)

  12. آيه 67 سوره الانبياء (21:67)

    أُفٍّ لَكُمْ وَ لِما تَعْبُدُونَ مِنْ دُونِ اللَّهِ أَ فَلا تَعْقِلُونَ

    اف بر شما و بر آنچه جز خدا مى‏پرستيد! پس آيا نمى‏انديشيد؟ (ترجمه حلبی)

  13. آيه 10 سوره البقرة (2:10)

    فِي قُلُوبِهِمْ مَرَضٌ فَزادَهُمُ اللَّهُ مَرَضاً وَ لَهُمْ عَذابٌ أَلِيمٌ بِما كانُوا يَكْذِبُونَ

    در دلهاشان مرضي است و خدا نيز بر مرضشان بيفزوده است و به کيفر دروغي که گفته اند برايشان عذابي است دردآور (ترجمه آیتی)

  14. آيه 13 سوره البقرة (2:13)

    وَ إِذا قِيلَ لَهُمْ آمِنُوا كَما آمَنَ النَّاسُ قالُوا أَ نُؤْمِنُ كَما آمَنَ السُّفَهاءُ أَلا إِنَّهُمْ هُمُ السُّفَهاءُ وَ لكِنْ لا يَعْلَمُونَ

    و چون به آنان گفته شود که شما نيز همانند ديگر مردمان ايمان بياوريد، ،مي گويند : آيا ما نيز همانند بيخردان ايمان بياوريم : آگاه باشيد ، که آنان خود بيخردانند و نمي دانند (ترجمه آیتی)

  15. «لا یشعرون» در مورد نامسلمانان در آیه های زیر آمده است:
    النحل: ٢٦، النمل: ١٨، الأعراف: ٩٥، يوسف: ١٥، القصص: ٩،الأنعام: ١٢٣، النحل: ٤٥، العنكبوت: ٥٣، يوسف: ١٠٧، النمل: ٦٥، آلعمران: ٦٩، الأنعام: ٢٦،     البقرة: ٩، الزمر: ٢٥، الزخرف: ٦٦، القصص: ١١، النحل: ٢١، البقرة: ١٢، النمل: ٥٠، المؤمنون: ٥٦، الشعراء: ٢٠٢.
  16. آیه 110 سوره ال عمران (3:110)

كُنْتُمْ خَيْرَ أُمَّةٍ أُخْرِجَتْ لِلنَّاسِ تَأْمُرُونَ بِالْمَعْرُوفِ وَ تَنْهَوْنَ عَنِ الْمُنْكَرِ وَ تُؤْمِنُونَ بِاللَّهِ وَ لَوْ آمَنَ أَهْلُ الْكِتابِ لَكانَ خَيْراً لَهُمْ مِنْهُمُ الْمُؤْمِنُونَ وَ أَكْثَرُهُمُ الْفاسِقُونَ

شما بهترين امتي هستيد از ميان مردم پديد آمده ، که امر به معروف و نهي از منکر مي کنيد و به خدا ايمان داريد اگر اهل کتاب نيز ايمان بياورند برايشان بهتر است بعضي از ايشان مؤمنند ولي بيشترين تبهکارانند (ترجمه آیتی)

افزون بر اینها الله در قرآن بارها نامسلمانان لعنت کرده است، آیا لعنت کردن الله، امامان و پیامبر اسلام نیز برای نامسلمانان بطور متقابل آزاد است یا نه؟ برخی از مسلمانان میگویند لعن کردن اهانت نیست، اگر اهانت نیست پس ما نیز باید بتوانیم لعن کنیم. برخی میگویند شما که به خدا اعتقاد ندارید نباید از لعن شدن ناراحت شوید. من این پاسخ را صحیح نمیدانم زیرا فحاشی وقتی صورت گرفته است که شخصی به دیگری فحش بدهد نه اینکه شخصی احساس کند به او فحش داده شده است. برای نمونه فرض کنید با مردمی آشنا میشوید که در فرهنگ و عقاید و باورهایشان عبارت «کله استخوانی» یک اهانت محسوب میشود در حالی که در فرهنگ شما چنین نیست. حال در این میان شخصی از این جمعیت در مورد شما از این عبارت استفاده میکند. آیا اهانتی صورت گرفته؟ روشن است که صورت گرفته است و ملاک دیدگاه توهین کننده است نه توهین شونده.

لعنت البته در مقابل سایر اهانتهای قرآن موضوع کوچکیست،  غیر از این نتیجه که مسلمانان انصافاً نباید انتظار احترام از سایرین را داشته باشند، از وجود آیات بالا میتوان نتایج منطقی دیگری را نیز گرفت. پاسخ این پرسش چیست؟ «آیا دستکم یکی از 15 آیه بالا اهانت آمیز است یا نه؟»

اگر پاسخ مسلمانان نه است، آنگاه آنچه در 15 مورد بالا آمده نباید برای مسلمانان اهانت آمیز تلقی شوند، یعنی اگر نامسلمانی مسلمانان یا پیامبر اسلام یا هر چیز یا شخص مقدس دیگری را با واژه هایی همچون خر، حرامزاده، نفهم، بی شعور، نجس، حیوان، چهارپا و غیره خطاب کند، مسمانان حق اعتراض ندارند چون اینکار شبیه گفتن «خودتی!»  هست که نباید اهانت محسوب شود و مسلمانان نباید از نامسلمانان انتظار داشته باشند که از خدای آنها در برخورد با مخالف و منتقد مودب تر باشند.

اگر پاسخ مسلمانان آری است، آنگاه اهانت کردن باید آزاد باشد، مگر اینکه مسلمانان حق اهانت به دیگران را منحصر به خود بدانند و بگویند ما حق اهانت به دیگران را داریم ولی دیگران حق اهانت به ما را ندارند. که این البته غیر عادلانه و زیاده خواهی است.

هردو این پاسخها به ضرر مسلمانان و به نفع نامسلمانان است، واقعیت این است که آنچه در آیات بالا آمده است نشان از کمبود و خشم و کینه گوینده دارد، همچنین نشان از تربیت بیابانی و کم دارد، نشان از عقده های فراوان و مشکلات روحی و افسردگی های شدید دارد، تمام این صفات به خود محمد میخورند، همین دشنامها از نگر من میتوانند نشان دهند که قرآن به خدا ارتباطی ندارد.

به نظر نمی آید هیچ انسان عاقلی تمایل به احترام گذاشتن غیر متقابل نسبت به اسلام و مسلمانان داشته باشد. یعنی اگر قرار باشد ما به مسلمانان احترام بگذاریم و خدای آنها به ما اهانت کند، ما باید دیوانه باشیم. از طرفی مسلمانان را توانایی دگرگون کردن قرآن نیست، پس هیچگاه ضرورتی ندارد نامسلمانی به اسلام و مسلمانان احترامی بگذارد. مگر اینکه آیات اهانت آمیز قرآن روزی از قرآن حذف شوند. یا دستکم تعداد زیادی از مسلمانان بپذیرند که در قرآن خطا وجود دارد و آنچه در قرآن آمده لزوماً الهی نیست، آیا مسلمانان هرگز به این تکامل فکری خواهند رسید؟ به نگر من نه! چون خود دین دیدگاه ناقض قرآن است.

افزون بر قرآن که کلام الهی پنداشته میشود، احادیث بسیار زشت و زننده ای در مورد کفار در متون دینی مسلمانان دیده میشود. در زیر به چند مورد از آنها اشاره میکنیم:

حلیة المتقین، علامه مجلسی، باب چهارم، فصل چهارم:

حضرت صادق علیه السلام فرمود که: دشمن ما اهل بیت نیست مگر کسی که ولدالزنا یا مادرش در حیض به او حامله شده باشد.

همانجا باب هفتم، فصل سوم:

در حدیث موثق از حضرت صادق علیه السلام منقول است که: از آبی که در حوض هاى کوچک در حمام هاى سنیان جمع می شود از غسل مردم غسل مکن که در آن غساله یهودى و نصرانى و گبر و دشمن ما اهل بیت که از همه بدتر است جمع می شود و خدا خلقى از سگ نجس تر خلق نکرده است و کسیکه عداوت ما اهل بیت دارد از سگ نجس تر است.

همانجاباب دهم  فصل هفتم:

از حضرت صادق (ع) منقول است که هر که مومنی را سیر کند بهشت بر او واجب می شود و هر که کافری را سیر کند، خدا شکم او را پر از زقوم جهنم کند!

پس از ذکر این احادیث بسیار زشت، به یاد آوردن این نکته سودمند است که   کردار و پندار یک انسان نسبت به مخالفانش شاخص خوبی برای نشان دادن شخصیت اصلی اوست، و این احادیث  که از نظر یکی از بزرگترین محدثین شیعه در رده «موثق» هم قرار گرفته اند، میزان فرومایگی شخصیت های دینی تشیع را به خوبی نشان میدهند.  ممکن است تصور کنید به دلیل یاوه گو بودن مجلسی احادیث بالا چندان اهمیتی ندارند، ولی آیت الله مکارم شیرازی از چند منبع سنی نیز حدیث مشابهی را نقل کرده است (18)، به استفتاء زیر توجه کنید:

سؤال: آيا در منابع اهل سنت رواياتى مبنى بر حلال زاده نبودن دشمنان على(عليه السلام) وجود دارد؟

جواب: در منابع اهل سنت رواياتى در اين حضوص وارد شده است كه در اينجا به برخى از آنها اشاره مى كنيم:

  1. ابوسعيد خدرى مى گويد : «كنّا معشر الأنصار نبور أولادنا بحبِّهم عليّاً(رضي الله عنه) ; فإذا وُلد فينا مولودٌ فلم يحبّه عرفنا أ نّه ليس منّا»(1) [ما انصار ، فرزندانمان را با دوست داشتن على(رضي الله عنه) امتحان مى كرديم ; پس هر گاه فرزندى از ما متولّد مى شد و او را دوست نداشت مى فهميديم او فرزند ما نيست] .
  2. عبادة بن صامت مى گويد : «كنّا نبور أولادنا بحبِّ عليّ بن أبي طالب(رضي الله عنه) ; فإذا رأينا أحدهم لا يحبّ عليّ بن أبي طالب علمنا أ نّه ليس منّا وأ نّه لغير رِشْدَة»(2) [ما فرزندانمان را با دوست داشتن على ابن ابى طالب(رضي الله عنه) امتحان مى كرديم ، و چون مى ديديم يكى از آنها على ابن ابى طالب(رضي الله عنه) را دوست ندارد ، مى فهميديم از ما نيست و از راه حلال به دنيا نيامده است] .
    حافظ جزرى در كتاب «أسنى المطالب»(3) پس از ذكر اين حديث نوشته است :
    مطلب از قديم تا به حال مشهور است كه فقط زنازاده با على(رضي الله عنه) دشمنى مى كند.
  3. حافظ حسن بن على عدوى از احمد بن عبده ضبىّ از ابوعيينه از ابن زبیر از جابر نقل كرده است : «أمرنا رسول الله(صلى الله عليه وآله) أن نعرض أولادنا على حبِّ عليِّ بن أبي طالب» [پيامبر خدا(صلى الله عليه وآله) به ما دستور داد كه فرزندانمان را بر دوستى على بن أبى طالب عرضه كنيم] . رجال اين حديث رجال صحيحين (صحيح بخارى و مسلم) بوده و همگى از ثقات محسوب می شوند.
  4. حافظ طبرى در كتاب «الولاية» با سندش از على(عليه السلام) اين حديث را نقل كرده است :
    «لا يحبّني ثلاثة : ولد الزنا ، ومنافق ، ورجل حملت به اُمّه في بعض حيضها» [مرا سه نفر دوست ندارند : زنازاده و منافق و كسى كه مادرش در حال حيض به او حامله شده باشد] .
  5. از ابوبكر نقل شده است : من پيامبر خدا(صلى الله عليه وآله) را ديدم كه خيمه اى بنا كرده بود و بر كمانى عربى تكيه داده بود و در آن خيمه ، على و فاطمه و حسن و حسين بودند ، و فرمود : «معشر المسلمين! أنا سلمٌ لمن سالمَ أهل الخيمة ، حربٌ لمن حاربهم ، وليٌّ لمن والاهم ، لا يحبّهم إلاّ سعيد الجدِّ طيّب المولد ، ولا يبغضهم إلاّ شقيُّ الجدِّ رديء المولد»(4) [ اى گروه مسلمين! من با كسى كه با اهل خيمه در صلح باشد در صلحم ، و با كسى كه با آنان در جنگ است در جنگ هستم ، و دوستدار كسى هستم كه با آنها دوستى ورزد . و آنان را جز فرد خوشبخت حلال زاده دوست ندارد ، و جز فرد بدبخت داراى ولادتِ پست ، با آنان دشمنى نمى كند] .
    اين مطلب را در گذشته و حال ، بسيارى از شعرا به نظم در آورده اند كه مجالى براى ذكر اشعار آنها نيست ; يكى از اين اشعار ، شعر صاحب بن عبّاد است(5) :

1 ـ بحبَّ عليّ تزولُ الشكوكُ وتصفو النفوسُ ويزكو النجار
2 ـ فمهما رأيتَ محبّاً له فثَمّ العلاءُ وثَمّ الفخار
3 ـ ومهما رأيتَ بغيضاً له ففي أصلِهِ نسبٌ مستعار
4 ـ فمهّد على نَصبه عذرَهُ فحيطانُ دارِ أبيه قصارُ

[ 1 ـ با دوستى على شكّ ها برطرف مى شود ، و نَفْس ها و روح ها تصفيه مى شود ، و اصل ونَسَب پاك مى گردد . 2 ـ پس هر جا دوستدار او را ديدى ، برترى و فخر آنجاست . 3 ـ و هر گاه دشمن او را ديدى پس در اصل و نَسَب او نَسَبى عاريه گرفته شده است . 4 ـ پس براى دشمنى او عذرى درست كن ، (و بگو) ديوارهاى خانه پدرش كوتاه بوده است] .
و همو سروده است :

حبُّ عليّ بن أبي طالب فرضٌ على الشاهدِ والغائبِ
واُمُّ من نابذَهُ عاهرٌ تبذلُ للنازلِ والراكبِ

[دوستى على بن أبى طالب بر هر شاهد و غايبى واجب است . و هر كس با او دشمنى ورزد مادرش بد كاره بوده و بر پياده و سواره خود را عرضه مى كرده است] .(6)

1 ـ أسنى المطالب ، حافظ جزرى : 8 [ص 58] ; شرح ابن أبي الحديد 1 : 473 [4/110 ، خطبه 56] ، و در آنجا تصحيفى روى داده است .
2 ـ أسنى المطالب : 8 [ص 58] ; نهاية ، ابن الأثير 1 : 118 [1/161] .
3 ـ أسنى المطالب : 8 .
4 ـ الرياض النضرة ، حافظ محبّ الدين طبرى 2 : 189 [3/136] .
5 ـ ديوان الصاحب بن عبّاد : 95 .
6 ـ شفيعى شاهرودى، گزيده اى جامع از الغدير، ص 406.

نتیجه آنکه حرامزاده و زنازاده بودن دشمن علی موضوعی جدی است که بنیادگرایان شیعه واقعاً به آن اعتقاد دارند و از گفتن آنهم شرم ندارند. من بخاطر اسلام ستیز بودن بارها با این قضیه روبرو شده ام، برای نمونه به کامنت زیر نگاه کنید (نام کسی که مورد فحاشی قرار گرفته بود و بکب ار منتقدان اسلام بود با ستاره پنهان شده است):

*** ***** يك زنا زاده بود- پيامبر اعظم (ص) فرمودند: اهل بيت پيامبر را كسي نميكشد جز زنا زاده- اهل بيت پيامبر را كسي ناسزا نميگويد جز زنا زاده؛ همتون بريد گمشيد. اين آرزو رو هم به گور ميبريد كه يه روزي بتونيد توي ايران حكومت نجستون رو اجرا كنيد.

پاسخ طنز آمیز من نیز به او این بود:

پیامبر اعظم غلط فرمود، هرکس مخالف دموکراسی و سکولاریسم است زنا زاده است. آرش بیخدا

اهانت در میان مسلمانان تنها به نامسلمانان نیست بلکه به یکدیگر نیز بسیار اهانت میکنند. برای نمونه یک وبسایت اسلامی (19) که مربوط به اهل تسنن است به بررسی جمعیت شیعیان نسبت به اهل تسنن در دنیا پرداخته است و در جایی نوشته است:

باید در یاد داشت که میزان زاد و ولد در میان شیعیان به این دلیل زیاد است که دین آنها اجازه زنا (متعه=ازدواج موقت، صیغه) را به آنها میدهد.

تلویزیون الاقصی وابسته به گروه تروریستی فلسطینی حماس در تاریخ پنجشنبه 15 ژانویه 2009 عالم سنی را نشان داد که به نقل از ابن تیمیه از بنیانگذاران سلفی گرایی گفت (20):

شیعیان خرهای یهودیان هستند، که یهودیان در هر فتنه ای بر آنها سوار میشوند.

آخوند شیعی معروف یه نام شیخ دانشمند نیز در یکی از جلسات سخنرانی خود که فیلم برداری شده است نیز به صراحت میگوید (21):

1- اهل تسنن بر اساس فقه شیعه، زنازاده هستند

2- عمر هم زنازاده بوده است هم حرامزاده

3- لعنت بر پدر هرچی سنی!

نمونه دیگری از اهانت های شیعیان به مقدسات اهل تسنن، مراسم عمر کشان است که در آن به عمر زشت ترین دشنامها را میدهند (22)، عمر کشان البته تنها اهانت شیعیان به اشخاصی که برای اهل تسنن محترم هستند نیست، به نمونه دیگری از این اهانت ها در قالب حدیث توجه کنید:

صهاک کنیز حبشی عبد المطلب بود و برای او شتر می چرانید نفیل با او زنا کرد و خطا ب را به دنیا آورد. خطاب وقتی به سن بلوغ رسید به صهاک طمع کرد و با او زنا نمود و دختری به دنیا آورد. آن دختر را در پارچه ای از ابریشم پیچید و از ترس مولایش او را بر سر راه گذاشت. هاشم ابن مغیره او را دید و برداشت و تربیت کرد و نامش را حنتمه گذاشت حنتمه وقتی به سن بلوغ رسید روزی خطاب او را دید و در او طمع کرد و او را از هاشم خواستگاری کرد هاشم او را به ازدواج خطاب درآورد و عمر ابن خطاب به دنیا آمد. (23)

نمونه های دیگری از این نوع اهانت ها به صحابه محمد را از نویسندگان و شخصیت های مشهور شیعه میتوان یافت که دو مورد آن را در زیر میاوریم:

آیت الله خمینی:

در کتاب کشف الاسرار مي‌گويد: ما در اينجا کاري نداريم به شيخين و آنچه مرتکب شدند از مخالفت با قرآن، و بازي گرفتن احکام خداوند، و آنچه که از جانب خود حلال و حرام کردند، و آن ستمي که بر عليه فاطمه دختر پيامبر و فرزندانش انجام دادند.
ولي ما به جهل و ناداني آنان نسبت به احکام خداوند و دين اشاره مي‌کنيم و بعد از اتهام شيخين به جهل و ناداني مي‌گويد:
و بدرستي که افرادي جاهل و احمق و دروغگو و ستمگر مانند اينها، شايستگي ندارند که در جاي امامت بوده و شامل اولي الامر باشند .  (24)

نعمت الله جزایری:

عمر بن الخطاب در مقعدش بيماري است که شفاياب نمي‌شود مگر با آب (مني) مردان، پس او کسي است که با وي چنين انجام مي‌شود….عثمان بن عفان از کساني بود که مخنث (کونی) بود و با وی بازی می‌شد. (25)

اهانت به دیگران در قالب لعنت نیز در میان شیعیان جایگاه ویژه ای دارد، گفته میشود که علی بن البیطالب نیز مخالفان سیاسی خود را مورد لعنت قرار میداد:

امیرالمؤمنین علیه اسلام گروهی را لعن کرده چنانچه در قنوت نماز واجب لعن می کرد معاویه و عمروبن العاص و ابو موسی اشعری و ابوالأ عودالسّمی را ، با آنکه حضرت با گذشت ترین مردم بود در مورد گناه جنایتکاران ، و اگر او لعن را بهترین وسیلهء تقرب نمی دانست آن را در نماز واجب بکار نمی برد. (26)

در وبسایت آیت الله شاهرودی پرسش و پاسخ زیر صورت گرفته است:

پرسش- آیا لعن کردن برخی از مادران مومنین (زنان محمد) مانند عایشه به گناه نافرمانی از پیامبر، جنگیدن علیه امام زمان، و دشمنی با امیر المومنین علی ابن ابیطالب، بصورت علنی یا تصریحی مجاز است؟

پاسخ- لعن کردن تمام کسانی که به علی ابن ابیطالبو فاطمه زهرا و دیگر امامان دشمنی کرده اند و جنگیدند مجاز است، مگر اینکه ترس از آسیب رسیدن به شما باشد (مثلاً جانتان در خطر بیافتد). و گفته شده است که امام صادق بعد از هر نماز هر هشت تای آنها را لعنت میکرد (آن چهار زن و چهار مرد را). (27)

لعن خلفای راشدین که مورد احترام شدید اهل تسنن هستند در برخی ادعیه شیعیان مثل زیارت عاشورا به صراحت ذکر میشود، اما افزون بر لعن کردن گویا علی ابن ابیطالب اهانت های دیگری نیز انجام میداده است، برای نمونه دکتر سروش در مصاحبه ای گفته است:

وقتی که مناظره ای بین آقای مصباح و محمد جواد حجتی برگزار شد (من همه اینها را از حافظه نقل می کنم والا اگر بنا به تتبـّع و استقصاء باشد موارد بسیار بیشتر از این می شود پیدا کرد) من خود شاهد این مناظره بودم، که آقای حجتی به مصباح یزدی می گفت که در سخنرانی های عمومی بی حرمتی کردن نسبت به مستمعین و مخاطبان کار شایسته ای نیست و آقای مصباح به جای اینکه روش خود را در مقام سخن گفتن تصحیح کند در جواب آقای حجتی گفت که:

« نخیر، ما خطبه هائی در نهج البلاغه داریم که در آن خطبه ها امام علی هم هنگام سخن گفتن و خطابه خواندن به مستمعین خود اهانت می کرد.» (28)

من چنین چیزی از این مناظره شخصاً به یاد ندارم ولی اینکه علی به طرف مقابل خویش اهانت میکند واقعیت دارد، نمونه هایی از آن را در اینجا ذکر میکنم:

از امام صادق روايت است كه :

اميرالمومنين بر سر منبر بود و داشت خطبه می داد كه زن بداخلاقی بلند شد و گفت: اين قاتل دوستان است، حضرت امير به طرف وی نگاه كرد و فرمود:

ای زن بيباك و پررو! ای بد زبان شبيه مردان! ای كسيكه مانند زنان حيض نميبينی! ای كسيكه بر فرجش آشكارا چيزی اويزان است! (يا سلفع يا جريئة يا بذية يا مذكرة، يا التي لا تحيض كما تحيض النساء ، يا التي على هنها شئ بين مدلى!) (29)

افزون بر مطالب بالا، مسلمانان به عملی به نام «مباهله» اعتقاد دارند که در آن دو طرف که با یکدیگر اختلاف نظر دارند گرد هم می آیند و بر یکدیگر لعنت میفرستند تا خدا طرفی را که محق نیست مورد لعن خود قرار دهد. به نظر نمی آید این عمل که توسط پیامبر اسلام انجام شده خیلی محترمانه باشد بلکه یقیناً نوعی بی احترامی در آن دیده میشود. نتیجه این بخش آنکه مسلمانان خود پایبند به احترام گذاشتن به نامسلمانان و حتی دیگر مسلمانان نیستند نه در نظر اینگونه هستند نه در عمل. پس درخواست احترام آنها درخواستی صادقانه و برای عملی متقابل نیست بلکه نوعی زورگویی و زیاده خواهیست.

موضوع دومی که در این بخش بدان خواهیم پرداخت رفتار محمد با نامسلمانان است آیا محمد به مقدسات دینی نامسلمانان احترام میگذاشت؟ مسلمانان دوست دارند بگویند که او به سایر ادیان احترام میگذاشت ولی این خلاف واقع است، روشن ترین نشانه بی احترامی محمد به سایر ادیان تخریب بتهای خانه کعبه پس از فتح مکه است. بتهای خانه کعبه خدایان و یا نمایندگان خدایان بت پرستان بودند و بت پرستی هم یک دین است! کاری که محمد با بتهای بت پرستان کرد مشابه تخریب خانه خدا و اماکن مقدس مسلمانان است، اگر تخریب بتها اهانت به بت پرستان نیست پس تخریب کعبه و قرآن و غیره هم نباید بی احترامی تلقی شوند.  تخریب بناهای مقدس در تاریخ اسلام حتی محدود به نامسلمانان هم نمیشود، در زمان محمد گروهی از افراد موسوم به «منافق» در قبا مسجدی ساختند که محمد آنرا «مسجد ضرار» نامید، محمد همراه با یارانش این مسجد را تخریب کرد و این مسجد به گفته یک مورخ شیعی «از آن پس براى چندى به صورت مزبله و محل اجتماع زباله و كثافات در آمد» (30). از خود پرسش کنید، تخریب بتخانه، و مسجد در ردیف احترام به باورهای دینی و مقدسات دیگران است یا اهانت به آنها؟

افزون بر این در تاریخ به صراحت آمده است که محمد به خدایان قوم خویش دشنام میداده است و از همین رو سران قریش خواستار توقف این دشنامگویی بودند.

ابوجهل بن هشام، و امیه بن خلف، جمله در فنای کعبه حاضر شدند و با یکدیگر مشورت کردند و گفتند: نمیدانیم که چه تدبیر کردیم با این مرد، یعنی محمد، علیه السلام، که دین ما را بخلل آورد و قوم ما را از راه ببرد و خدایان مارا دشنام داد.(31)

در اسباب النزول واحدی سه روایت در مورد شان نزول آیه 108 سوره انعام وجود دارد که هر سه تاکید میکنند که محمد و پیروانش به خدایان مشرکان دشنام میداده اند:

والبى از ابن عباس روايت مى‏كند كه مشركان گفتند يا محمد (ص) از بدگويى خدايان ما بس كن و گر نه خدايت را هجو مى‏كنيم. آيه بدين مناسبت نازل گرديد.

قتاده گويد: مسلمانان بت‏هاى كفار را دشنام مى‏دادند و كافران نيز عينا پاسخ مى‏گفتند. خداوند مسلمين را از تحريك كردن آن مردم نادان نهى كرد.

سدّى گويد چون ابو طالب به حال مرگ افتاد قريش گفتند بياييد به نزد اين مرد برويم و از او بخواهيم كه برادر زاده‏اش را در مورد ما نصيحت و وصيت كند، چه شرم داريم از اينكه پس از او محمد (ص) را بكشيم كه عرب گويند ابو طالب مانع بود و چون بمرد محمد (ص) را كشتند. پس ابو سفيان و ابو جهل و نضر بن حارث و امية بن خلف و ابىّ بن خلف و عقبة بن ابى معيط و عمرو عاص و اسود بن بخترى بر بالين ابو طالب رفتند و گفتند تو بزرگ و سرور مايى و محمد ما را و خدايان ما را مى‏آزارد دوست داريم او را بخوانى و از اينكه نام خدايان ما را ببرد منع كنى، ما نيز او را با خدايش رها مى‏كنيم. (32)

برخی روایات بالا را ناقض دستور قرآن در آیه 108 سوره انعام میدانند و نتیجه میگیرند که محمد و یارانش به مقدسات دیگران دشنام نمیداده اند، چنین نتیجه گیری سفسطه آمیز است، چون فرض میکند محمد آنچه دستور میداده را خود رعایت میکرده، حال آنکه چنین تصوری تنها با فرض عصمت محمد قابل پذیرش است و چون عصمت محمد مورد پذیرش ما نیست نمیتوانیم چنین استدلالی را بپذیریم، حتی برخی از مسلمانان نیز عصمت محمد را مردود میدانند. برای توضیحات بیشتر پیرامون این سفسطه به نوشتاری با فرنام «سفسطه های رایج پیرامون تاریخ» مراجعه کنید. این عده میگویند پیامبر به مقدسات اعراب دشنام نمیداده بلکه به آنها نقصان نسبت میداده است.

واقعیت این است که اسلام تنها خود را دین راستین میداند و تمامی ادیان دیگر را اگر غیر از یهودیت و مسیحیت باشند و آیین صابئین (برخی معتقدند آیین زرتشت نیز جزو این ادیان است) اساساً دین نمیدانند و خود این ادیان را هم در حال حاضر گمراه و تحریف شده میدانند.  به همین جهت به خود حق میدهند که ادیان باطل را نابود کنند و حتی نمادهای آنها را نیز از بین ببرند. بنابر این محمد نیز برای سایر ادیان احترام قائل نبود. حتی احترام محمد به اهل کتاب هم احترامی عادلانه و پایدار نبود محمد به محض اینکه توانایی سرکوب اهل کتاب را پیدا کرد با قتل عام و تبعید در نابود کردن آنها کوشید و آنانی که زیر سلطه اسلام زندگی میکردند یعنی اهل ذمه را به شهروند درجه دوم با حقوقی نابرابر تبدیل کرد. برای اطلاعات بیشتر در این زمینه به نوشتاری با فرنام «آیات جنایی قرآن جنبه دفاعی دارند!» مراجعه کنید.

سومین موضوع این بخش پیرامون خشونتی است که مسلمانان همواره علیه نامسلمانان بکار گرفته اند. تصور کنید در حال قدم زدن هستید و ناگهان با صحنه مقابل برخورد میکنید: شخصی چاقو به دست گرفته و دیگری را روی زمین خوابانده و در حال تلاش برای بریدن سر او است. قربانی نیز در حال تلاش برای رهایی از دست قاتل است و در این حین به او فحشهای جنسی بسیار رکیک میدهد. در چنین موقعیتی آیا عاقلانه است که شما به قربانی اعتراض کنید و بگویید چرا به این قاتل اهانت میکنی؟  آیا این اعتراض مضحک نیست؟

رفتار مسلمانان با نامسلمانان و حتی مسلمانان دگر اندیش نیز همواره مشابه همین اتفاق بوده است. مسلمانان خشونت را تا منتهای درجه در ترویج و پاسداشت دین خود استفاده میکنند و از اقرار به این هم ابایی ندارند. کدام جماعتی در دنیا رفتاری که مسلمانان با دگر اندیشان دارند را در قبال دگر اندیشان دارند؟ این است که اگر نامسلمانان چند تا فحش و بد و بیراه هم به اسلام و مسلمان بدهند این قضیه آنقدر اهمیت ندارد، اگر آن خشونت کنار برود این فحاشی نیز کنار خواهد رفت. اینطور اعتراضها به فحاشی زمانی مضحک تر میشوند که از طرف نامسلمانان انجام میگیرند، برای نمونه کمونیست ها و چپی ها که گاهی اوقات به ازدواج موقت اسلامگرایان در می آیند گاهی خواستار احترام به مقدسات و باورهای دینی مردم میشوند!

در چه صورتی دیگران به مسلمانان احترام خواهند گذاشت؟

مسلمانان باید یاد بگیرند که احترام را نمیتوانند با تهدید و توحش از یکسو، و گدایی کردن و مظلوم نمایی از سوی دیگر بدست بیاورند.  احترام اکتسابی است و مسلمانان باید احترام را کسب کنند و نشان دهند که شایسته احترامند و لیاقت آن را دارند و بی احترامی به آنها بی انصافیست. گفتن این از نظر سیاسی درست نیست و مسلمانان گویا مایلند این قضیه را انکار کنند ولی واقعیت این است که مسلمانان در دنیا احترام چندانی ندارند و بطوری فزاینده وجهه خود را از دست میدهند و مورد نفرت  و تحقیر دیگران قرار میگیرند. این موجب شادمانی کسی نمیشود مسلمانان بخش بزرگی از مردم دنیا هستند و مورد احترام واقع نشدن آنها خبر خوبی برای هیچکس نیست.  شاید دیگران این را به زبان نیاورند ولی بسیاری از نامسلمان درون خود مسلمانان را با چشم حقارت نگاه میکنند و احترام چندانی برای آنها قائل نیستند، مسلمانان نیز اینرا میدانند به همین دلیل است که «به مقدسات ما اهانت نکنید!» را زیاد شنیده ایم. هرچه بیشتر به یاری فن آوری و گلوبالیسم نامسلمانان با مسلمانان و اسلامشان آشنا میشوند بیشتر مسلمانان در نظر آنها منفور و تحقیر میشوند.  مردم جهان نه تنها مسلمانان را بعنوان افراد نادان بلکه افراد ستیزه جو و خشن و دگر ستیز میدانند و همزیستی با مسلمانان برای بسیاری از مردم جهان به یک معضل تبدیل شده است.

پرسشی که در اینجا مطرح است این است که مسلمانان برای کسب احترام باید چکار کنند؟ روشی که مسلمانان تا کنون برای کسب احترام پیش گرفته اند که همان خشونت و توحش از یکسو و گدایی و مظلومنمایی از سوی دیگر است مسلماً نتوانسته است برای مسلمانان احترام دست و پا کند، این روشها که برخاسته از خود اسلام هم هست به این دلیل ناکارآمد هستند که افراد خیر خواه و فهمیده ای آنها را بوجود نیاورده اند بلکه مغزی متوحش و بیابانی این شیوه برخورد را برای مسلمانان تجویز کرده است. تجربه هم به خوبی نشان میدهد که مردم حاضر نیستند به کسی که به زور میخواهند آنها را به احترام وادارد احترام بگذارند، بلکه کسب احترام روشهای دیگری دارد. بد نیست مسلمانان به دیگرانی که مورد احترام دیگران هستند نگاه کنند و ببینند چه رفتاری در آنها سبب کسب احترام برای آنها شده است و همان روش را پیش بگیرند نه اینکه تا ابد به دستورهای خشن و ابلهانه دینی خود جامه عمل بپوشانند. از این رو، برای خیر خواهی و چون ممکن است مسلمانان علاقه به احترام شدن داشته باشند توصیه های زیر به مسلمانان تقدیم میشود، شاید که مسلمانان بتوانند برای خود در دنیا احترام کسب کنند:

  1. سکولار شوید، اسلام را از عرصه های عمومی زندگی خود خارج کنید و تنها برای خود نگه دارید، برای دیگران با باورهای دینیتان مزاحمت ایجاد نکنید، اذان را با صدای بلند پخش نکنید، در ماه رمضان رستورانها را نبندید، دیگران را مجبور به داشتن حجاب نکنید و خلاصه قوانین دینیتان را به اجتماع تحمیل نکنید، سعی نکنید با ظاهر و رفتار متفاوت خود را از اجتماع جدا کنید، مثل بقیه باشید
  2. زن ستیزی را کنار بگذارید، به زن حقوق و حیثیت برابر بدهید، با زنان مثل حیوانات خانگی رفتار نکنید، همجنسگرایی را به رسمیت بشناسید، چند همسری را کنار بگذارید، صیغه و محلل و ختنه زنان را متوقف کنید
  3. دانش، خردگرایی و تفکر انتقادی و منطق را جایگزین تعصب و ایمان و سنگ مغزی و جهاد و شهادت و خرافات و حرف و حدیث و قرآن و غیره کنید
  4. نسبت به سایر فرهنگها و ادیان و آیین ها و کشورها و ملیت ها با احترام برخورد کنید، دگراندیش ستیزی، برتری جویی، و بیگانه ستیزی را کنار بگذارید برابری حیثیتی و حقوقی را برای خود و دیگران جستجو کنید، از گفتن اینکه فکر میکنید بهترین مردم جهان هستید و بهترین دین دنیا را دارید به دیگران خود داری کنید! درک کنید که دیندار بودن پدیده ای تصادفیست و به همین دلیل هر دینی مشکوک است و نباید دین را زیاد جدی گرفت و برای آدم کشت یا کشته شد
  5. خشونت و توحش را کنار بگذارید، شکنجه و تنبیه های فیزیکی را متوقف کنید، دست قطع کردن، چشم در آوردن، اعدام، قصاص، سنگسار، شلاق زدن و سایر وحشی گری ها را کنار بگذارید، ترحم، صلح، دوستی و انسانیت را جایگزین حس توحش خود کنید و با مجرمان برخورد انسانی و مطابق با حقوق بشر کنید
  6. تلاش خود را برای زشت بودن متوقف کنید، سعی کنید زیبا باشید، موهای زائد بدن را کوتاه کنید، مثل آدمهای هزار سال پیش لباس نپوشید قیافه بربر ها و انسانهای غار نشین را به خود نگیرید، بهداشت را رعایت کنید و سعی کنید شیک و باکلاس باشید
  7. خرافات را کمتر کنید در زندگی به واقعیت های مادی ارزش بیشتری بدهید، کار کنید، تنبلی و مفت خوری را کنار بگذارید، تولید کنید
  8. حساسیت خود را در مقابل اهانت کم کنید، مانند کودکان اهانت را جدی نگیرید، تنبیه اهانت کنندگان را به الله شکنجه گر بسپارید، به جایی که در آنجا به شما اهانت میشود نروید و اهانت به باورها و دینتان را متمدنانه تحمل کنید، درست مثل تمام دین داران و باورمندان دیگر!

به زبان دیگر تمام توصیه های بالا را میتوان در یک توصیه خلاصه کرد، مسلمان نباشید، سعی کنید کمتر شبیه آنچه اکنون هستید باشید و بیشتر شبیه غربی ها باشید. حال پرسش این است که آیا مسلمانان میتوانند چنین کنند؟ پاسخ به نظر من مثبت است بسیاری از مسلمانان خود این شرایط را رعایت میکنند و انسانهای قابل احترامی هستند ولی خوب بی احترامی نامسلمانان به اسلام و مسلمانان معمولاً بخاطر همین مسائل است و میتوان دید که این مسائل در میان مسلمانان وجود دارد. به هر روی چه بتوانند چه نتوانند به نظر میرسد راه کسب احترام این باشد. افزون بر کسب احترام رعایت کردن این مسائل میتواند سبب زندگی بهتر برای خود مسلمانان و پیشرفت برای آنها باشد، ولی کو گوش شنوا؟ متاسفانه از واقعیت های تلخ جوامع بدوی این است که مردم بدوی با بدویت خود خوشحالند و حتی نمیپذیرند که بدوی هستند.

منابع

1- عبدالحکیم عادلی، توهین به مقدسات،  فقه پژوهان – زمستان 1386، شماره 2 +

2- همان 21

3-  الغدیر ج 10/ص 157 و لعن نمودن رسول الله معاویهء ملعون در الغدیر ج 10/ص139 . شرح نهج البلاغه ابن ابی الحدید ج 4 / ص79-ج15/175-ج6/ص289. تاریخ طبری ج11/ص357

4- خبرنامه گویا متن کامل سخنان مجتهد شبستری را تحت عنوان «متن کامل سخنان محمد مجتهد شبستری در دانشگاه اصفهان، نوروز» منتشر کرده است. +

5- روزنامه کیهان، تهران، صفحه 2 اخبار کشور، مورخ 10/12/87 +

6- خبرگزاری فارس، شماره خبر :8712051489، مورخ 87/12/05 +

7- خبرگزاری فارس، شماره خبر :8712080291، مورخ 87/12/08 +

8- خبرگزاری آفتاب، پنجشنبه ۸ اسفند ۱۳۸۷ ساعت ۱۲:۰۰؛ نماینده فلاورجان: سخنان مجتهد شبستری بی‌اساس است +

9- http://www.farsnews.net/newstext.php?nn=8506250139 مرور شده در تاریخ 21 آپریل 2009

10-  http://www.farsnews.com/newstext.php?nn=8506250040 مرور شده در تاریخ 21 آپریل 2009

11- http://www.makaremshirazi.org/persian/squestions/?qid=10685 مرور شده در 18 آپریل 2009

12- http://www.islahweb.org/html/modules.php?op=modload&name=News&file=article&sid=1553&mode=thread&order=0&thold=0 مرور شده در تاریخ 21 آپریل 2009

13- http://behar.ir/html/index.php?name=Sections&req=viewarticle&artid=73&page=1 مرور شده در 19 جون 2009

14- شماره نامه 62068 فرستاده شده از طریق تارنمای saanei.net

15- http://www.bbc.co.uk/persian/news/021105_a-iran-nouri.shtml مشاهده شده در 10 آپریل 2009

16-  http://english.pravda.ru/society/stories/81664-Hindu-0 مرور شده در تاریخ 15 جون 2009

17- http://www.reuters.com/article/oddlyEnoughNews/idUSN1731340120071017 مرور شده در 29 جون 2009

18- http://www.makaremshirazi.org/persian/squestions/?qid=10685 مرور شده در 18 آپریل 2009

19-  http://www.islamicweb.com/beliefs/cults/shia_population.htm مرور شده در 18 آپریل 2009

20-  http://www.newiraqnews.com/fa/pages/?cid=1670 مرور شده در 18 آپریل 2009

21- توضیحات یک آخوند در مورد اینکه چرا سنی ها حرامزاده اند. مرور شده در 18 آپریل 2009

22- برای دو نمونه از مراسم عمر کشان به پیوندهای مقابل مراجعه شود (بسیار زننده):

فیلمی از مراسم عمر کشان

صدای مراسم عمر کشان

23- بحارالانوار چاپ سنگی، جلد 8 صفحه 295، الصلابة في معرفة الصحابة، جلد 3، صفحه 212، در کتاب شیعه علوی شیعه صفوی دکتر شریعتی در برگ 72 نیز به این حدیث اشاره شده است.

24- آیت الله خمینی، کشف الاسرار ص 126

25- الانوار النعمانية ج، 1 باب 1 ص، 63 و 65 چاپ شرکت چاپ ایران

26- الغدیر ج 10/ص 157 و لعن نمودن رسول الله معاویهء ملعون در الغدیر ج 10/ص139 . شرح نهج البلاغه ابن ابی الحدید ج 4 / ص79-ج15/175-ج6/ص289. تاریخ طبری ج11/ص357

27- پرسش شماره 50، http://www.shahroudi.net/aghayeda/aghayedj1.htm مرور شده در 19 جون 2009

28- http://www.drsoroush.com/Persian/Interviews/P-INT-13841218-HomaTV.html مرور شده در تاریخ 15 جون 2009

29- بحارالانوار العلامة المجلسي  و34/256 و40/141 و41/290 و293 و58/131، بصائر الدرجات للصفار ص 379 والاختصاص للمفيد ص 304.

30- زندگانى حضرت محمد(ص)، زندگانى حضرت محمد(ص)، رسولى محلاتى ص 615

31-  سیرت رسول الله، ابن هشام، صفحه 269

32- اسباب نزول القرآن، على بن احمد واحدى،مترجم:عليرضا ذكاوتى قراگزلو، نشر نى‏،تهران، 1383 ش‏. ص: 116 و 117.  با سپاس از بهروز +

محمد دیوانه نیست؟

آنرا که عقل است، دین نیست و آنرا که دین است، عقل نیست!

ابوالعلی معری

در قرآن بسیار به این نکته اشاره شده است که محمد دیوانه نیست، و این نشان میدهد که اعراب محمد را متهم به دیوانه بودن میکردند، در این نوشتار دلایل احتمالی پشت این اتهام را بر خواهیم شمرد. لازم به توضیح است که من معتقد نیستم محمد بطور کلی دیوانه بوده است، رفتار محمد نشان میدهد که فردی باهوش بوده است و خوب میدانسته است چگونه به اهداف پلید خود برسد، برای نمونه به نوشتاری با فرنام بخش سوم – حکم شدن سعد بن معاذ، قضاوت او، پیاده شدن حکم او و نتیجه گیری در ماجرای بنی قریظه مراجعه کنید، بلکه در این نوشتار تلاش بر این است که نشان داده شود محمد بگونه ای از انحرافات روانی رنج میبرده است و ممکن است که او به دلیل همین انحرافات روانی واقعاً صداهایی را شنیده باشد و چیزهایی را دیده باشد که واقعیت نداشته باشند و تماماً ساخته ذهن او بوده باشند.

معمولاً باورهای دینی که ما با آنها آشنایی نداریم، بسیار مضحک به نظر میرسند، بعنوان مثال من مسلمانان زیادی را دیده ام که به باورهای مسیحی مثل تثلیث و اباطیلی که در انجیل نوشته شده است، مثل جریان آمدن خدا بر روی زمین و کشتی گرفتن افراد با خدا و غیره میخندند و آنها را مسخره میکنند. روزی با یک مسلمان سنی صحبت میکردم او طبق معمول میگفت، شما با اسلام آشنایی ندارید و و راجع به اسلام بگونه ای سخن میگفت که انگار دارد راجع به جراحی مغز صحبت میکند، او میگفت این آخوندهای نادان شیعه بسیاری از جعلیات را به نام اسلام ارائه میدهند و به همین دلیل است که شما اسلام را رها کرده اید. او برای اینکه ادعایش را پشتیبانی کند حدیثی از یکی از کتابهای شیعه نقل کرد که در آن خر پیامبر با پیامبر صحبت میکرده است و گفته است اجدادش هم خر پیامبران قبلی بودند یا اراجیفی از همین دست که در کتابهای شیعه به وفور یافت میشوند. او سپس شروع به خندین کرد و گفت اگر اسلام این است من نیز آنرا قبول ندارم، کدام آدم احمقی قبول میکند که خر میتواند صحبت کند؟ من نیز حرفش را تایید کردم و گفتم خوب اینکه حیوانات بتوانند صحبت بکنند واقعا احمقانه است، اما خوب خود قرآن نیز از این حرفهای احمقانه زیاد زده است، در قرآن آمده است که مورچه ها با سلیمان صحبت کرده اند و هد هد هم همینطور، و کسانی که اینها را باور میکنند واقعا باید احمق باشند. چهره این مسلمان سنی که گرایش های سلفی نیز داشت ناگهان سرخ شد و رگ گردنش بیرون زد، و نزدیک بود از خشم منفجر شود، به او گفتم البته خوب شما احتمالاً این رو نمیدونستید، و برای اینکه او بیش از این شاکی نشود گفتم من منظورم کسانی بود که این چیزها را نمیدانند و به آنها اعتقاد دارند… و خلاصه توانستم یک جوری قضیه را ماست مالی کنم که به اعصاب طرف زیاد فشار نیاید.

جالب اینجاست که او بعد از این گفت که بله حیوانات هم میتوانند صحبت بکنند و مورچه ها هم با همدیگر صحبت میکنند و هد هد هم سخنرانی میکند و اینها، من نیز به او نشان دادم که حرفهایش پایه علمی ندارد و اینها… اما بالاخره من نفهمیدم اگر هد هد میتواند صحبت بکند چگونه است که خر پیامبر نباید بتواند صحبت کند؟ و گفتگوی ما طبق معمول با این پایان یافت که او آن آیه قرآن را که میگوید در قلب کافران مرضی هست، را خواند و من هم به او گفتم که البته من هیچ بیماری قلبی خوشبختانه ندارم اما به نظر من هم در مغز مسلمانان مرضی هست، آدمی که مغز سالم داشته باشد این همه پرت و پلاهای قرآن را قبول نمیکند و آنها را با ادعاهای شبه علمی ماست مالی نمیکند و خودش را گول نمیزند.

هدف از بیان این حکایت شخصی کوتاه این بود که بگویم باورهای دینی دیگران همیشه برای دین داران مسخره، کودکانه و در نهایت احمقانه هستند. اما دین داران این صداقت را و آزاد اندیشی را ندارند که بفهمند باورهای دینی خودشان هم بسیار احمقانه هستند. آدمها باورهای دینی که در محیطشان وجود دارد را باور میکنند و آنقدر این باورها برایشان تکرار میشود که حماقت مستور در آنها کم کم پنهان و عادی میشود. برای مسلمانان کشتی گرفتن با خدا احمقانه به نظر میرسد ولی اینکه سلیمان مانند علاءالدین سوار باد میشده است و یونس در شکم ماهی مانند پدر ژپتو زندگی کرده است احمقانه به نظر نمیرسد. برای مسیحیان نشستن محمد بر روی خرش و رفتن به معراج مسخره به نظر میرسد اما کشتی گرفتن با خدا مسخره به نظر نمیرسد. همین قضیه باعث میشود که اگر باورهای دینی جدیدی را کسی برای انسان مطرح کند آن شخص در نظر انسان دیوانه و مجنون مینماید. به یاد دارم نخستین بار که یک هندو از هندوئیسم برای من سخن میگفت من از او با شگفتی تمام میپرسیدم که مطمئنی؟ شوخی نمیکنی؟ بعد هم درون خودم فکر میکردم که این بابا باید حتماً دیوانه باشد که به این همه مزخرفات باور دارد.

جریان محمد رسول الله همینطور بوده است، شکی وجود ندارد که بسیاری از اعراب فکر میکردند محمد دیوانه است و به قول معروف بالاخانه را اجاره داده. این واقعیت را میتوان از روی قرآن نیز دریافت، به آیات زیر توجه کنید:

الفرقان آيه 8

أَوْ يُلْقَى إِلَيْهِ كَنزٌ أَوْ تَكُونُ لَهُ جَنَّةٌ يَأْكُلُ مِنْهَا وَقَالَ الظَّالِمُونَ إِن تَتَّبِعُونَ إِلَّا رَجُلًا مَّسْحُورًا

يا گنجى [از آسمان‏] براى او فرستاده شود، يا باغى داشته باشد كه از [ميوه‏] آن بخورد [و امرار معاش كند]؟!) و ستمگران گفتند: (شما تنها از مردى مجنون پيروى مى‏كنيد!)

الطور آيه 29 

فَذَكِّرْ فَمَا أَنتَ بِنِعْمَتِ رَبِّكَ بِكَاهِنٍ وَلَا مَجْنُونٍ

پس تذكّر ده‏، كه به لطف پروردگارت تو كاهن و مجنون نيستى‏!

القلم آيه 2 

مَا أَنتَ بِنِعْمَةِ رَبِّكَ بِمَجْنُونٍ.

كه به نعمت پروردگارت تو مجنون نيستى‏.

الحجر آيه 6

وَقَالُواْ يَا أَيُّهَا الَّذِي نُزِّلَ عَلَيْهِ الذِّكْرُ إِنَّكَ لَمَجْنُونٌ.

و گفتند: (اى كسى كه (ذكر) [= قرآن‏] بر او نازل شده‏، مسلماً تو ديوانه ‏اى‏!

المومنون آيه 70

أَمْ يَقُولُونَ بِهِ جِنَّةٌ بَلْ جَاءهُم بِالْحَقِّ وَأَكْثَرُهُمْ لِلْحَقِّ كَارِهُونَ.

يا مى‏گويند او ديوانه است‏؟! ولى او حق را براى آنان آورده‏؛ امّا بيشترشان از حق كراهت دارند [و گريزانند].

الصافات آيه 36

وَيَقُولُونَ أَئِنَّا لَتَارِكُوا آلِهَتِنَا لِشَاعِرٍ مَّجْنُو.

و پيوسته مى‏گفتند: (آيا ما معبودان خود را بخاطر شاعرى ديوانه رها كنيم‏؟!)

التكوير آيه 22

وَمَا صَاحِبُكُم بِمَجْنُونٍ.

و مصاحب شما [= پيامبر] ديوانه نيست‏!

القلم آيه 51

وَإِن يَكَادُ الَّذِينَ كَفَرُوا لَيُزْلِقُونَكَ بِأَبْصَارِهِمْ لَمَّا سَمِعُوا الذِّكْرَ وَيَقُولُونَ إِنَّهُ لَمَجْنُونٌ.

نزديك است كافران هنگامى كه آيات قرآن را مى‏شنوند با چشم‏زخم خود تو را از بين ببرند، و مى‏گويند: (او ديوانه است‏!).

کمتر مفهومی به این اندازه در قرآن تکرار میشود، خدای کائنات تمام کار خود را رها کرده و چندین بار این حرف را تکرار کرده که باباجان، این پیامبر ما دیوانه نیست! البته خوب در واقعیت خود محمد بوده که میگفته باباجان من دیوانه نیستم، این نیز چیزی طبیعی است، اکثر دیوانه ها نمیدانند که دیوانه هستند، معمولاً این دیگران هستند که به آنها میگویند شما دیوانه هستید. محمد فکر میکرده است اگر از طرف الله حرف بزند که الله هم گفته من دیوانه نیستم مردم آنقدر خنگ هستند که حرف او را قبول میکنند، و البته ظاهراً درست فکر میکرده اطرافیان محمد بجز کسانی که او را شناختند مانند عبد الله ابن ابی سرح واقعا انسانهای نادان و خنگی بودند، البته برخی از آنها محمد را برای شرکت در غارتهای او همراهی میکردند، یا مانند کسانی که در تاریخ اسلام از آنها با فرنام «منافق» یاد میشد، جرات نداشتند اسلام را کنار بگذارند و مجبور بودند بگویند ما مسلمانیم. اما همانطور که در قبل نیز گفته شد در این آیات معلوم میشود که مخالفان محمد او را به دلیل دیوانگی و عدم تعادل روانی اش رد میکردند و او بر خلاف آنچیزی که مسلمانان میگویند، یعنی به اینکه به امین و راستگو معروف باشد، بیشتر به دیوانه و خل بودن شهرت داشته است، البته بسیاری از دیوانه ها آدمهای راستگویی نیز هستند.

محمد حتی برای اثبات اینکه دیوانه نیست پا را فراتر نیز میگذارد، او آیاتی می آورد تا نشان دهد که مردم در مورد پیامبران پیشین نیز همینگونه فکر میکردند و اصولاً همه پیامبر ها دیوانه و خل و چل به نظر میرسند و دیوانه وار رفتار کردن از صفتهای پیامبران خدا است.

الذاريات آيه 52

كَذَلِكَ مَا أَتَى الَّذِينَ مِن قَبْلِهِم مِّن رَّسُولٍ إِلَّا قَالُوا سَاحِرٌ أَوْ مَجْنُونٌ.

اين گونه است كه هيچ پيامبرى قبل از اينها بسوى قومى فرستاده نشد مگر اينكه گفتند: (او ساحر است يا ديوانه‏!)

سوره القمر آيه 9

كَذَّبَتْ قَبْلَهُمْ قَوْمُ نُوحٍ فَكَذَّبُوا عَبْدَنَا وَقَالُوا مَجْنُونٌ وَازْدُجِرَ.

پيش از آنها قوم نوح تكذيب كردند، [آرى‏] بنده ما [نوح‏] را تكذيب كرده و گفتند: (او ديوانه است‏!) و [با انواع آزارها از ادامه رسالتش‏] بازداشته شد.

در اینکه نوح  نیز توسط مردم دیوانه و مجنون خطاب میشده است یا نه البته جای شک بسیار است، زیرا اساساً نمیتوان حتی یقین داشت که این شخصیت قرآنی و دینی، شخصیت ای تاریخی باشند، نوح احتمالاً کاملاً یک شخصیت افسانه ای است که از افسانه های بابلی مثل گیل گمش و غیره اقتباس شده است. اما اینکه محمد به یارانش گفته که باقی پیامبران نیز دیوانه به نظر می آمدند نکته درستی است. در هرکجای جهان اگر به بیمارستانهای روانی مراجعه کنید با خیل عظیمی از بیماران روانی که ادعا میکنند پیامبر، امام زمان، عیسی مسیح، و یا خود خدا هستند مقابل خواهید شد، چند سال پیش در یکی از وبلاگهای فارسی که خاطرات یک پزشک در آن نوشته میشد مطلبی توجه مرا به خود جلب کرد،

ياد يکی از جلسات ويزيت بيماران در بخش روانپزشکی افتادم.

يکی از با وفا ترين بيماران آن بخش يک بيمار اسکيزوفرن(پارانوئيد) بود. توهمات و هذيانهای او واقعا شنيدنی بود. اين بيمار جزء بيماران من نبود ولی وقتی انترن او صبح ها با او مصاحبه می کرد من هم می رفتم گوش می کردم. گاهی چنان سير هذيانهای او منسجم بود که تعجب می کرديم با وجود چنين ذهن آشفته ای چطور نتيجه گيری های منطقی می کند! اولين روزی که اين بيمار( آقای الف) وارد اتاق مشاوره شد بدون توقف به طرف يکی از انترن ها که به خاطر رينوپلاستی هنوز بانداژ بينيش را بر نداشته بود رفت و گفت: فايده نداره، ژنتيکيه ، بچت دماغش گنده ميشه! ما مات و مبهوت از اين همه هوش و ذکاوت !!مانده بوديم که به او گفتند بنشيند و به سؤالات جواب بدهد. او هم مؤدبانه نشست. اولين سؤال اين بود: شما قبلا در مورد اينکه خدا هستيد صحبت می کرديد. کمی راجع به اين موضوع صحبت کنيد.( لازم است به اين نکته اشاره کنم که در تمام اين جلسات يکی از روانپزشکان محترم می خوابيد. اشتباه نکنيد چرت نمی زد کاملا می خوابيد بطوری که اواسط جلسه از صدای خروپف ايشان ما از جا می پريديم. استاد ديگر هم يک روزنامه چپی می خواند و وقتی از ايشان می پر سيدند نظر شما چيست؟ با عجله می گفت: خوبه منم موافقم) خلاصه جناب بيمار با جديت پاسخ داد: نه، من قبلا خدا بودم ولی الان خسته شدم .فعلا مشاور خدا هستم. اساتيد همه ابراز رضايت می کردند از اين همه بهبودی بيمار!! بالاخره از خدايی به سمت مشاور رسيدن نوعی بهبودی به حساب می آمد! بعد از مشورت با يکديگر به دليل اصرار فراوان بيمار تصميم گرفتند که او را به مرخصی بفرستند. ۲ روز بعد بيمار را به دليل پرخاشگری به بيمارستان آوردند. وقتی از پدر بيمار سؤال شد که چرا دوباره بيمار را آورده اند گفت: به شدت هذيان می گويد. می گويد من امام زمان هستم . وقتی می گويم پسرم اين حرف ها را نزن، می گويد: نه! تو پدر من نيستی. پدر من امام حسن عسگری است! (1)

در گذشته نیز همینگونه بوده است، اگر کسی ناگهان شروع به صحبت کردن از جانوران نا آشکار میکرد و ادعا میکرد که از آنها پیغام میگیرد و حامل پیامی از سوی آنها است، انسانهای عاقل میفهمیدند که او دیوانه است، اما در گذشته تیمارستان وجود نداشته است که آدمهای دیوانه را در آن نگاهداری کنند، آدمهای دیوانه بین مردم پخش میشدند. جالب است که خود مسلمانان نیز اشخاصی را که بعد از محمد، ادعای پیامبری کرده اند، همچون بهاء الله و غیره را دیوانه خطاب میکنند. بنابر این شاید یکی از دلایلی که باعث میشد مردم گمان کنند محمد دیوانه است، این بود که او افکار دینی جدیدی را که برای اعراب مشرک آشنا نبود و محمد آنها را از یهودیان و صابئین و مسیحیان آموخته بود برایشان تعریف میکرد، و در مقابل تفکرات و رسوم اعراب مشرک مانند حج را برای یهودیان و صابئین و مسیحیان تعریف میکرد، و این باعث میشد که همه فکر کنند محمد دیوانه است، زیرا او تفکرات دینی جدید و ناشناخته ای برای هر دسته از مردم داشت که خود آنها را از دسته دیگری از مردم آموخته بود.

عاقلان آن دوران که در صف کافران بودند خیلی زود به این دیوانگی محمد پی بردند زیرا محمد نمیتوانست پیامبر بودن خود را به آنها اثبات کند، محمد خود در قرآن نشان میدهد که تمام پیامبران معجزاتی داشته اند اما وقتی مردم از او معجزه میخواستند او نمیتوانست معجزه ای نشانشان دهد. نضر بن حارث و ابوجهل از عاقلان آن دوران بودند، نام ابوجهل در اصل «ابو حکیمه» بوده است، اما محمد بخاطر عقده هایی که از او داشت او را ابوجهل نامید، ببینید تاریخ چگونه از برخورد این عاقلان با محمد روایت کرده است،

چون پیغمبر علیه السلام، چنین جواب ایشان باز داد و نومید شدند از آن که وی رضای ایشان خواهد گرفت، یا چیزی از ایشان قبول خواهد کردن، به اقتراح و سؤال در آمدند و گفتند: ای محمد، چون چنین است که تو میگوئی و تو پیغمبر خدائی و رسول بحثی و این دعوی که میکنی راست است، پس چنانکه خود میبینی، مکه جائی تنگ است و آبری و عمارتی ندارد، اکنون تو دعا بخدای کن و از حق تعالی درخواه، تا این کوههای مکه از جای بردارد و صحرائی فراخ در حوالی مکه بازدید آورد و چشمهای آب درآن (همچون سوریه و عراق) روان کند و رودها دران بباشد، همچنان که در زمین شمال و عراق گشوده است، تا ما بدان عمارت و زراعت میکنیم، و دیگر دعا کن و از خدای درخواه تا از أسلاف (پدران) ما قصی بن کلاب زنده گرداند و به ما صدق رسالت تو گواهی دهد، پس چون تو چنین بکرده باشی ما بتو ایمان آوریم. سید علیه السلام، گفت: مرا نه از بهر این فرستاده اند، که مرا از بهر آن فرستاده اند تا رسالت حق بشما گزارم، اگر قبول کردید، خیر دنیا و آخرت یافتید و اگر قبول نکنید، من صبر میکنم تا حق تعالی چه حکم میکند میان من و شما.

دیگر گفتند: ای محمد چون تو این نمیکنی و رضایت ما بدست نمی آوری، از خدای درخواه تا فرشته از آسمان بفرستد، تا بر صدق رسالت تو گواهی دهد و هرچه تو گوئی باورکنیم. سید، علیه السلام، گفت: مرا نه از بهر آن فرستاده اند. دیگر گفتند: ای محمد ما ترا مالی و ملکی نمیبینیم و تو هم چون مردم دیگر از بهر معاش ببازار میروی و این کار تو که دعوی میکنی، ضرورت آن اسبابی بکار میباید.، پس اگر از خدای درخواهی تا ترا گنجهای زر و سیم بدهد و أنهار (نهر ها) روان ترا بدهد و باغها و بستانها ترا بدست آورد، تا ثروت و نعمت تو از آن دیگران زیادت شود و فضل و مهتری تو بر همگان ظاهر شود، ما ایمان بتو آوریم و تصدیق رسالت تو کنیم. سید علیه السلام گفت: مرا از بهر این نفرستاده اند، مرا از بهر أدای رسالت فرستاده اند تا رسالت حث بشما گزارم، اگر قبول کردید خیر دنیا و آخرت شما را باشد و اگر نه صبر کنم تا حق تعالی چه حکم کند، و بدانید ای قوم، که این همه اقتراح که شما از من کردید، نزد حق تعالی سهل است، لکن مرا نفرموده است که این چنین از وی درخواهم.

آنگاه گفتند: ای محمد، چون این التماسها هیچ بجای نمی آوری، ما بر تو ایمان نمی آوریم و خداوند خود را بگوی تا از آسماان بر ما عذاب فرستد اگر قادر است و عذاب میتواند فرستادن، همچنانکه دعوی میکنی. سید علیه السلام، گفت: عذاب فرستادن به اختیار خداوند باز بسته است؛ اگر خواهد بفرستد و اگر نخواهد نفرستد. آگه گفتند ای محمد، خداوند تو نمیدانست که ما با تو این مجلس خواهیم ساختن و این سؤال خواهیم کردن تا ترا بیاموختی که جواب ما چگونه میباید دادن؟ و اگر ما بتو نگرویم و ایمان نیاوریم او بر سر ما چه عذاب خواهد فرستاد؟ و ترا از آن خبر دادی که ما را بچه عذاب گرفتار خواهد کرد. این همه بایستی که خداوند ترا از پیش خبر باز داده بودی، اگر چنانست که خداوند تو عالم الاسرار است و هیچ بر وی خافی نیست؛ ولکن ای محمد ما را گمان چنانست که این همه رحمان یمامه ترا می آموزد و تلقین میکند و ما به رحمان یمامه هرگز ایمان نخواهیم آوردن؛ و بدان ای محمد که بهر نوعی پیش رضای تو باز آمدیم و هرچه ما را بود از مال و جاه بر تو عرض کردیم، و تو هیچ از ما قبول نکردی و در بند رضای ما نشدی، و بهیچ نوع مراد ما نطلبیدی؛ اکنون ما إقامت (عذر) خود بنمودیم و ما را بیش از این طاقت تحمل نماند، و بعد ازین تدبیر آن کنیم که ترا هلاک کنیم یا تو مارا بهلاک آوری.  چون این سخن بگفتند: یکی برخاست و گفت ای محمد ما فرشتگان میپرستیم و ایشان دختران خدا اند. دیگری برخداست گفت: ای محمد ما بتو ایمان نیاوریم تا تو خدای و فریشتگان بگواهی بیاوری و گواهی دهند که تو پیغمبر خدایی.  و عبدالله بن ابی امیه که عمه زاده پیغمبر بود، برخاست و گفت، ای محمد، ما بتو ایمان نیاوریم تا آنگه که نردبانی بر آسمان نهی و بدان نردبان ببالا میروی و به آسمان روی و باز از آن جایگاه فرود آئی و با خود چهار گواه از فریشتگان بیاوری، تا گواهی دهند که تو پیغمبر خدائی، و چون این همه بکرده باشی مرا گمان چنانست که هم ایمان نیاوریم بتو. سید علیه السلام چون دید که قوم دست بغوغا آوردند و هریکی هرزهای آغاز کردند، دل تنگ شد و از پیش ایشان برخاست و بخانه بازرفت. (2)

انصافاً اگر کسی پیش شما بیاید و چنین ادعاهایی بکند و چنین رفتاری را نشان دهد شما غیر از اینکه فکر کنید طرف مقابل دیوانه است، آیا فکر دیگری نیز میکنید؟

اما قضیه به همین سادگی تمام نمیشود، پیامبر اسلام علاوه بر اینکه حرفهای دیوانه ها را میزده است و رفتاری دیوانه وار نیز داشته است، محمد تقریباً تمام ویژگیهای شخصی که به شدت بیمار است و انحرافات روانی دارد را داشته است، پیامبر اسلام از اینکه او را دیوانه خطاب بکنند بسیار ناراحت بوده است و از افسردگی میخواسته است خود کشی کند، تاریخ طبری در مورد این تلاش برای خودکشی اینگونه نوشته است:

میخواستم به بالای کوه بلندی بروم و خود را پایین پرت کنم، و با کشتن خود، خود را آسوده سازم. با این هدف به بالای کوه رفتم، وقتی که به میانه کوه رسیدم صدایی از آسمان شنیدم که میگفت «ای محمد تو رسول الله هستی و من جبرئيل‌ هستم». (3)

سایر کتابهای تاریخی همچون  سیرت رسول الله نیز این قضیه را گزارش کرده اند، محمد درست بعد از دریافت نخستین وحی قصد خود کشی داشته است، زیرا فکر میکرده است که دیوانه شده است!

پس من این بخواندم ، چون بخوانده بودم، جبرئیل علیه السلام، از پیش من برفت. من در حال از خواب باز آمدم و سورت اقرا تا آنجا که گفته بود از برداشتم و همچون نقشی بود که بر دل من کرده بودند. (حال در میان مخلوقات الله هیچکدام در نزد من از کاهنان و انسانهای دیوانه منفور تر نبودند، من حتی نمیتوانستم به آنها نگاه کنم. با خود اندیشیدم، نکند که من شاعر یا دیوانه ای باشم – مبادا که قریش هرگز چنین چیزی به من بگوید، من به بالای کوه خواهم رفت و خود را پایین خواهم انداخت تا کشته شوم و آرام گیرم، پس من رفتم و) بعد از آن من از غار برون رفتم و چون به میان کوه رسیدم آوازی شنیدم از جانب آسمان که میگفت «ای محمد توئی پیغمبر خدای و منم جبرئیل. (4)

آیا کسی که قصد خودکشی داشته است و چندین بار تلاش برای خود کشی کرده است دچار مشکلات عمیق روحی روانی نیست؟ دیوانه به چه کسی گفته میشود؟ مگر غیر از این است که دیوانه را عوام در آن دوران به کسانی میگفتند که تعادل روانی نداشتند و چنین حرکت هایی از آنها سر میزده است؟ امروزه کسانی که قصد خودکشی دارند را تحت درمان و مراقبتهای ویژه پزشکی قرار میدهند مسئله به قصد خود کشی محمد ختم نمیشود، محمد در هنگام دریافت وحی غش میکرده است، به قدیمی ترین گزارش تاریخی از شکل دیدار نخستین محمد با جبرئیل توجه کنید،

پیغمبر علیه السلام، حکایت کرد و گفت: شب بیست و چهارم از ماه رمضان خفته بودم و چشم من به خواب رفته بود که جبرئیل، علیه السلام در آمد و نامه ای در پاره ای دیباج سبز پیچیده بود و آن نامه بیرون آورد و مرا داد و گفت: بخوان. من گفتم: نمیتوانم خواندن. آنگه دست مرا بگرفت و سخت بفشرد، چنانکه هوش از من برفت، و بعد از آن دست از من بداشت و دیگر مرا گفت: بخوان، این نوبت از ترس گفتم» چه بخوانم گفت… (6)

بیهوش شدن محمد غیر از اینکه او مشکلات روانی داشته است و بیمار بوده است چه چیزی را میتواند نشان دهد؟ اینکه او دیوانه است! محمد خود نیز همینگونه فکر میکرده است کتاب الطبقات ابن سعد شرح داده است که محمد بعد از رسیدن به خانه اش، به خدیجه گفته است که گمان میکند دیوانه شده باشد،

ای خدیجه، نورهایی را میبینم و صداهایی را میشنوم، میترسم دیوانه شده باشم. (5)

در منابع دیگری، رفتار محمد در هنگام رسیدن به خانه پس از اولین «وحی» اینگونه توصیف شده است:

سپس رسول الله با وحی اش بازگشت، ماهیچه های گردنش از رعب و وحشت میلرزیدند، سپس او به خدیجه رسید و گفت «مرا بپوشان، مرا بپوشان» آنها او را پوشاندند و ترس او فروکش کرد، او گفت «ای خدیجه، مرا چه شده است (مشکل من چیست)؟ سپس هر آنچه بر او اتفاق افتاده بود را برای خدیجه گفت و سپس گفت، «میترسم اتفاقی برایم افتاده باشد». (8)

محمد خود نمیدانست که جبرئیل چیست و به او تلقین شد که جبرئیل یک فرشته است که وحی می آورد،

جبرئیل علیه السلام به قاعده خویش فرود آمدی و سید علیه السلام، او را بدیدی و سخن وی بشنیدی، لکن سید را علیه السلام، هنوز یقین نمیشد، که وی جبرئیل است و او را اندیشهای دیگر می افتاد و احوال خود با کس نمیگفت الا با خدیجه. یک روز از بس که متفکر بود پیش خدیجه رفت و گفت: یا خدیجه، من از این حالت خود میترسم و نمیدانم که این کیست که من او را میبینم؟ و این چیست که از وی همی شنوم؟ خدیجه گفت: ای ابن عم من، هیچ توانی که چون او پیش تو آید- یعنی جبرئیل، علیه السلام – تو ما را خبر دهی؟ سید علیه السلام گفت: بلی توانم  و این بار که بر من آید ترا خبر دهم. پس چون جبرئیل علیه السلام، در آمد خدیجه را خبر داد و گفت: یا خدیجه، اینک صاحب من آید که برابر بر من می آید، یعنی جبرئیل. آنگه خدیجه گفت: ای پسر عم من، برخیز و بر زانوی چپ من نشین. سید علیه السلام، برخواست و بزانوی چپ وی نشست. خدیجه او را گفت : اکنون او را میبینی؟ گفت: بلی. خدیجه گفت: با زانوی راست من نشین. سید علیه السلام برخواست و با زانوی راست وی نشست. گفت: اکنون او را میبینی؟ گفت: بلی. خدیجه گفت: برخیز و بر کنار من نشین. سید علیه السلام، برخاست و بر کنار وی نشست و خدیجه مقنعه از سر بیفگند، و موی خود مکشوف گردانید، در حال که او موی خود مکشوف گردانید، جبرئیل علیه اسلام غایب شد. دیگر پیغمبر را، علیه السلام گفت: او را میبینی؟ گفت: نه. پس خدیجه آواز برداشت و گفت: یا محمد، دل خوشدار که آنچه تو آن را میبینی فریشته است نه دیو، و آنچه تو از وی میشنوی وحی رحمان است نه وسواس شیطان. (7)

گفته اند این آزمایش از اینرو بوده است که فرشته با دیدن موی عریان زن شرم میکند و میرود اما دیو چون بی شرافت است موی عریان زن را نگاه میکند، از اینرو بوده است که خدیجه میخواسته است ببیند آنچه محمد میبیند فرشته است یا دیو، البته ممکن است توجه محمد وقتی خدیجه موهایش را افشان میکند به موهای خدیجه منحرف شده باشد و از روی همین تمرکز باشد که او دیگر آنچه قبلاً میدیده است را ندید.

به یک آدم نیمه دیوانه که در حال غش کردن خاطرات مغشوشی بر ذهنش باقی مانده است به سادگی میتوان با تلقین کردن فهماند که باباجان، تو پیامبری! محمد خود نمیدانسته است که چه دیده است و چه شده است، به او از طرف اطرافیانش تلقین میشود که به تو وحی میشود و آن چیزی که میبینی یک فرشته است! البته خدیجه خود از وحی و جبرئیل و غیره آگاهی نداشته است، این پسر عموی خدیجه ورقه ابن نوفل بوده است که با پیامبری و وحی و ادیان سامی بخوبی آشنا بوده است، ورقه به محمد بطور جدی قبل از اینکه ماجرای بالا اتفاق بیافتد تلقین میکند که او یک پیامبر است،

چون ورقه حکایت از سید، علیه السلام، بشنید، سوگند خورد و گفت: ای محمد، به آن خدایی که جان ورقه در ید قدرت اوست که آنچه تو دیدی جبرائیل بود همچنانکه از نزد حق تعالی بر موسی می آمد بر تو آمد و تو آنچه از وی شنیدی وحی خدای بود و تو پیغمبر آخر الزمانی و بهتر عالمیانی. (13)

شاید بعد از این تلقین ها بوده است که محمد نیمه دیوانه قوت قلب بیشتری میگیرد و با قطعیت میگوید که تجربه ای که او داشته است تجربه ای الهی بوده است و او واقعا یک پیامبر است.

سوره نجم آیات 1 تا 10.

وَالنَّجْمِ إِذَا هَوَى؛ مَا ضَلَّ صَاحِبُكُمْ وَمَا غَوَى؛ وَمَا يَنطِقُ عَنِ الْهَوَى؛ إِنْ هُوَ إِلَّا وَحْيٌ يُوحَى؛عَلَّمَهُ شَدِيدُ الْقُوَى؛ ذُو مِرَّةٍ فَاسْتَوَى؛ وَهُوَ بِالْأُفُقِ الْأَعْلَى؛ ثُمَّ دَنَا فَتَدَلَّى؛ فَكَانَ قَابَ قَوْسَيْنِ أَوْ أَدْنَى؛ فَأَوْحَى إِلَى عَبْدِهِ مَا أَوْحَى.

قسم به آن ستاره چون پنهان شد؛

که ، يار شما نه گمراه شده و نه به راه کج رفته است؛ و سخن از روی هوی نمی گويد؛ نيست اين سخن جز آنچه بدو وحی می شود؛ او را آن فرشته بس نيرومند تعليم داده است؛ صاحب نيرويی که استيلا يافت؛ و او به کناره بلند آسمان بود؛ سپس نزديک شد و بسيار نزديک شد؛ تا به قدر دو کمان ، يا نزديک تر؛ و خدا به بنده خود هر چه بايد وحی کند وحی کرد.

بدون شک ورقه ابن نوفل یکی از کسانی است که در پیامبری محمد نقشی کلیدی را بازی کرده است،  قسمت زیادی از ماجرای پیامبری محمد زیر سر ورقه ابن نوفل است، او از دانشمندان زمانش بوده است و انجیل و تورات را به عبری مینوشته است، چند روز بعد از اینکه محمد به اصطلاح نخستین وحی را میگیرد، ورقه ابن نوفل میمیرد، و مرگ ورقه همزمان میشود با قطع شدن وحی های «الهی»، محمد برای مدت حدود سه سال دیگر هیچ وحیی نمیگیرد، عجب تصادفی! اگر مرگ یک انسان موجب قطع شدن وحی محمد شود، چه نتیجه ای عقلانی میتوان غیر از این گرفت که منبع وحی در آن دوران همان انسان بوده است؟ محمد در این مدت که وحی قطع شده بود آنقدر افسرده و ناراحت بود که دوباره چندین بار قصد خود کشی داشته است، زیرا او فکر میکرد دیوانه شده است. محمد به بالای کوه میرفت تا خود کشی کند اما جبرئیل جلوی او را میگرفت(!) و میگفت محمد دلگیر نباش که تو پیامبر خدایی! شیخ صفی الرحمن المبارکپوری از برجسته ترین تاریخ  دانان مسلمان اینگونه نوشته است:

ابن سعد به اعتبار ابن عباس نقل کرده است که نزول وحی برای چند روز قطع شده بود [فتح الباری 1/27,12/360] بعد از مطالعات دقیق، به نظر میرسد ممکن ترین روایت این است که قطع شدن وحی به مدت سه سال و نیم طول کشید، البته برخی از علما با این روایت مخالفت کرده اند اما توضیح بیشتر در ایجا از حوصله خارج است.

در این زمان، پیامبر (ص) به گونه ای از افسردگی همراه با سرگشتگی و حیرانی دچار شده بود. بخاری روایت کرده است:

نزول وحی برای مدتی قطع شده بود و پیامبر بسیار ناراحت گشته بود، بنابر آنچه ما شنیده ایم، او چندین بار قصد داشت خود را از بالای کوه ها به پایین پرتاب کند و هربار که به بالای کوه میرفت تا خود را پایین بیاندازد، جبرئیل در مقابل او ظاهر میشد و میگفت «ای محمد! تو قطعاً رسول الله هستی!» بعد از آن قلبش آرام میگرفت و خود نیز آرام میشد و به خانه باز میگشت. هرگاه بین نزول وحی وقفه ای بلند می افتاد او باز هم، همینکار را میکرد، و جبرئیل بر او نازل شده و همان حرف را تکرار میکرد.  [صحیح بخاری 2/340] (14)

محمد وقتی وحی میگرفته است به حالت عجیبی میرسیده است، از احادیث بسیار متعددی میتوان ویژگیهای این حالت را یافت، صحیح بخاری معتبر ترین کتاب حدیث مسلمانان وحی گرفتن محمد را از قول کسانی که شاهد نازل شدن وحی بر او بوده اند اینگونه توصیف کرده است، محمد در هنگام وحی گرفتن:

ناگهان به زمین می افتاد، پوشینه پنجم شماره 170

چهره اش سرخ میشد، پوشینه دوم شماره 610

به سختی نفس میکشید، پوشینه ششم شماره 507

صدایی همچون صدای زنگ میشنید، پوشینه چهارم شماره 438

خرناس میکشید، پوشینه دوم شماره 610، مانند شتر خرناس میکشید، پوشینه سوم شماره 17،

رویش را میپوشاندند، پوشینه دوم شماره 610

عرق میکرد، پوشینه دوم شماره 544، پوشینه چهارم شماره 95،

محمد البته مقدار زیادی از وحی های خود را نیز در هنگام خواب میگرفته است، یا بهتر است بگوییم ادعا میکرده است که در هنگام خواب بر او وحی شده است و رویاهای او رویاهای صادقه بوده اند، اما مسئله جالب این است که محمد با خوابهای خود سر اعراب را نیز کلاه میگذاشته است، و به آنها دروغ میگفته است، مثلاً در روزی که قرار بود جنگ بدر اتفاق بیافتد محمد به مسلمانان میگوید که در خواب وحی گرفته است و الله تعداد دشمنان را کم تخمین زده است، محمد میدانسته است که اعراب حاضر نیستند با زبان خوش برای گزافه گوییهای او او با دشمنان اسلام که هم قبیله ای ها و حتی نزدیکان و خویشاوندانشان بودند بجنگند برای همین مجبور بوده است با دروغ و انواع و اقسام روشها آنها را گول بزند، البته چون سند این قضیه در خود قرآن است، از نظر مسلمانان، این خود خدا است سر اعراب را شیره می مالیده است،

سوره انفال آیه 43

اذ يريكهم الله في منامك قليلا ولو اراكهم كثيرا لفشلتم ولتنازعتم في الامر ولكن الله سلم انه عليم بذات الصدور.

در خواب، خدا شمارشان را به تو اندک نشان داد. اگر شمار آنها را بسیار نشان داده بود، از ترس ناتوان میشدید و در تصمیم به جنگ به مناقشه بر می خواستید، ولی خداوند شما را از دشمنان در امان داشت، که او به آنچه در دلهاست آگاه است.

صدام حسین در دادگاه خود حرف جالبی زد، او گفت اگر کسی دروغ بگوید، باز هم ممکن است دروغ بگوید! بنابر این اگر انسان دروغی را از شخصی میشنود باید بیش از پیش احتمال بدهد که آن شخص باز هم دروغ بگوید، مسلمانان در قرآنشان ثبت شده است که الله به برخی از مسلمانان دروغ گفته است تا آنها را به کار خاصی وا دارد، خود خدای اسلامگرایان نیز همچون خودشان فرومایه و فاسد الاخلاق است و دروغ مصلحتی میگوید از کجا معلوم این خدای بد سابقه باز هم همان کار را تکرار نکند و باز هم دروغ نگوید ظاهراً برای الله نیز هدف وسیله را توجیه میکند، تصور کنید بعد از مرگ الله به مسلمانان بگوید من با ارسال قرآن میخواستم شما را آزمایش کنم، آنهایی که آنقدر نادان بودند که به قرآن باور داشتند را به جهنم خواهم فرستاد و آنهایی که خردگرا بودند و قرآن را قبول نداشتند را به بهشت خواهم فرستاد، چنین کارهایی از الله مسلمانان (اگر وجود داشته باشد) کاملا قابل انتظار است، مسلمانان اگر در چنین موقعیت هایی قرار بگیرند چه خاکی به سرشان خواهند ریخت؟ عجیب جانور خداییست این الله! ریچارد داوکینز به درستی گفته است که خدای سامی مزخرف ترین شخصیت افسانه ای است که بشر تابحال در افسانه ها و اسطوره سازی هایش پدید آورده است. آیا خدا به انسان دروغ میگوید؟

خارج از این مسائل که محمد مطرح میکرده است، او پیش از اینکه پیامبر بشود و ادعای پیامبری کند نیز همینگونه یاوه گویی میکرده است و دیگران گمان میکردند او دیوانه است، او گفته است وقتی که کودک بود افرادی با لباس سفید آمدند و شکمش را پاره کردند و قلبش را در آوردند، باقی ماجرا را خود بخوانید،

ماجرا از زبان حلیمه، دایه محمد نقل میشود:

بعد از آن سید، علیه الصلوه والسلام، چون مدتی گذشته بود، روزی، بیرون خیمه رفته بود، گله بزغاله میچرانید و خود بازی میکرد با برادر دیگر که شیر یکدیگر خورده بودند (برادر رضاعی بودند)، ناگاه دیدم که برادرش فریاد برآورد و میدوید و میگفت: یا اماه، دو شخص آمدند و برادر قریشی مرا خوابانیدند و شکم وی بشکافتند و تازیانه ای چند بر وی زدند و اینک افتاده است. حلیمه گفت من و شوهرم بدویدیم و سید را، علیه السلام، دیدیم که افتاده بود و بترسیده بود و گونه رویش بگردیده بود. پس من او را بر گرفتم و بر سر و روی وی بوسه دادم و گفتم: جان مادر ترا چه افتاد؟ سید علیه السلام گفت: ای مادر، این ساعت دو شخص آمدند که جامهای اسفید داشتند و من را بخوابانیدند و شکم مرا بشکافتند و چیزی چند ازان برگرفتند و چیزی چند باز جای نهادند، ندانم که چه برگرفتند و چه باز جای نهادند و دیگر شکم من باز دوختند و برفتند. و آنگاه آن دو شخص جبرئیل و میکائیل بودند، اما سید علیه الصلوه و السلام، آنگاه نمیدانست. (9)

باید توجه کرد که برادر رضاعی محمد، این ماجرا را خود ندیده است بلکه آنچه محمد به او گفته است را بیان داشته است. جالب است که حلیمه و شوهرش بعد از اینکه این اتفاق می افتد محمد را به مادرش آمنه باز میگردانند، زیرا میفهمند که محمد دیوانه شده است یا به تعبیر ابن اسحق «دیو بر وی راه یافته است»، و آنها نمیخواستند که اگر این دیوانگی بلایی سر محمد بیاورد آنها مسئولش باشند،

چون سید علیه السلام این حالت برش افتاد، شوهرم گفت: ای زن، پیش از آن که این پسر واقعه دیگر برش افتد، او را باز پیش مادر بر، که من میترسم که دیو بر وی راه یافته است. پس چون شوهرم چنین گفت، او را بر گرفتم و باز مکه بردم پیش آمنه.  (10)

محمد بعدها وقتی بزرگ میشود این ماجرا را خود اینگونه نقل کرده است،

من آنم که در قبیله بنی سعد شیر خوارگی کردم و آن جایگه بپروردم و روزی بزغاله ای چند میچرانیدم، ناگاه دو شخص آمدند و جامهای سپید داشتند، یعنی جبرئیل و میکائیل علیهما السلام، و در دست ایشان طشتی زرین بود و آن طشت پر از برف رحمت بود، آنگاه بگرفتند مرا و بخوابانیدند و شکم من بشکافتند و دل من بیرون آوردند و گوشت پاره ای سیاه از آن بیرون کردند و بینداختند، و پس دل مرا در آن طشت نهادند و به آب رحمت بشستند و بعد از آن باز جای خود نهادند و شکم من باز دوختند و درست باز کردند. (11)

مترجم سیرت، «قلب» عربی را به «دل» فارسی ترجمه کرده است، این نکته قابل توجه است که محمد فکر میکرده است قلب انسان بجای مغز او جایگاه تفکر است و این مسئله در قرآن نیز دیده میشود (12)، طبری تاریخ نگار مشهور مسلمان دیگر از ابوذر نقل کرده است که آن دو فرشته بعد از باز کردن سینه محمد، قلب او را در آوردند و آلودگی های ناشی از شیطان که در قلبش بود و لخته خونی را که در قلبش بوده است در آورده اند، و بعد از اینکه او را ترک کردند مهری بر پشت او زدند (18)، محمد همواره از این مهر که خالی بین دو کتفش بوده است برای اثبات پیامبری اش استفاده میکرده است و این خال به مهر پیامبری او مشهور بوده است.  محمد البته بعدها نیز همان داستان را دوباره پیاده کرده است، اینبار جبرئیل سینه او را باز میکند و در آن عقل و ایمان میریزد!

صحیح البخاری؛ پوشینه اول ؛ شماره 345:

ابوذر روایت کرده است که محمد پیامبر الله ؛ اظهار داشت؛ هنگامی که من در مکه بودم؛ سقف اتاق خانه ام برداشته شد و جبرئیل در اتاق فرود آمد وسینه مرا پاره کرد و آنرا با آب زمزم شستشو داد. سپس؛ محتویات یک سینی طلایی را که پر از عقل و ایمان بود؛ در سینه من ریخت و پارگی آنرا بست.

دیدارهای محمد با جبرئیل چگونه بود؟ محمد بعضی اوقات جبرئیل را نشسته بر تختی میدید

صحیح بخاری، پوشینه 6 شماره 447

یکبار وقتی که راه میرفتم، ناگهان صدایی از آسمان شنیدم. به بالا نگاه کردم و در شگفت شدم، همان فرشته ای را که مرا در غار حرا دیده بود دیدم. او بر روی یک تخت بین زمین و آسمان نشسته بود. من از او ترسیدم، به خانه آمدم و گفتم مرا بپوشانید، مرا بپوشانید.

در برخی اوقات وقتی محمد وحی میگرفت خود را میپوشانید، یعنی پارچه ای بر سر خود میکشید، در قرآن نیز به این مسئله اشاره شده است، سوره المدثر با «یا ایها المدثر» آغاز میشود، یعنی «ای جامه به سر کشیده!» شاید باورکردنی نباشد ولی قدیمی ترین کتابهای تاریخی مسلمانان، معمولاً جبرئیل را نشسته بر روی یک خر وصف میکنند، در بسیاری از مواقع جبرئیل سوار بر خر، بر پیامبر اسلام نازل میشده است، اگر پیامبر اسلام امروز میزیست لابد جبرئیل را نشسته در اتومبیل رولزرویز میدید.

چون وقت نماز پیشین بود، جبرئیل علیه السلام بیامد و عمامه ای از استبرق در سر داشت و بر استری خنگ (خری سفید) نشسته بود و قطیفه دیباج (لباسی ابریشمی) برافگنده بود، (17)

عایشه همسر محمد نیز فکر کرده بود که محمد دیوانه شده است، او فکر میکرد با زنانش جماع کرده، در حالی که چنین نکرده بود. عایشه دیوانگی را با جادو و طلسم شدن بیان کرده است.

صحیح البخاری؛ پوشینه هفتم؛ شماره 658:

عایشه روایت کرده است که مردی به نام لبید بن الاعصم از طایفه بنی زریق؛ محمد را سحر می کرد و او را وادار می نمود تصور کند کاری انجام داده که در واقع آن کار از او سر نزده بود.

صحیح البخاری؛ پوشینه هفتم؛ شماره 660:

عایشه روایت کرده است که پیامبر الله؛ گاهی اوقات سحر و افسون می شد و فکر می کرد با همسرانش همخوابگی کرده؛ در حالیکه در واقع به چنین عملی دست نزده بود….. او در چنین زمانی زیر اثر سحر و افسون قرار می گرفت.

صحیح البخاری؛ پوشینه هفتم؛ شماره 661:

عایشه روایت کرده است؛ محمد پیامبر را چنان سحر و افسون می کردند که او فکر میکرد؛ کارهایی انجام داده که هیچگاه به آن کارها دست نزده بود.

وقتی محمد در بستر مرگ بود و کاغذی خواست تا وصیت کند، عمر گفت به او فشار آمده است و هذیان میگوید، برایش کاغذ نیاورید، این حدیث که به حدیث قرطاس (قرطاس یعنی کاغذ) معروف است  در منابع تاریخی زیادی ذکر شده است. (15)

نتیجه آنکه نه تنها افراد مخالفان محمد فکر میکردند او دیوانه است، بلکه نزدیکان او و حتی خود او نیز فکر میکرده است که دیوانه بوده است، دلایل و شواهد کافی تاریخی برای اینکه محمد یک دیوانه به نظر بیاید وجود دارد، حال پرسش این است که آیا اعراب درست میگفتند؟ دکتر مسعود انصاری در کتاب نگاهی نو به اسلام، این ویژگیهای محمد را به این نسبت داده است که او دچار به صرع بوده است، دکتر انصاری اینگونه در مورد صرع توضیح داده اند

صرع یک بیماری عصبی است که فرد مبتلا به آن دچار حمله های گاهگاهی میشود. این حمله ها که حالت تشنج در بیمار به وجود می آورد در نتیجه غیر عادی بودن امواج مغزی بوجود می آید. حمله های یاد شده بویژه در نتیجه فعالیت های بیش از اندازه گروهی از سلول های عصبی مغز ایجاد میگردد. این حمله ها به اشکال گوناگون به وجود می آیند که شدید ترین آنها با تشنج های سخت همراه بوده و حالات خفیف آن برخی تغییرات ناچیزی در منش فرد  مبتلا به وجود می آورند که برای دیگران غیر قابل مشاهده بوده و تنها خود بیمار آنرا حس خواهد کرد. بیماری صرع دست کم حاکی از آنست که در هنگام حمله بیماری، مغز از انجام وظیفه عادی باز ایستاده است. چون تمام اعمال و رفتار انسان از مغز او ناشی میشود، میتوان گفت که در هنگام حمله های صرع اندیشه گری و منش انسان به کاستی و بی نظمی خواهند گرائید. یکی از پژوهشگران مینویسد، بیماری صرع با ناتوانی مغزی همراه بوده و در بسیاری از مبتلایان به این بیماری تمایلات جنسی بسیار شدید بوده و سبب خواهد شد که بیمار برای ارضاء تمایلات جنسی خود به برخی اقدامات گستاخانه دست بزند. (16)

شما نیز اگر محمد را از نزدیک میدید و رفتار او را آنچنان که معتبر ترین و کهن ترین کتابهای تاریخی که برخی از آنها قدمتی بیش از هزار و چند صد سال دارند گزارش کرده اند میدید، احتمالاً به همین نتیجه میرسیدید که او یک دیوانه و مجنون است، البته این بستگی به این دارد که شما نیز آدم باهوشی باشید و یا اینکه مانند اعراب اطراف محمد از نادانان و ساده لوحان باشید. اعراب آن دوران مانند امروز نمیتوانستند بگویند «محمد انحراف روانی دارد»، آنها به زبان خود میگفتند «او ساحر، دیو زده، طلسم شده، کاهن و یا مجنون است».  اسلام از زمان محمد تاکنون توسط افراد بسیار زیادی از علما و فقها و فلاسفه گرفته تا ادیبان و غیره غنی سازی شده است. به همین دلیل است که مسلمانان چهره پنهان شده محمد در لابلای تاریخ را نمیبینند و از شناخت تاریخی و دقیق پیامبرشان بیم دارند. آیا به نظر شما اگر خداوند پیامبری را انتخاب کند و بخواهد توسط او پیامی را به شما برساند، او شخصی را که مجنون و دیوانه به نظر میرسد انتخاب میکند؟ آیا یک شخص دیوانه و دچار به صرع که پرت و پلا میگوید میتواند پیام آور خالق کائنات (اگر فرض کنیم وجود داشته باشد) باشد؟ آیا شما از شخصی که دیوانه به نظر میرسیده است، و شواهد تاریخی زیادی بر دیوانگی او شهادت میدهند پیروی میکنید؟ پاسخ این پرسش بر عهده شما!

منابع و توضیحات:

1) http://hakimejan.persianblog.com/1382_6_hakimejan_archive.htm

2) سیرت رسول الله ابن هشام انگلیسی برگ 134، سیرت فارسی پوشینه نخست برگ 271

3) At-Tabari, Tarikh al-Rasul Wa al-Muluk, Leiden, 1991, I, p. 1152

4) سیرت رسول الله ابن هشام انگلیسی برگ 106، سیرت فارسی پوشینه نخست برگ 209، ترجمه فارسی قصد خودکشی محمد را نقل نکرده است، کلمات داخل پرانتز ترجمه از متن انگلیسی سیرت است.

5) The Kitab al-Tabaqat al-Kabir, «Book of the Major Classes», by Ibn Sa’d, translated by S. Moinal Haq, p. 225

6) همانجا و صحیح بخاری پوشینه 1 کتاب 1 شماره 3.

7) همانجا برگ 212

8) صحیح بخاری پوشینه 6، کتاب 60 شماره 478

9) سیرت رسول الله ابن هشام فارسی پوشینه نخست برگ 149

10) همانجا، برگ 150

11) همانجا برگ 151

12) برای توضیحات بیشتر به نوشتاری با فرنام قلب جای تفکربخوانید.

13) سیرت رسول الله ابن هشام فارسی پوشینه نخست برگ 211

14) الرحیق المختوم، صفی الرحمن المبارکپوری، نسخه انگلیسی، دانشگاه اسلامی مدینه منوره، برگ 70، این ماجرا در بسیاری از کتابهای تاریخی مهم دیگر نیز آمده است، مثلا نگاه کنید به The History of Al Tabari, Volume VI, Muhammad at Mecca, State University of New York Press. P76

15) تاریخ طبری پوشینه 4 برگ 1320، صحیح بخاری 9.468، 7.573 و 5.716.

16) نگاهی نو به اسلام، دکتر مسعود انصاری، برگ 459.

17) سیرت رسول الله ابن هشام فارسی پوشینهپوشینه دوم برگ 751.

18)  The History of Al Tabari, Volume VI, Muhammad at Mecca, State University of New York Press. P75

تکامل چیست؟

نوشته آرش بیخدا

پیشگفتار:

تکامل یک مبحث بسیار گسترده و بزرگ در رشته زیست شناسی است و نوشتن در ارتباط با آن در تارنمایی که ارتباطی با رشته های علمی ندارد بسیار دشوار است، زیرا از طرفی مطالب نباید بسیار عمیق و پیچیده و فنی باشند، و از طرف دیگر نباید بسیار سطحی باشند. هدف از نوشتن این نوشتار بیشتر یک مقدمه است برای آشنایی با تئوری تکامل و رفع شدن سوء تفاهماتی که دین خویان در مورد تکامل ایجاد کرده اند، و همچنین بررسی کوتاهی از درگیری های موجود میان دین و بویژه اسلام با تئوری تکامل است، نه شرح و توضیح علمی و کامل نظریه تکامل. علاقه مندان میتوانند برای مطالعه بیشتر در مورد تکامل به بخش زیست شناسی کتابخانه دانشگاه های شهری که در آن زندگی میکنند مراجعه کنند. توصیه میکنم علاوه بر کتابهایی در مورد تکامل، بدنبال کتابهایی در مورد داستان آدم و حوا و خلقت انسان نیز بگردید. مطمئناً اگر کتابی در این زمینه پیدا کنید در بخش افسانه ها و داستانهای ننه قمر خواهد بود نه در بخش بیولوژی. آخرین بار که من برای مطالعه در مورد تکامل به کتابخانه رفتم دست خالی برگشتم زیرا انبوه کتابهای نوشته شده در مورد هر بخش کوچکی از تکامل، انتخاب یک کتاب را برای من بسیار دشوار کرده بود و من فرصت جستجوی طولانی را نداشتم.

در این نوشتار ابتدا تاریخچه کوتاهی از تکامل و نقش داروین در تئوری تکامل را بیان خواهم کرد و سپس به تعریف تکامل خواهم پرداخت، بعد از آن تکامل را از نگر رابطه آن با وجود خدا و دین بررسی خواهم کرد و اندکی به برخوردهای میان دین خویان و تکامل خواهم پرداخت و بعد هم چند شبهه عوامانه بسیار رایج از تکامل را مطرح کرده و پاسخ خواهم داد.

تاریخچه مختصری از تکامل و نقش داروین در تکامل:

تکامل یعنی اینکه انسانها از نسل میمون ها هستند. این ابتدائی ترین و خام ترین برداشتی است که ممکن است شخصی از تکامل داشته باشد و متاسفانه تنها اطلاعی که بسیاری از دین خویان از تکامل دارند همین است، که یک آدمی به نام داروین پیدا شده است و ثابت کرده است انسانها قبلاً میمون بوده اند. متاسفانه این برداشت نابخردانه تنها بین دین خویان و خرد باختگان که انتظاری بیش از این هم از آنها نمیرود رایج نیست، بلکه کسانی که بیخدا هستند نیز برخی اوقات چنین نظراتی را اعلام میکنند.

دوست کمونیست و کردی برای من تعریف میکرد که برای «هدایت» رهبر یکی از احزاب کردستان با او جلسه ای گذاشته بودند و میخواستند به او اثبات کنند که «انسانها از نسل میمون هستند»، او به آنها با درشتی برخورد کرده بود و گفته بود نه! کرد ها از نسل شیرند.

در بیان تاریخچه مختصری از تکامل باید گفت که داروین نخستین کسی نیست که تکامل را کشف کرد، هزاران سال پیش از داروین تئوری تکامل در افسانه ها و اسطوره های برخی از ملت ها وجود داشته است، مثلا هندو ها معتقد بوده اند حیات از آب شروع شده است و اولین موجودات ابتدا در آب شکل گرفتند و بعد به سایر موجودات تبدیل شدند. بعدها دانشمندان و فلاسفه ای مثل تالس تکامل را بصورت فرضیه های طبیعی برای توضیح علمی حیات مطرح کردند اما بررسی علمی و دقیق تکامل در دوران اخیر شکل گرفته است. پیش از داروین چند دانشمند دیگر مانند لامارک شخصی که زیست شناسی را به معنی امروزی اش بنا نهاد نیز در مورد تکامل مطالعاتی داشتند و نظریاتی را نیز ارائه داده بودند.  تفاوت اصلی میان نظریه تکامل لامارک با نظریه داروین در این بود که داروین تکامل را امری گروهی و مربوط به گونه های جانوری میداند ولی لامارک آنرا امری انفرادی میدانسته است، اما با این وجود، این داروین است که  پدر تکامل خوانده میشود زیرا درک مدرن ما از تکامل به تئوری گزینش طبیعی بر میگردد که چارلز داروین و آلفرد راسل والاس آنرا در سال 1858 در کتاب «مشاء انواع یا ریشه گونه ها» (Origin of species) مطرح کردند.

تعریف گزینش طبیعی:

بر اساس نظریه گزینش طبیعی، طبیعت موجوداتی که ویژگیهای مساعد برای نجات یافتن و ادامه حیات و تکثیر شدن را دارند را حفظ میکند و موجوداتی که این ویژگی ها و صفات را نداشته باشند تدریجا منقرض میشوند.

گزینش طبیعی در قیاس با گزینش مصنوعی نامگذاری شده است که در آن انسانها گونه خاصی از جانداران را که مورد نظر آنها است انتخاب میکنند و آنها را تکثیر میکنند، مثلا کشاورزان گندم را گزینش کرده و به تکثیر آن کمک میکنند و یا دامداران گاو را گزیده و با پرورش دادن آن به ادامه حیات و تکثیر آن یاری میرسانند، داروین معتقد بود طبیعت نیز چنین میکند، و موجوداتی که بتوانند خود را با شرایط زیستی همساز کنند احتمال ادامه یافتن حیاتشان از باقی جانداران بیشتر خواهد شد و برعکس، یعنی طبیعت نیز بصورت استعاره ای همچون آن کشاورز که گزینش مصنوعی میکند، موجوداتی را انتخاب میکند و باعث گسترش آنها میشود. مفهوم گزینش طبیعی همان تولید مثل افراقی است، یعنی بعضی از اعضای یک گونه بیش از سایر اعضا تولید مثل میکنند و در نتیجه میزان بیشتری از ژن آنها به نسل بعدی انتقال می یابد. گزینش طبیعی از مرکزی ترین یا شاید هم مرکزی ترین نکاتی است که بیولوژی امروزه بر روی آن تمرکز دارد.

داروین با بررسی آناتومی استخوان بدن جانورانی که جمع آوری کرده بود به این نتیجه رسید که شباهت بسیار زیادی در طرز شکل گیری این ساختمان استخوانها وجود دارد و در مورد انسان اعلام کرد که آناتومی بدن انسان با آناتومی بدن بوزینه (و نه میمون، ساختمان بدن میمون و گوریل و شامپانزه و بوزینه علی رغم تشابه ظاهری بسیار متفاوت است) بسیار شبیه است و نتیجه گرفت که انسان و بوزینه از یک تیره و از یک منشع تکاملی هستند (نه اینکه انسان قبلا بوزینه بوده است)، یعنی به تعبیری پسر عموهای یکدیگر هستند. نکته جالب این است که کلمه اورانگوتان که ریشه مالزیایی دارد به معنی «مرد جنگلی» است. داروین حدود 20 سال از انتشار تئوری خود، خودداری کرد و بعد از تحقیقات بسیار آنرا انتشار داد. خود کتاب داروین از آثار بسیار جالب علمی است، خواندن کتاب او به همه کسانی که علاقه مند به چنین موضوعاتی هستند توصیه میشود.

تکامل امروز با آنچه داروین کشف کرده بود بسیار متفاوت است و مانند هر موضوع دیگری دستخوش تغییرات گسترده شده است و خود تکامل یافته است. بنابر این داروین نخستین کاشف تکامل نیست، بلکه از کسانی است که بیشترین خدمت را به بیولوژی در این زمینه کرده است، داروین مبتکر نظریه گزینش طبیعی است و نظریه او از نظریاتی است که انقلابی را در دنیای علم راه انداختند.

تکامل چیست:

اگر  تاریخ زمین را بصورت یک تقویم 30 روزه از ابتدای بوجود آمدن زمین تا به امروز تصور کنیم. هر روز آن 150 میلیون سال خواهد بود. خواهیم دید که اولین سیستمهای زنده در روز  4ام این تقویم که برابر خواهد بود با تقریبا 4 میلیارد سال پیش بوجود آمدند. اولین سیستمهای زنده در واقع بسیار زود بدنیا آمدند. قدیمیترین فسیلهایی که یافت شده است در حدود 3.1 میلیارد سال پیش (27 امین روز) بوجود آمدند. بر اساس این تقویم اولین انسانهای واقعی چیزی حدود 10 دقیقه آخر این تقویم به دنیا آمدند و تاریخ ثبت شده بشری که به دوران سومری ها باز میگردد حدود 30 ثانیه آخری این تقویم را اشغال میکند. به این تقویم، تقویم زمین شناسی گفته میشود که نمونه ای بسیار مختصر از آن در زیر آمده است. علامت سوال به این معنی است که در دقت این روز در زمین شناسی تردید وجود دارد.

 تقویم زمین شناسی Geological Calander.منبع این اطلاعات یکی از کتابهای دانشگاهی رشته بیولوژی با مشخصات زیر است:

Life on Earth (Second Edition)Authors: Willson, Eisner, Briggs, Dickerson, Metzenberg, O’Brien, Susman, Boggs.
دوران ARCHEOZIC
دوران PROTEROZOIC
دوران PALEOZOIC
دوران MESOZOIC
دوران CENOZOIC
1 2
3 4اولین نظام زنده؟ 5 6 7اولین سلول؟ 8باکتری 9سرخسهای سبز و آبی
10قدیمیترین فسیلها(FIG TREE CHERT) 11 12 13 14 15 16
17 18 19 20 21 22 23
24اولین سلولهای EUCARYOTIC 25اولین حیوانات 26 27حیات آبزی(فسیلهای فراوان یافت شده است) 28اولین گیاهان روی خشکیاولین مهره داراناولین حیوانات روی خشکیاولین دوزیستان 29جنگلهای زغالی انبوهحشرات 30دایناسورها و اولین پرنده هااولین گیاهان گلدار
اولین پستانداران  و چیرگی خزندگان چیرگی پستانداران


حال

همانطور که در این تقویم نیز مشخص است، گونه های مختلف جانوری همگی به یکباره پا به زمین نگذاشته اند، بلکه به تدریج گونه های جدیدی در روی زمین بوجود آمده اند. وجود تک سلولی ها بر روی سیاره ای با شرایط مساعد برای حیات همچون زمین کافی است تا به بوجود آمدن پر سلولی ها، نرم تنان، بی مهرگان، دو زیستان، پستانداران و در نهایت انسان بیانجامد. این تقویم تنها موجوداتی که پا به روی زمین گذاشته اند را نشان میدهد، جالب است بدانید دانشمندان معتقدند تعداد گونه های جانوری که هم اکنون بر روی زمین وجود دارند کمتر از یک دهم 1% تمام گونه های جانوری است که تابحال روی زمین زیسته اند.  باید توجه داشت که تئوری تکامل به نحوه پیدایش حیات و تک سلولی های نخستین ارتباط چندانی ندارد، بلکه به چگونگی ادامه حیات ارتباط دارد، برای توضیح چگونگی شکل گیری حیات تئوریهای دیگری همچون آزمایش میلر یولر مورد بررسی قرار گرفته اند. حال تکامل نظریه ای است که میتواند به ما در فهم اینکه چگونه گونه های جانوری جدید بر روی زمین پدیدار میشود و برخی جانداران نیز از روی زمین محو میشوند کمک میکند.

تعریف تکامل:

تکامل در بیولوژی، به پروسه ای اطلاق میشود که بر اساس آن، جمعیت گونه ها با ویژگیهای برتر وراثتی افزایش می یابند و از نسلی به نسل بعدی منتقل میشوند. در طول زمان این ویژگیها به گونه جانوری کمک میکنند که به تعداد بیشتری نسبت به گونه های رقیب تکثیر بیابند و در جمعیت بر آنها تسلط بیابند. اتفاق افتادن این پروسه در مدت های طولانی میتواند پدید آمدن موجودات جدید را توضیح دهد.

بر اساس تئوری تکامل موجودات جدید تر همگی اجداد مشترکی دارند، و برای نشان دادن این شراکت در اجداد، معمولا از درختواره های فیلوژنتیکی (Phylogenetic tree) استفاده میشود، بعنوان مثال درختواره زیر (برای بزرگ شدن روی آن کلیک کنید) ارتباط حیوانات با گیاهان و سایر موجودات را نشان میدهد.

منبع تصویر + (تارنمای دانشگاه ایالت فلوریدا)

فسیلهای باقیمانده از اجداد انسانها به خوبی نشان میدهد که ساختار بدن آنها با بدن انسانهای امروزی بسیار متفاوت هستند و اکتشافات در این مورد بسیار گسترده بوده است و شاید آخرین آنها کشف آدمها با ساختمان بدنی کوچکتر و جمجمه کوچکتر اشاره کرد که در اکتبر 2004 در جزیره فلورز یافت شد (منبع خبر +) اما امروز بالاخره با پیشرفت ژنتیک دیگر نیازی به پیدا کردن استخوان ها و فسیل ها برای اثبات تئوری تکامل وجود ندارد، پیشرفت علوم مارا برای بررسی تکامل از یافتن فسیل ها و باقیمانده های جانوران تقریباً بی نیاز میکنند، هرچند گنجینه بسیار غنی از فسیلها امروز از لحاظ شهودی نیز راه را برای مشاهده تکامل جانوران بسیار هموار میکند.

یافته ها در مورد فسیل ها بسیار پرارزش هستند اما باید توجه کرد که باقی ماندن یک جانور بصورت فسیلی امری بسیار نادر است چون معمولاً شرایط بسیار خاص و دقیقی باید شکل بگیرد که جانوری بصورت فسیل باقی بماند، مثلاً جسد آن جانور باید بر اثر اتفاقات خاصی در لجن مدفون شده باشد و هزاران عامل دیگر باید وجود داشته باشند که از جانوری فسیل باقی بماند. بنابر این ایرادی که برخی از دین خویان به تکامل وارد میکنند، مبنی بر اینکه فسیل های کافی برای اثبات تکامل یافته نشده است، حتی اگر چنین فرضی را درست فرض کنیم نیز ایرادی معتبر نخواهد بود.

همانطور که گفته شد توسعه و پیشرفت در ژنتیک درهای جدیدی را برای فهم تکامل باز کرده است، بگونه ای  که امروز مطالعات ژنتیکی پایه درک ما از تکامل هستند، یعنی بهترین توضیحات و توجیهات را برای بررسی موضوعات مختلف در ارتباط با تکامل را میتوان از دیدگاه ژنتیکی دریافت کرد. اطلاعات ژنتیکی که دستورالعمل های ساخت سلول هستند را امروز میتوان در هر موجودی مانند یک کتاب باز کرد و خواند. و همین تحقیقات ژنتیکی امروز نشان میدهد که 99% ژنهای انسان و بوزینه کاملا مشترک هستند و تفاوت بیولوژیکی میان انسانها و بوزینه ها در همان 1% است که باهم اختلاف دارند، بنابر این تحقیقات امروزی هم تئوری داروین را که با بررسی و مشاهده استخوانهای جانوران توسعه یافته بود، تایید میکنند. برای توضیح بیشتر در این مورد ابتدا باید اندکی با DNA آشنا شویم. در مورد DNA بطور مفصل در نوشته ای با فرنام (بنیاد و شالوده حیات، حیات چگونه آغاز میشود ؟) توضیحات کافی داده شده است و در اینجا تنها بطور مختصر در مورد آن توضیحاتی داده خواهد شد.

DNA یک مولکول بلند است که از زنجیره ای از واحدهای کوچکتر بیوپولیمر (واحدهای مرکبی که در سلول های زنده پیدا میشوند، مانند پروتئین ها، اسید نوکلئید ها و یا کربوهیدراتها ) تشکیل شده اند. اگر تمام DNA های انسان در کنار هم قرار گیرند و انتهایشان به ابتدای دیگری متصل شود رشته ای به طول تقریبی 175 سانتیمتر ضخامتی کمتر از یک میلیونیم سانتیمتر حاصل میشود. اگر ضخامت و طول این رشته را بصورت متناسب به ضخامت یک رشته سیم ویولون افزایش دهیم، طول رشته به حدود 9 مایل خواهد رسید. در درون سلول این مولکولهای بلند دو به دو با هم پیچ میخورند و یک RNA را تشکیل میدهند. این رشته ها بوسیله پیوند هایی شیمیایی ای متشکل از فسفر و نوعی قند که بین این دو رشته وجود دارد به هم پیوسته میشوند. این پیوندها در واقع از یک بدنه و یک پایه تشکیل شده اند،  دو نوع پایه در این پیوند ها وجود دارد که پورین و پریمیدین نامیده میشوند. هر کدام از این دو نوع پایه خود دو نوع دیگر دارند، این پایه ها با توجه به نوع مواد شیمیایی بکار رفته در آنها دسته بندی شده اند.

  • پورین ها (Purines) خود به  دو دسته دیگر تقسیم میشوند:

1. آدنین (Adenine) که با حرف A نمایش داده میشوند.

2. گانین  (Guanine) که با حرف G نمایش داده میشوند.

  • و پریمیدین ها (Pyrimidines) نیز خود به دو دسته دیگر تقسیم میشوند:

3. تیمین (Thymine) که با حرف T نمایش داده میشوند.

4. سیتوزین (Cytosine) که با حرف C نمایش داده میشوند.

بنابر این ما 4 نوع پایه داریم که اینها یک سیستم عددی مبنای 4 را برای تبادل اطلاعات بین مولکول ها بر عهده دارند.  بنابر این اطلاعات DNA یک موجود را میتوان همچون رشته ای از اطلاعات صفر و یک کامپیوتری (مبنای دو که تمام دستگاه های دیجیتال از آن استفاده میکنند) همچون کتابی خواند، با این تفاوت که الفبای  DNA تنها از 4 حرف تشکیل شده است. بعنوان مثال رشته زیر را میتوان حاوی اطلاعاتی دانست که از سلولی به سلول دیگر منتقل شده است.

ATAATTCGTTCAAGGGCTATATGCCGTTTAAAACGT

واحد های تولید کننده و نوع مواد تشکیل دهنده DNA تقریباً در تمامی موجودات روی کره زمین (به استثنای چند ویروس که مواد دیگری DNA آنها را تشکیل میدهند) مشترک و دقیقا شبیه یکدیگر هستند. این موضوع خود نشان میدهد که تمامی این DNA ها ریشه های مشترک دارند و از یک جا برخاسته اند و از DNA اولیه ای که شکل گرفته است مشتق شده اند. اما بطور مشخص و واضحی اطلاعات DNA یک انسان سیاه پوست با یک انسان سفید پوست تفاوت هایی دارد و میان DNA یک انسان با یک گیاه تفاوت های بسیار بیشتری وجود دارد و یا اطلاعات میان DNA یک انسان و یک بوزینه 99% مشابه یکدیگر است. و البته میان DNA افرادی که از یک خانواده هستند تفاوت اطلاعات بسیار ناچیز تر است از تفاوت DNA بین دو غریبه. میان DNA زن و مرد نیز تفاوت هایی وجود دارد.  تشابه میان اطلاعات ژنتیکی انسان و بوزینه نظریه داروین مبتنی بر ارتباط انسانها و بوزینه ها را که از روی مشاهده فیزیولوژیکی بدن بوزینه انجام گرفته بود تایید میکند. بطور کلی برای نشان دادن اینکه انسان چگونه تکامل یافته است، دو درختواره توصیه میشود، که هر دو آنها را میتوانید در زیر ببینید.

میمون اورانگوتان گوریل بوزینه انسان
میمون اورانگوتان گوریل بوزینه انسان

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

همانگونه که گفته شد تکامل ارتباط مستقیمی با ژنتیک دارد، DNA در واقع دستور العمل های مهندسی ای را داراست که دستور العمل ساخت سلول را به مهندس های موجودات زنده یعنی پروتئین ها منتقل میکند و پروتئین ها با دقت تمام این دستور العمل ها را پیاده میکنند و نتیجه یک سلول با فعالیت دقیقاً مشخص و با ظرافت تمام است. همانطور که نوشته های الفبای مبنای 32 زبان فارسی از نقطه ها و کلمات و فاصله ها تشکیل شده است، الفبای مبنای 4 ژنتیکی نیز از حالت مشابهی پیروی میکنند و الفبای خاص خود را دارند.

همانطور که گفته شد DNA ها خود نیز از پروتئین های کوچکتری که خود متشکل از آمینو اسید ها هستند ساخته شده اند و تعداد کل انواع آمینو اسید ها در سلولهای بدن 20 نوع است. در یک زبان مبنای 4 برای نامیدن هرکدام از این 20 نوع آمینو اسید تنها 3 حرف نیاز است و 64  (4 * 4 * 4) کلمه 3 حرفی مختلف را میتوان با ترکیب این الفبای چهار حرفی ژنتیکی تشکیل داد. اما در موجودات زنده تنها از 16 نوع کلمه سه حرفی متشکل از این حروف الفبای مبنای 4 استفاده میشود که به هر کدام اصطلاحا کودون (Codon) میگویند. شکل زیر این مفهوم را به تصویر کشیده است.

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

هر کدام از این کودون ها معنی مشخصی دارند و همه آنها امروز شناخته شده اند و معانی آنها نیز تفسیر شده است. بعضی از این کودون ها نقش آغاز و پایان یک پیغام ژنتیکی را بازی میکنند. شکل این پایه ها بگونه ای است که تنها میتوانند با پایه مشخصی توسط پیوند های هیدروژنی ترکیب شوند و ارتباط برقرار کنند، مثلا هروقت در یک شاخه A وجود داشته باشد، حتماً باید در طرف دیگر T وجود داشته باشد. پیوستن A با C مانند این است که کسی تلاش کند یک دوشاخه را به یک پریز که سه سوراخ دارد وصل کند، این اتفاق غیر ممکن نیست اما بسیار دشوار است و بسیار کم اتفاق می افتد.

A با T پیوند میخورد

C با G پیوند میخورد

منبع تصویر The First Chimpanzee In Search of Human Origins, by John Gribbin and Jeremy Cherfas

این است که در واقع وقتی سلولی میخواهد تکثیر شود، در بین دو رشته ای که اطلاعات DNA آنرا تشکیل میدهند شکافی ایجاد میشود. چون A تنها با T و C تنها با G ارتباط برقرار میکند، این دو رشته از هم شکافته شده دقیقا اطلاعات مشترکی را حمل میکنند و مانند این است که قرینه یکدیگر باشند، بعد ازجدا شدن این دو شاخه وقتی DNA جدید درون فضایی پر از انواع و اقسام آمینو اسید ها قرار میگیرد به سرعت جفت های خود را جذب میکند، و دوباره به یک شکل نردبان پیچ خورده دو شاخه ای مانند آنچه قبلا در سلول قبلی بوده است تبدیل میشود و در این پروسه است که دستور العمل های ساخت سلول از سلولی به سلول دیگر منتقل میشوند. اطلاعات ترتیب یافته به سبک اطلاعات ژنتیکی در واقع حاوی تمام مشخصات موجود جدیدی است که باید شکل گیرد، این اطلاعات در میان تمام جانوران از والد به فرزند انتقال می یابند و در بدن فرزند دوباره شبیه سازی میشود.

حال بصورت تصادفی و بر اثر برخی علت های دیگر گاهی اوقات این اطلاعات ژنتیکی بواسطه یک جهش ژنتیکی تغییر پیدا میکنند. اگر جهش ژنتیکی وجود نداشته باشد تمامی موجودات دقیقاً شبیه یکدیگر خواهند بود. این تغییرات ژنتیکی یکی از عوامل تکامل هستند و عامل دیگر نیز شرایط زیستی در محیطی است که این جانداران در آن زندگی میکنند. تغییرات زیست محیطی باعث میشوند موجوداتی که سازگارتر با محیط هستند نجات پیدا کنند و موجوداتی که سازگاری با محیط ندارند نابود شوند. برای اینکه این مسئله بهتر درک شود به مثالی توجه کنید:

در جنوب غربی ایالات متحده امریکا زمینهای شنی وجود داشت که رنگ زرد داشتند، تا اینکه آتشفشانی فوران میکند و مواد مذاب روی سطح شن ها را فرا میگیرند، بعد از اینکه این مواد مذاب سرد میشوند سطح این زمین زرد رنگ به سنگهای تیره تبدیل میشود، موشهای زرد رنگی که رنگ زمین شنی پیش از فوران آتشفشان در آن زمین ها زندگی میکردند به این منطقه جدید باز میگردند، هر 1000 سال یکبار یک موش سیاه رنگ بر اساس تصادفات (جهش) ژنتیکی ایجاد میشود، اگر فرض کنیم در صورتی که سیاه بودن یک موش  یک صدم درصد احتمال بقای آن موش را نسبت به موشهای زرد بیشتر بکند، زیرا جغدهایی که در آن منطقه وجود دارند میتوانند موش های زرد رنگ را به دلیل اینکه نمیتوانند خود را بر روی سنگ های سیاه استتار کنند به سادگی شکار میکنند، در حالی که موش های سیاه میتوانند بسیار ساده تر خود را از دید شکارچیان پنهان کنند، در نتیجه جمعیت موشهای سیاه به تدریج بیشتر میشود و جمعیت موشهای زرد کمتر و کمتر میشود، بعد از حدود 1000 نسل از زاد و ولد این گونه جانوری جمعیت موشهای سیاه به نود و پنج درصد کل جمعیت موشها تبدیل میشود. در این مثال یک موش سیاه به دلیل تغییری که برای نجات در مورد او تحقق افتاده است پس از 1000 نسل به اکثریت آن گونه جانوری تبدیل میشود. حال اگر فرض کنیم آن امتیاز از یک صدم درصد به ده درصد تبدیل شود این وضعیت در 100 نسل تحقق خواهد یافت، و تحقیقات نشان داده است که این عدد حتی بیش از ده درصد است. در واقعیت این تغییر جمعیت و تکامل ممکن است در صد سال اتفاق بیافتد.

میبینیم که در مثال بالا که یک مورد کوچک از تکامل است، هر دو عامل، یعنی شانس و همچنین شرایط زیستی چگونه باعث تکامل یافتن این موجودات میشود. تغییرات متعدد به مرور زمان منجر به شکل گیری گونه های جدید بسیار متفاوت با گونه های پیشین میشود و تکامل همیشه ادامه پیدا میکند، در نتیجه همه جانداران در هر زمان و مکانی همواره در حال تکامل یافتن هستند.

تکامل و ارتباط آن با دین و خدا:

یکی از مسائلی که باعث میشود دین داران با این تئوری علمی در جنگ باشند این است که تکامل نشان میدهد انسانها از نگر بیولوژیکی آنچنان موجودات متفاوتی از سایر جانداران نیستند، اما  بر اساس باورهای دینی انسانها اشرف مخلوقات هستند و جهان برای انسانها آفریده شده است (به این دیدگاه انتروسنتریسم «Anthropocentrism» گفته میشود)، اما تئوری تکامل و سایر واقعیت های طبیعی نشان میدهند که اینگونه نیست و این انسان است که بگونه ای سازگار با طبیعت تکامل یافته است. دلیل دشمنی دین داران با کشف شدن اینکه زمین مرکز کائنات نیست نیز همین بود، باورهای دینی به آنها آموخته بود که زمین مهمترین عنصر تمام کائنات است (به این دیدگاه ژئوسنتریسم Geocentrism گفته میشود) و اگر اینچنین نبود از نظر آنها دیگر لابد انسان نیز مهمترین موجود نبود و اتفاقا بعدها هم همان تکامل نشان داد که اینگونه است و انسان نیز از لحاظ بیولوژیکی و طبیعی یک حیوان است. برخی از دین داران گمان میکنند این واقعیت توهین به بشر است که به او گفته شود تو نیز یک قسمتی از طبیعت هستی و صاحب طبیعت نیستی و ابر و باد و مه و خورشید برای تو در کار نیستند. حتی برخی از نادانترین دینگرایان این را اثباتی بر درستی دینشان قرار داده اند، یعنی مثلاً گفته اند تکامل باطل است زیرا انسان را پایین می آورد و دین درست است زیرا انسان را بالا میبرد، و این چیزی جز مغلطه توسل به نتیجه باور نیست، یعنی از روی خوبی و بدی نمیتوان درستی و یا نادرستی یک قضیه را اثبات کرد، این «استدلال» خداباوران به این معنی است که انگار هر نظریه ای که جایگاه بالاتری به انسان بدهد، آن قضیه درست تر است، اگر این قضیه نابخردانه درست باشد، میتوان گفت خدا نوکر و بنده انسان است، زیرا در این صورت انسان جایگاهش بسیار بالاتر خواهد بود، و دین داران با اینکه میگویند انسان بنده خدا است به بشر توهین میکنند، این دو «استدلال» به یک اندازه مضحک هستند.

دیگر مسئله ای که باعث دشمنی دینداران با تئوری تکامل شده است داستانها و اسطوره های خلقت مانند قصه آدم و حوا است که بنیادگرایان دینی برداشتی واقع انگارانه از آنها دارند، یعنی معتقدند واقعا چنین اتفاقهایی افتاده است و روشن است که این داستانها در صورت درست بودن تئوری تکامل تنها به قصه هایی تبدیل میشوند که واقعیت خارجی نداشته اند. در ادبیات تمام ملتها معمولا اسطوره های خلقت یافت میشوند، مثلا در اسطوره های ایرانی داستان مشیه و مشیانه وجود دارد. داستان آدم و حوا نیز تنها یک داستان محلی اینچنین در میان یهودیان بوده است که مسلمانان گمان میکنند چون در قرآن است باید حقیقت مطلق باشد. این دیدگاه از طرف دینداران مدرنتر مورد تایید است، مثلا پاپ ژان پل دوم اعلام کرده بود که داستان آدم و حوا میتواند تنها یک داستان آموزنده باشد، و تکامل ممکن است درست باشد، اگر تکامل درست باشد لزوماً لطمه ای به انجیل و تورات نمیخورد. اما مسیحیان و مسلمانان و یهودیان بنیادگرا با برداشتهای لیبرالتر از داستانهای دینی توافق ندارند در کنار تکامل سعی کرده اند تئوری (!) های دیگری همچون تنظیم هوشمند (Intelligent Design) و یا خلقت علمی (Creationist science) پدید آورده اند که این دیدگاه ها در مجامع علمی مورد قبول نبوده اند و در دادگاه های مختلف در کشورهای مختلف طرفداران تدریس این مفاهیم محکوم به دروغگویی و تلاش برای علمی جلوه دادن اباطیل دینیشان شده اند.

عده ای گمان میکنند تکامل ضد وجود خدا است و سازگاری با وجود خدا ندارد، برداشت این عده ناشی از درک ضعیف آنها از مسئله علیت است، این افراد گمان میکنند که اگر همه چیز در مورد حیات با تئوری ها و علتهای طبیعی قابل توضیح باشد دیگر نمیتوان برای خدا نقشی را در نظر گرفت، بعبارت دیگر این عده برای خدا بدنبال علت عرضی میگردند. بطور کلی نه تئوری تکامل نه هیچ تئوری علمی دیگری نمیتواند عدم وجود خدا را اثبات کند، اثبات عدم وجود خدا مسئله ای کاملاً فلسفی است نه علمی زیرا خداوند در صورتی که وجود داشته باشد میتواند علتی طولی باشد، در این مورد در نوشتاری با فرنام «خدای حفره ها چیست؟» توضیحات کامل آورده شده است، بنابر این تکامل به هیچ عنوان تئوری نیست که درستی آن عدم وجود خدا را اثبات کند و کمتر فیلسوف بیخدایی است که از تکامل بدین شکل سود جسته باشد، مگر آنکه در رد  برهان نظم از آن برای نشان دادن اینکه تئوری تکامل لزوماً نیازی به علت عرضی الهی ندارد استفاده کرده باشد، اما این ناسازگاری تنها بین خدای فلسفی (خداوند چیست؟) است که وجود ندارد، بین خدای دینی، مثلا خدای اسلام و تکامل ممکن است اختلاف نظر وجود داشته باشد، زیرا خدای اسلام گفته است که بشر بصورت خلقت آدم و حوا بوجود آمده است و آدم تکامل یافته نبوده بلکه از خاک پدید آمده است و این کاملا در تناقض با نظریه تکامل است. نتیجه آنکه استفاده از تئوری تکامل برای اثبات عدم وجود خدا بصورت عام آن جایز و درست نیست اما استفاده از این تئوری برای رد وجود خداهای خاصی مثل خدای اسلام ممکن است درست باشد و وحشت دین خویان از این تئوری نیز ممکن است دلیلی موجه داشته باشد.

اما از این گذشته تکامل بدون شک به گسترش بیخدایی کمک کرده است، در فلسفه روشی وجود دارد که معروف به «تیغ اوکام» (Occam’s Razor) است. بر اساس این روش وقتی توضیحات کافی برای توضیح یک قضیه وجود داشته باشد، توضیحات اضافی دیگر که در توضیح آن قضیه تغییری ایجاد نمیکنند اهمیتی پیدا نمیکنند و حتی نادیده گرفته میشوند، از این روش معمولا بیشتر در بررسی نظریه های طبیعی استفاده میشود. دلیل این نامگذاری نیز این است که این روش همچون یک تیغ توضیحات اضافی در مورد هر قضیه را میبرد و اوکام نیز نام منطق دان انگلیسی بوده است که این روش را معرفی کرده است. در بررسی مسئله روح مثالی را مطرح کردم که در اینجا نیز آنرا تکرار میکنم. تصور کنید عده ای به موجودی نامرئی و غیر مادی به نام «گوراگورا اعتقاد داشته باشند و ادعا کنند گوراگورا موجودی است که در هنگام عطسه کردن نزد انسانها می آید و انسانها را میبوسد. و بوسه او سبب عطسه انسانها میشود. هیچ کس نمیتواند گوراگورا را ببیند و یا او را لمس کند. حال آیا کسی میتواند اثبات کند که گوراگورا وجود ندارد؟ این باورمندان به گوراگورا ممکن است به شما بگویند هر گاه او شما را ببوسد شما عطسه کرده اید و هر گاه شما را نبوسد عطسه نخواهید کرد، و اگر شما این باور آنها را انکار کنید، آنها از شما خواهند پرسید، پس انسان برای چه عطسه میکند؟ اگر دلیلی علمی برای عطسه پیدا کنید و به آنها بگویید که عطسه کردن به این دلیل و به آن دلیل علمی است که اتفاق می افتد، ممکن است معتقدان به گوراگورا به شما بگویند «خوب ما نیز منکر این دلایل علمی نیستیم، اما گوراگورا هم همزمان با آن دلایل علمی شما را میبوسد، و اگر گوراگورا وجود نداشته باشد و شما را نبوسد شما هرگز عطسه نخواهید کرد.» حال برای دانشمندی که قضیه عطسه کردن را بررسی میکند، یافتن دلایل علمی عطسه کردن کافی هستند و او هیچ توضیح اضافی در مورد گوراگورا را نخواهد پذیرفت. ارتباط تکامل با خدا نیز بسیار مشابه با همین مثال است. اعتقاد به اینکه خدا باعث تکامل شده است همانقدر خردمندانه است که اعتقاد به اینکه گوراگرا باعث عطسه کردن میشود خردمندانه است. اما به نظر من هرگز نمیتوان از تکامل علیه وجود خدا بطور قطعی استفاده کرد.

برخی از خداباوران معتقدند تکامل نیز به دلیل پیچیدگی و نظمی که درون خود دارد نمیتواند بدون نظارت خدا ممکن باشد، این «استدلال» بسیار شبیه به برهان نظم است و در رد برهان نظم به اندازه کافی در دفاع از بطلان بودن این استدلال صحبت شده است.

شبهات رایج در مورد تکامل:

بعد از این توضیحات مختصر راجع به تکامل اکنون شایسته است به برخی از شبهات رایج که در مورد تکامل مطرح میشود و معمولا ناشی از سوء تفاهماتی است که در اذهان اشخاص پیش می آید بپردازیم. در این بخش به دو شبهه بسیار رایج در مورد تکامل خواهیم پرداخت.

تکامل هنوز اثبات نشده است و تنها یک نظریه است:

این اعتراض از رایج ترین اعتراضاتی است که عوام نسبت به تکامل مطرح میکنند. این افراد نمیدانند که در دنیای علم هیچ مفهومی بالاتر از تئوری نمیرود و تئوری بالاترین مرحله ایست که یک نظر علمی میتواند داشته باشد. بسیاری از سایر مفاهیم علمی همچون جاذبه نیوتون، سرعت نور، بیگ بنگ و غیره تماما تئوری هستند، اساساً هرچیز که بر مشاهده مبتنی باشد نمیتواند از مرحله تئوری بالاتر رود. در برخی از شاخه های علم (منظور از علم همان Science) است، مفاهیمی وجود دارند که مشتق شده از اصول قطعی ریاضیات هستند به آن دسته از مفاهیم قضیه یا تئورم (Theorem) گفته میشود مثلا روابط فیثاغورس و تالس دو نمونه از قضایا هستند، سایر چیز ها نمیتوانند چیزی جز تئوری باشند. پیرامون این مسئله در نوشتاری با فرنام علم چیست؟  توضیحات بیشتری آورده شده است.

نتیجه آنکه تئوری بودن تکامل نمیتواند از ارزش و درستی آن بکاهد و کسانی که این ایراد را وارد میکنند مفهوم کلمه «تئوری» را در فلسفه علم درک نمیکنند. از این گذشته هر تئوری برای توضیح یک واقعیت شکل میگیرد، مثلاً تئوری جاذبه نیوتون برای توضیح واقعیت جاذبه شکل گرفته است، دقیقاً همین ارتباط میان تئوری تکامل و خود تکامل بعنوان یک واقعیت وجود دارد.

تکامل تصادفی است و احتمال آن پایین است، پس محال است:

در پاسخ به این شبهه باید گفت نخست اینکه تکامل تماماً مبتنی بر تصادف نیست، شخصی که این اعتراض را مطرح میکند عامل دوم تکامل را که عاملی غیر تصادفی است را نادیده میگیرد، از این گذشته تئوری تکامل تماماً مبتنی بر تصادف نیست، بلکه عوامل جبری نیز در آن نقش بازی میکنند. بسیاری از بیولوژیست ها معتقدند دو عامل اساسی در تکامل نقش بازی میکنند،

  1. تغییراتی که بر اساس تحولات تصادفی ژنتیکی (جهش ژنتیکی) انجام میگیرند.
  2. تغییراتی که قدرت و احتمال نجات یافتن و تکثیر موجود را بالا میبرند، که عدم تحقق این تغییرات موجب حذف آن موجود توسط گزینش طبیعی میشود.

کسانی که این اعتراض را بیان میکنند درکی بسیار ضعیف از تئوری احتمالات دارند، اینکه احتمال وقوع یک اتفاق پایین باشد هرگز و هرگز به این معنی نیست که آن اتفاق محال است، لذا این اعتراض نیز از پایه غلط است. در این مورد در نوشتاری با فرنام «مگر میشود همه چیز بطور تصادفی بوجود آمده باشد؟» توضیحات کافی داده شده است.

نتیجه گیری:

باید روی این نکته تاکید کرد که تکامل باور دینی و داگمای بیخدایان نیست، بیخدایان وجود خدا را به این دلیل انکار و نفی نمیکنند که معتقد به تکامل هستند. اینکه بیشتر بیخدایان معتقد به تکامل هستند به این دلیل است که بیخدایان معمولا بیشتر از خداباوران علاقه به یافته های مستند علمی دارند و با تئوری های علمی خردگرایانه تر برخورد میکنند و معتقد به قصه های ننه قمر کتابهای دینی نیستند. هیچ نظریه دیگری در حال حاضر برای توضیح انواع گونه های جانوری وجود ندارد و اگر تکامل روزی رد شود و تئوری بهتری ارائه شود بدون شک بیخدایان خردگرا نیز این تئوری را کنار گذاشته و تئوری جدید را خواهند پذیرفت.

در پایان با معرفی چند لینک دانشگاهی برای آموختن بیشتر در مورد تکامل این نوشتار را به پایام میبرم.

کتاب داروین بصورت گفتاری +

معجزات مربوط به شفا یافتن بیماران

خیلی از دوستان وقتی با آنها از بیخدایی صحبت میکنیم و یا حقانیت اسلام را برای آنها زیر سوال میبریم در مورد معجزات امامان و شفا یافتگان صحبت میکنند و مثلا میگویند فلان شخص فلان بیماری را داشت و به حرم امام رضا رفت و شفا یافت، حال چگونه میتواند کل این قصه امامت و اسلام و پروردگار دروغ باشد؟

بسیاری از ادعاهایی که در این موارد مطرح میشود بر میگردد به بیماری های عصبی مثل فلج و یا بیماریهای میکروبی و یا سرطانی. توجه داشته باشید که در بسیاری از این موارد عزیزان برای امتیاز دادن به امامانشان نمک قضیه رو زیاد میکنند و به شدت اغراق میکنند. بنابر این بسیاری از این مواردی که مطرح میشود پشت سرش هزاران جور دروغ و کلاه برداری و شیادی با اهداف مشخص اقتصادی و عقیدتی وجود دارد، نوشته زیر یکی از اسنادیست که احمد کسروی در باب همین شیادی ها در اثر خود آورده است.

متاسفانه در بین مردم به ویژه مردم مشرق زمین، خرافه و حرف مفت طرفدار بیشتری تا واقعیت دارد و مردم خیلی بیشتر دوست دارند باور کنند چیزهای عجیب و غریب و متافیزیکی و جادویی که در تخیلات و داستانها ذکر میشوند واقعا وجود دارند. خرافات همواره طرفداران بیشتری از واقعیات دارند. زیرا خرافات برای مردم خوش آیند هستند و مردم نسبت به آنها میل بیشتری دارند تا نسبت به توضیحات دقیق و و صحیح علمی و معمولاً امیال انسانها بر عقلانیت آنها پیروز میشود، یعنی اگر چیزی خلاف میلیشان باشد حتی اگر درست هم باشد تمایل چندانی نسبت به آن نشان نمیدهند.

گذشته از اینکه اکثر کسانیکه ادعا میکنند شفا یافته اند، به سادگی دروغ میگویند ،، در واقع عده ای نیز هستند که واقعا در اثر حضور در اماکن مقدس(!) از بیماریهایی رهایی پیدا میکنند و تیمار میشوند. ولی بجای پذیرفتن دلایل خرافی باید دید واقعاً این اتفاق برای چه می افتد و ریشه آن در کجا است.

وجود داشتن بیماری در بدن برای شخص استرس و ترسهایی ایجاد میکند که این استرسها و ترسها امروزه قابل بررسی و موشکافی دقیق هستند، در بسیاری از مواقع وقتی چنین استرسهایی در بدن وجود دارند کار مبارزه با عوامل بیماری برای سیستم دفاعی بدن دشوار میشود. استرس بر روی سیستم عصبی بدن، سیستم دفاعی و ترشحات هورمونی به طور مستقیم  تاثیر منفی میگذارد، حتی گفته میشود استرس مادر بسیاری از بیماری ها است و همه باید بیاموزند که چگونه خود را از آرام سازند و از استرس رهایی یابند. بنابر این گروهی از بیماریها را میتوان با روانکاوی و استرس زدایی از بین برد، یعنی با امیدواری دادن و تلقین کردن میتوان بسیاری از بیماری ها را از بین برد و خیلی وقتها ممکن است این اتفاق بیافتد یعنی شخص وقتی درون حرم میرود واقعا به خود تلقین میکند که خوب خواهد شد و این تلقین بر بدن وی تاثیر میگذارد، تلقین در انسان از قوت بسیار بالایی برخوردار است و با تلقین میتوان تغییرات محسوسی در سیستم های مختلف بدن از جمله سیستم دفاعی بدن ایجاد کرد. برای همین است که در مورد بسیاری از بیماریها پزشکها از اطرافیان بیمار میخواهند که به او روحیه بدهند و به او تلقین کنند که خوب خواهد شد.

گروهی دیگر از بیماری ها که جنبه عصبی دارند و به سیستم عصبی بدن مربوط میشود از جمله بیماری فلج نیز در بسیاری از مواقع توسط یک محرک روانی فوق العاده زیاد که بطور ناگهانی به شخص وارد میشود (در اثر هیجانات) میتواند روی سیستم عصبی شخص اثر کند و بیماری وی را تا حدود زیادی درمان کند. زیگموند فروید نیز که خود از بیخدایان بزرگ خود با انجام عمل مشابهی کودک فلجی را درمان نمود. در اکثر مواردی که میگویند شخصی شفا پیدا کرده یکی از این دو اتفاق یاد شده افتاده است و این هیچ ربطی به امام رضا و یا حضرت معصومه و یا وجود خدا ندارد. این اتفاق به این دلیل نمی افتد که فرد بیمار وارد حرم شده است و یا شخصی که نظر کرده امامان است دستش را بر روی سر او کشیده است، این اتفاق میتواند با وارد شدن به یک معبد بودایی، یک کلیسا، کنیسه و یا هرجای دیگر اتفاق بیافتد. حتی یک متخصص روانشناسی نیز میتواند چنین کاری را انجام دهد، بنابر این، شفا یافتن این بیماران نه معجزه امامان است نه بخاطر قداست یک مکان و یا الطاف الهی و…، برای اثبات این حرف دلایل دیگری می آوریم.

اگر شما یک مسافرت به نقاط دیگر جهان بکنید خواهید دید که در گوشه کنار دنیا نیز مواردی از این قبیل بسیار وجود دارند، مثلا در هندوستان معبدهایی وجود دارد که مانند حرم امام رضا مردم از تمام نقاط جهان آنجا میروند تا شفا پیدا کنند و اتفاقاً آمار شفا یافتگانشان بسیار بیشتر است از آمار شفا یافتگان حرم امام رضا و خانواده اش است. گروهی از افراد مانند سای بابای کلاه بردار در هندوستان از شهرت جهانی در این زمینه برخوردار هستند، حال اگر حقانیت با امام رضا است چرا سای بابا میتواند با تبلیغ مفاهیم هندوئیسم و بودیسم و سایر مکاتب غیر الهی که صد در صد مخالف با مفاهیم اسلامی هستند و از دید اسلامی هندو ها کاملا باطل و مشرک و کافر هستند و بودیست ها هم که اساساً خدا را انکار میکنند و بیخدا هستند، چرا باید سای بابا یک هندوی کافر و مشرک و دشمن اهل بیت بتواند مردم را بیشتر از امام رضا شفا دهد؟ این چه عنایت غلطیست که پروردگار به این هندوی کافر کرده است؟

یا مثلا در امریکا شخصی به نام بنی هین یک کانال تلویزیونی راه انداخته و با استناد به همین معجزات و… مردم را به پرستش عیسی مسیح فرا میخواند، وی مسیح را پسر خدا میداند و این از دید قرآنی (سوره توبه آیات 29 تا 32) فوق العاده گناه و شرک بزرگی محسوب میشود اما آیا خداوند همچنان به چنین شخصی این قدرت شفا دادن را داده است؟ در قرآن اشاره شده است که هرکس چیزی غیر از خدا را بپرستد به همراه آن چیز در آتش جهنم خواهد سوخت (سوره انبیا آیه 98)! چطور ممکن است بنی هین که قرار است در آتش بسوزد در این دنیا اینقدر کرامات داشته باشد؟ البته بنی هین نیز طبیعتاً مانند اکثر افراد مشابه و مذهبیون ازاین کار صرفه مالی بسیار بالای میبرد و کانالهای تلویزیونی رسمی دنیا در مورد دروغین بودن ادعاهای او چندین بار برنامه هایی را ساخته اند. اساساً داستان معجزه و شفا در مسیحیت بسیار بسیار قوی تر است و از روشهای اصلی شستشوی مغزی مسیحیان تحریک قربانیان به معجزه و شفا است، و از آنجا که اهل تسنن چندان به چنین چیزهایی اعتقاد ندارند میتوان گمان کرد که همچون مراسم عذاداری و رده بندی های مذهبی این افکار نیز از مسیحیت وارد تشیع شده باشد.

جواب به اینگونه پرسشها را تنها با همان دو روشی که در اکثر این موارد شفا انجام میشود میتوان به روشنی داد. شفا یافتن به این ربطی ندارد که شخص به حرم امام رضا میرود یا به معبد هندو ها میرود یا به مراسم آقای بنی هین میرود، شفا یافتن به این ربط ندارد که طرف الله میپرستد یا گاو یا مسیح و یهووه. حتی کافران هم میتوانند اینگونه خود درمانی کنند، امروزه موسسات و مراکز زیادی در جهان وجود دارند که بدون استفاده از تعالیم دینی همان کاری را انجام میدهند که مریض های زیادی برای انجام آن به حرم امام رضا میروند.

روشها و حتی حرکات ورزشی مانند یوگا و روشهای تلقین کردن، خنده درمانی و بسیاری از سایر روشها امروز برای شفا یافتن (Healing) وجود دارد و در جاهای مختلف حتی رسم ها و عادتهای مختلفی نیز برای این کار وجود دارد. بعنوان مثال در کشور خودمان در گذشته نه چندان دور در کشور خودمان وقتی خانمی باردار نمیشد پیش یکی از علما (!)ی اسلام میرفت و این مردان روحانی بزرگوار دور ناف این خانم دعا مینوشتند و تا شفا بیابد و خوب چون این عمل در راه خیر بود هیچ اشکای نداشت که علمای اسلام بدن این خانم را ببینند و شاید حتی ثواب هم داشت! دعا نویسی و مهره اندازی و این جور حرفها هم از رسومات خرافی قدیمی ماست که احتمالا به دلایلی که آورده شد  بعضی وقتها خیلی خوب هم کار میکرده است، و هم موجب شفا یافتن بیماران و هم موجب شادی روح و تجدید روحیه علمای اسلام میشد.

اما مهم این است که دامنه این مریضیها زیاد گسترده نیست و همانطور که گفته شد به بیماری های مشخصی مربوط میشود، بعنوان مثال دیده نشده که شخصی بتواند جراحت و یا قطع عضو بدن خود را شفا دهد، و یا بسیاری از بیماریهای ویروسی به هیچ عنوان قابل شفا یافتن نیستند. از کسانی که این ادعا را میکنند بخواهید که برای رفع بیماری های خود پیش دکتر نروند، (فرقه هایی از مسیحیت چنین باوری دارند و هرگز از خدمات پزشکی استفاده نمیکنند)  و بروند حرم امام رضا و یا اینکه از ایشان بپرسید چرا یک بیمارستان بزرگ در طبقه دوم بارگاه امام رضا درست نمیکنند و یا اینکه از آنها بخواهید که دستشان را در مقابل شما قطع کنند و به حرم امام رضا بروند و با دست سالم برگردند، مسلماً چنین کاری نخواهند کرد چون خودشان میدانند دروغ میگویند. چند وقت پیش آیت الله سیستانی بزرگترین مرجع شیعه برای درمان خود به انگلستان رفته بود تا زیر دست یک عده کافر از خدا بیخبر نجس درمان شوند، باید از ایشان پرسید مگر امام رضا چلاق هستند که شما برای درمان میروید انگلستان؟ چرا تشریف نمیبرید مشهد؟ پرسش دیگر این است که چرا دست مبارک نماینده پروردگار بر روی زمین و نایب امام زمان آیت الله خامنه ای توسط این 12 امام حاضر و غایب شیعه شفا نمی یابد؟ ایشان چقدر با دست خودش قبر امام رضا را دستمال کشیده و کف ضريح مقدس را تی کشیده است؟ چرا دست ایشان در این همه مدت شفا نیافته است؟ یکی دیگر از مسائلی که امامان و خدا و معجزه گران از درمان آن عاجز هستند مسئله ضعف در بینایی است، که آزمایش آن بسیار ساده است، تابحال دیده نشده است شخصی ادعا کند معجزه ای رخ داده است و دیگر از عینک استفاده نمیکند.

یکی نیست به اینها بگوید آخر اگر این امامان اینقدر قدرت متافیزیکی داشتند چرا همگی کشته شدند و بعضاً توسط زنان خودشان کشته شده اند، و یا چرا این امام سجاد از اول تا آخر  عمرشان چرا اینقدر مریض بودند و شفا نیافتند و یا چرا پیغمبر اسلام خودش را شفا نداد تا بتواند بچه دار شود و اینقدر زحمت زن عوض کردن را بخود ندهد؟

در واقع قضیه معجزه و شفا آنگونه که توسط مسلمانان مطرح میشود گذشته از اینکه مضحک و بر خلاق قوانین فیزیکی و طبیعی است، بر خلاق خود تعالیم قرآنی نیز هست. یعنی حتی اگر یک مسلمان هم معقول باشد و دست از تعصبات بردارد و به قرآن مراجعه کند خواهد دید که قرآن به وضوح نشان میدهد که پیامبر اسلام نه غیب میدانسته است نه معجزه ای داشته است. حال که خود پیامبر اسلام چنین بوده است، چگونه ممکن است امامان چنین نیروهایی داشته باشند؟

سوره انعام آیه 50

قُل لاَّ أَقُولُ لَكُمْ عِندِي خَزَآئِنُ اللّهِ وَلا أَعْلَمُ الْغَيْبَ وَلا أَقُولُ لَكُمْ إِنِّي مَلَكٌ إِنْ أَتَّبِعُ إِلاَّ مَا يُوحَى إِلَيَّ قُلْ هَلْ يَسْتَوِي الأَعْمَى وَالْبَصِيرُ أَفَلاَ تَتَفَكَّرُونَ.

(ای محمد) به آنها بگو من نمیگویم گنجهای خداوند در نزد من است و از غیب خبری دارم یا اینکه من فرشته ام. من تابع الهام ضمیر و رساندن  وحی هستم.

سوره اعراف آیه 188

قُل لاَّ أَمْلِكُ لِنَفْسِي نَفْعًا وَلاَ ضَرًّا إِلاَّ مَا شَاء اللّهُ وَلَوْ كُنتُ أَعْلَمُ الْغَيْبَ لاَسْتَكْثَرْتُ مِنَ الْخَيْرِ وَمَا مَسَّنِيَ السُّوءُ إِنْ أَنَاْ إِلاَّ نَذِيرٌ وَبَشِيرٌ لِّقَوْمٍ يُؤْمِنُونَ.

بگو: من مالک سود و زیان خود نیستم، مگر آنچه خدا بخواهد. و اگر علم غیب میدانستم بر خیر خود بسی می افزودم و هیچ شری به من نمیرسید. من کسی جز بیم دهنده و مژده دهنده ای برای مومنان نیستم.

سوره اسراء آیه 59

وَمَا مَنَعَنَا أَن نُّرْسِلَ بِالآيَاتِ إِلاَّ أَن كَذَّبَ بِهَا الأَوَّلُونَ وَآتَيْنَا ثَمُودَ النَّاقَةَ مُبْصِرَةً فَظَلَمُواْ بِهَا وَمَا نُرْسِلُ بِالآيَاتِ إِلاَّ تَخْوِيفًا.

مارا از نزول معجزات باز نداشت، مگر اینکه پیشینیان تکذیبش میکردند. به قوم ثمود به عنوان معجزه ای روشنگر ماده شتر را دادیم. بر آن ستم کردند. و ما این معجزات را جز برای ترسانیدن نمیفرستیم.

سوره انعام آیه 37

وَقَالُواْ لَوْلاَ نُزِّلَ عَلَيْهِ آيَةٌ مِّن رَّبِّهِ قُلْ إِنَّ اللّهَ قَادِرٌ عَلَى أَن يُنَزِّلٍ آيَةً وَلَـكِنَّ أَكْثَرَهُمْ لاَ يَعْلَمُونَ.

وگفتند: چرا معجزه ای از پروردگارش بر او نازل نشده؟ بگو خدا قادر است که معجزه ای فرو فرستد. ولی بیشترینشان نمیدانند.

این آیات به وضوح ضعف محمد در انجام دادم عملی خارق العاده در زمان خودش را نشان میدهند، اما مسلمانان بعد از مرگ محمد شروع به افسانه سازی در مورد خود او و امامان کردند.

همچنین شایان ذکر است موسسه جیمز رندی مبلغ یک میلیون دلار را به هرکس که بتواند در شرایط علمی و مشاهده دقیق ثابت کند از نیروهای ماورای طبیعت برخوردار است یا عملی غیر طبیعی را انجام دهد یا انجام گرفتن آنرا نشان دهد پاداش میدهد، برای اطلاعات بیشتر به نوشتاری با فرنام جایزه یک میلیون دلاری موسسه جیمز رندی مراجعه کنید.

بیخدایی و اخلاق

نویسنده – آرش بیخدا

بطور کلی، آدمهای خوب کارهای خوب می‌کنند و آدمهای بد کارهای بد. اما برای اینکه آدم خوبی کار بد انجام دهد، به دین نیاز است.

استیون واینبرگ، فیزیک دان امریکایی برنده جایزه نوبل.

پیشگفتار

غیر واقع بینانه نیست اگر تصور کنیم اتهام بی اخلاقی مهمترین اتهامی است که خداباوران به بیخدایی میزنند، بسیاری از خداباوران فکر می‌کنند اگر بتوانند نشان دهند بیخدایی موجب بی اخلاقی می‌شود بیخدایی را رد کرده اند. این نیز خود نشان از نابخردی و آماتور بودن خداباوران در فکر کردن دارد زیرا بعید است آشکار تر از این بتوان مغلطه توسل به نتیجه باور را مرتکب شد؛ لذا این مسئله برای من بسیار جذاب است که مهمترین و رایج ترین استدلال خداباوران علیه بیخدایی کاملا مغلطه آمیز است و حتی نیاز به پاسخ دادن هم ندارد، زیرا هرگز از روی نتیجه یک باور نمیتوان نتیجه گرفت که آن باور نادرست است، اگر فرض کنیم بیخدایی موجب بی اخلاقی می‌شود این فرض هرگز نمیتواند بیخدایی را رد  یا خداباوری را اثبات کند، درست همانطور که با نشان دادن اینکه خشکسالی موجب قحطی می‌شود نمیتوان نشان داد که  خشکسالی باطل است، حقیقت ندارد و رخ نمیدهد. یعنی حتی اگر خداباوران بتوانند اثبات کنند که در صورت عدم وجود خدا، اخلاقیات عینی نمیتوانند حقیقت داشته باشند، یا اینکه فرد بیخدا قهراً فردی بی اخلاق هم هست نتیجه هرگز این نخواهد بود که بیخدایی غلط است و خدا وجود دارد، بلکه نتیجه این خواهد بود که اخلاقیاتی که تا مغز استخوان ما انسانها نفوذ کرده اند و شب و روز با آنها سر و کار داریم، شوربختانه عینی نیستند و ذهنی هستند و این چیزی است که باید آنرا به دلیل درست بودنش پذیرفت، و با آن ساخت و سازش کرد و این یک واقعیت تلخ است که وجود دارد، و بیخدایان واقعیت را خلق نکرده اند که بخواهند مسئول آن باشند و از آن شرم داشته باشند، اما خداباورانی که این ادعا را میکنند بگونه ای صحبت میکنند که گویا با فرض معدوم بودن خدا، مسئول نیستی خدا بیخدایان هستند و اگر بیخدایان دست از بیخدایی بردارند خدا موجود میشود!

اما ضرورت بی اخلاق بودن بیخدایان تنها یک فرض بود و جدا از اتهام مغالطه آمیز خداباوران تلاش من در این نوشتار بر این است که نشان دهم دلیل معتبری برای پذیرفتن اینکه بیخدایی با اخلاقمداری ناسازگار است وجود ندارد. بنابر این روشن است که من این نوشتار را در دفاع از بیخدایی نمینویسم زیرا بیخدایی نیازی به دفاع از این نگر ندارد. هدف من از نوشتن این نوشتار یاری رساندن به خداباوران منتقد بیخدایی است تا بتوانند بهتر اخلاق را درک کنند و کمی عمیقتر به این مسئله فکر کنند.

اتهام بی اخلاقی از پر سابقه ترین اتهاماتی است که به بیخدایان در سرتاسر تاریخ و جغرافیا زده شده است، این اتهام بیشتر به نوعی دهن کجی شباهت دارد، تجربه شخصی من نشان میدهد که هرگاه خداباوران مجبور به اعتراف به عجزشان در اثبات وجود خدایشان میشوند این اتهام را مطرح میکنند، یعنی چون بیخدا از یک طرف خداباور را به نابخردی محکوم میکند، خداباور نیز در مقابل بیخدا را محکوم به بی اخلاقی و مروج بی اخلاقی بودن میکند. بسیاری از خداباوران تلاش کرده اند نشان دهند که بیخدایان نمیتوانند به اخلاقیات عینی پایبند باشند، و بیخدایی منجر به فروپاشی نظام اخلاقی و پوچ گرایی-یعنی باور به غیر حقیقی بودن تمامی گزاره ها از جمله گزاره های اخلاقی می‌شود.

جالب اینجا است که این دیدگاه تنها محدود به خداباوران نمی‌شود، بیخدایان بسیاری نیز وجود دارند که اینرا تایید می‌کنند. بعنوان مثال یکی از شخصیت های داستانی داستایوسکی در رمان برادران کارامازف معتقد است که «اگر خدا وجود نداشته باشد، انجام هر کاری میتواند درست باشد»، و خداباوران بسیاری این دیدگاه را به خود داستایوسکی نسبت داده اند و همواره این جمله را به عنوان یک نقل قول از وی تکرار میکنند تا از این طریق سخنشان را اثبات کنند، که این نیز چیزی نیست جز نمونه ای آشکار از مغلطه توسل به مرجعیت.

معمولاً نظر خداباوران نسبت به بیخدایی این است که یک فرد باخدا در مقایسه با یک فرد بیخدا اخلاقمدار تر است و احتمال اینکه یک فرد بیخدا دست به جرم و جنایت و قتل و تجاوز بزند بسیار بیشتر از این است که فرد خداباوری دست به چنین کاری بزند. اتهام بی اخلاقی به بیخدایان تا حدی است که بسیاری از دین مداران و خداباوران وقتی به بیخدایی فکر میکنند همزمان به «هرکاری مجاز و آزاد است» نیز فکر میکنند، و گاهاً افرادی که گمان میکنند تنها ترس از خدا میتواند جلوی آنها را از ارتکاب جرم بگیرد، نزدیکانشان را در حال ارتکاب اعمال نامشروع جنسی در ذهنشان تصور میکنند. این درست مانند همان حسی است که بیخدایان نسبت به خداباوران دارند، بیشتر بیخدایان نیز بیشتر خداباوران را افراد خرافی، نادان، متعصب و کم هوش میدانند. یعنی این دو تفکر معمولا همواره یکدیگر را به نادانی و دیگری به بی اخلاقی محکوم میکرده اند، البته ما در این نوشتار فقط با مسئله اخلاق سر و کار داریم نه با نابخرد بودن خداباوری.

واقعیت آن است که  این تنها خداباوران نیستند که بیخدایان را محکوم به بی اخلاقی می‌کنند، برخی بیخدایان نیز معتقدند تفکر خدامحور و بویژه دینی به شدت ضد اخلاق است و نه تنها نمیتواند تضمینی برای اخلاق در جامعه باشد بلکه مانعی بزرگ بر سر اخلاقیات و اخلاق مداری است، در نوشتاری با فرنام سفسطه دین ضامن اخلاق در جامعه است این مسئله بطور مفصل شرح داده شده است. اساساً یکی از مهمترین و شاید مهمترین دلیلی که باعث میشود دین ستیزی و بویژه اسلام ستیزی ضرورت داشته باشد همین ناهمخوان بودن دین داری و در کنار آن خداباوری با اخلاق است. از طرفی دیگر بسیاری به بهانه همین فرضیه که بیخدایی برابر با بی اخلاقی است با دین ستیزی و روشنگری در مورد مسئله خدا مخالفت می‌کنند و فکر می‌کنند مردم باید بگونه ای به مقداری خرافات باور داشته باشند تا اخلاقمدار باشند، یعنی شخص خردگرا که همه خرافات دینی را کنار میگذارد از نظر این اشخاص نمیتواند اخلاقمدار باشد، زیرا این افراد گمان میکنند انسانها از روی حماقت و ترس باید اخلاقمدار باشند و اگر قرار باشد همه خردگرا باشند و به یاوه ها و اباطیل باورمند نباشند دیگر کسی اخلاقمدار نخواهد بود.

تجربه شخصی به من نشان داده است که بیشتر این دسته انسانها گمان می‌کنند بیخدایی برابر با بی اخلاقی است چون اساساً نمیفهمند اخلاق چیست و درکی  بسیار ضعیف و عوامانه از این شاخه بزرگ فلسفه دارند یا گاهی نیز هیچگونه دانشی در این زمینه ندارند. همچنین دینداران گمان می‌کنند حق انحصاری و مونوپولی در اخلاقیات دارند و این خدای آنها که نه فیزیک نازل کرده است، نه شیمی، نه دموکراسی نه حقوق بشر، بجای این چیزها برای ما اخلاق نازل کرده است. این خدا بوده است که به ما یاد داده است قتل کردن بد است و دزدی بد است و اگر خدا این را به ما یاد نمیداد ما خود این چیزها را نمیفهمیدیم و همه دزد و قاتل میشدیم.

مسئله بسیار مهم دیگر این است که اخلاق درصورتی که دینی و خدامحور باشد دردسر ساز خواهد شد و فساد درونی دین بیش از پیش به جان بشریت خواهد افتاد. از همین رو است که حتی برخی اندیشمندان مسلمان و خداباور نیز تلاش میکنند تا نظام اخلاقی خردمحور و فلسفی را جایگزین نظام اخلاقی دینی بکنند (1). از همین رو شایسته است تا اخلاق خردمحور و فلسفی سکولار هرچه بیشتر تبیین و تبلیغ شود تا خداباوران و دین خویان بویژه مسلمانان نیز یاد بگیرند که چگونه باید در مورد مسئله اخلاق فکر کنند زیرا این خود مبحثی بسیار مهم و ریشه ای است و سر انجام آن به سیاست و حقوق می انجامد و این نیز خود از انگیزه های نگارش این نوشتار است، چرا که شناخت سالم و صحیح از اخلاق ضرورتی انکار نشدنی برای سعادت بشر، و جامعه بشری است و سعادت بشر و جامعه اش آرزوی هر انسانگرایی است.

اما هدف اصلی نوشتن این نوشتار ارائه مقدمه ای بسیار مختصر و مفید است که درکی ابتدائی اما مفید را نسبت به مسئله اخلاق نتیجه بدهد. هرگز نمیتوان تمام مسئله اخلاق را در یک یا دو نوشتار مطرح و بررسی کرد اما میتوان با یک نوشتار چشم خرد را بسوی این شاخه فلسفه که ده ها فیلسوف و اندیشمند تابحال به توسعه آن خدمت کرده اند و همچنان نیز در حال توسعه است باز کرد و نشان داد که اخلاقمداری سکولار برتری بسیار روشن و آشکاری نسبت به اخلاقمداری دینی دارد. همچنین در این نوشتار من به بررسی ارتباط اخلاق با وجود خدا خواهم پرداخت و از بیخدایی در مقابل اتهام بی اخلاقی دفاع خواهم کرد.

برای بررسی اخلاق و دریافتن ماهیت و جایگاه آن در دیدگاه سکولار باید قطعاً مسئله را در دو موضوع بررسی کرد. مسئله نخست این است که آیا ارزشهای اخلاقی در دیدگاه بیخدایی میتوانند وجود داشته باشند؟ این اخلاقیات از چه منبعی برخاسته اند و چه ماهیتی دارند؟ چه کاری خوب است و چه کاری بد است؟ چه چیزهایی در ذاتشان خوب هستند و چه چیزهایی در ذات خود خوب نیستند؟ مسئله دوم این است که اگر این ارزشهای اخلاقی وجود دارند چرا یک شخص باید پایبند به آنها باشد؟ به عبارت دیگر چرا یک شخص باید اساساً اخلاقمدار باشد و آیا خداباوران انسانهای اخلاقمدار تری از بیخدایان هستند؟ این نوشتار در مورد تمامی این موارد توضیحاتی را خواهد داد و همچنین با استفاده از داده های آماری نشان خواهد داد که آیا باور به خدا نتیجه شگرفی در اخلاقمداری افراد دارد و آیا خداباوران بر اساس آمار اخلاقمدار تر از بیخدایان هستند یا نه. پیش از هر بحثی پیرامون ارتباط خداباوری و اخلاقمداری خوب است که مقداری راجع به اینکه اساساً علم اخلاق چیست و مباحث اخلاقی را چگونه میتوان دسته بندی کرد و چه مکاتب مطرحی در اخلاقیات امروزی وجود دارند توضیح دهم و تعریف های مختصری از آنچه در ادامه خواهد آمد ارائه بدهم.

معرفی مختصر فلسفه اخلاق

علم اخلاق (Ethics) یکی از شاخه های پنجگانه فلسفه است که به بررسی اخلاقیات (Morality) یعنی تمیز دادن خوب از بد میپردازد. دو واژه یاد شده در زبان یونانی از ریشه های قوانین، قواعد و آداب و رسوم می آیند. این تعریف از علم اخلاق شاید کمی گیج کننده باشد، فرق علم اخلاق با اخلاق مسلماً چیزی نیست جز اینکه علم اخلاق به بررسی ماهیت و چیستی خود اخلاق میپردازد از همین رو است که به علم اخلاق گاهی فلسفه اخلاق (Moral Philosophy) نیز گفته می‌شود. هدف بنیادین فلسفه اخلاق معرفی روشها و معیارهایی است که با آنها بتوان اخلاق را بهتر فهمید و خوب و بد را از یکدیگر تمیز داد. این شاخه از فلسفه خود به دو زیر شاخه متااتیکز- فرا اخلاق (Metaethics) (برخی آنرا زبر-اخلاق خوانده اند) و نورماتیو اتیکز- اخلاق هنجاری (Normative Ethics) تقسیم می‌شود.

شاخه اخلاق هنجاری (Normative Ethics) به مطالعه این میپردازد که چگونه میتوان خوب را از بد تشخیص داد. در این شاخه فلاسفه تلاش میکنند به این پرسش پاسخ دهند که چگونه میتوان تشخیص داد چیزی خوب است یا بد. گاهی به نظریه هایی که در این شاخه مطرح میشوند نظریات حسن (خوبی، شایستگی) و قبح (بدی، زشتی، ناشایست بودن) گفته میشود. بعبارت دیگر شاید بتوان گفت اخلاق هنجاری بطور مشخص به روش هایی که با آنها میتوان میان خوب و بد تمایز قائل شد و تشخیص داد که چه کاری/چیزی خوب است و چه کاری/چیزی بد است میپردازد، یعنی نتیجه این شاخه این است که مردم چه کارهایی باید بکنند و چه کارهایی نباید بکنند و از چه شیوه هایی باید اینرا دریابند. اخلاق هنجاری به ما نمیگوید که مردم چه چیز را شایست و یا ناشایست میپندارند یا چرا اینگونه میپندارند، بلکه به ما میگوید مردم چه چیز را باید شایست یا ناشایست بدانند. کاربرد این روش ها و نظریه ها میتواند از مسائل شخصی و تصمیمات اخلاقی شخصی آغاز شود و حتی روشهای تصمیم گیری در مورد ایجاد و تصویب قوانین را نیز شامل شود.

مبحثی دیگر که در زمینه اخلاق وجود دارد اخلاق کاربردی است (Applied Ethics)، هنگامی که فلاسفه یا اشخاص ذیربط در مورد مسائل بسیار مشخصی همچون اخلاقی بودن یا نبودن اعدام، سقط جنین، ازدواج همجنسگرایان، خودکشی، آزاد کردن مواد مخدر و غیره بحث میکنند و تلاش میکنند که  ازنظریات موافق یا مخالف خود با شیوه هایی که در اخلاق هنجاری مطرح میشود دفاع کنند، آنها در واقع در حال پرداختن به اخلاق کاربردی هستند. دانشگاه ها دریافته اند که اخلاق سهمی بسیار مهم در پرورش دانشجویان در رشته های مشخصی دارد از همین رو در برخی رشته های دانشگاهی بی ارتباط با فلسفه، دروسی از اخلاق کاربردی را که مربوط به آن رشته هستند تدریس میکنند و این دروس همگی جزو اخلاق کاربردی هستند. مثلاً به دانشجویان پزشکی، اخلاقیات پزشکی (Medical Ethics) و به دانشجویان رشته های مربوط به تجارت و مدیریت، اخلاقیات تجاری (Business Ethics) می آموزند که بحث های مربوط به این رشته ها را در آن تبیین میکنند.

پیش از توضیحات بیشتر لازم است که چند واژه از واژگان مصطلح در مباحث اخلاقی را تعریف کنیم. منظور از حقایق اخلاقی گزاره هایی (قضیه، گزاره چیست؟) هستند که راجع به ارزشهای اخلاقی خوب و بد ادعایی را مطرح میکنند، یا گزاره هایی که از مفاهیم و الفاظ اخلاقی برای بیان حقیقتی استفاده میکنند. مثلا اگر گزاره «کمک مالی کردن به گدا ها کار خوبی است.» درست باشد آنگاه این گزاره یک گزاره اخلاقی است و ارزش حقیقی آن «درست» است و اگر نادرست باشد ارزش حقیقی آن «نادرست» است، وقتی کسی در مورد درست یا نادرست بودن ارزش حقیقی یک گزاره اخلاقی موضعی را اتخاذ میکند میتوان گفت وی قضاوتی اخلاقی انجام داده است.

باید توجه داشت که نظریات مطرح شده در هر دو شاخه ریشه ای چند هزار ساله دارد و همچون سایر شاخه های فلسفه میتوان گفت قدمت آن به زمانی باز میگردد که بشر برای نخستین بار اندیشید، و از آن هنگام تا امروز ده ها کتاب و نوشته و سخنرانی در رد یا دفاع این نظریه ها نوشته و یا ایراد شده اند و مطالعه هر یک از این نظریه ها میتواند سالها وقت بگیرد. هدف ما نیز در اینجا دفاع از هیچیک از این نظریه ها نیست، بلکه تنها بصورت مقدمه ای که در آینده از آن استفاده خواهد شد به ذکر و معرفی بسیار مختصر آنها خواهیم پرداخت. تفاوت بنیادینی که در میان نظریه های مختلف اخلاق هنجاری وجود دارند ناشی از اختلاف بر سر این است که آیا نتیجه و پیامد یک عمل نشان میدهد که آن عمل درست یا نادرست است یا خود آن عمل. گروهی که به دسته نخست اختصاص دارند طبیعتاً اوضاع و احوال و شرایط انجام یک عمل را بررسی میکنند (جزئی نگری اخلاقی Moral Particularism) و گروه دوم در پی روشن ساختن قواعد و اصولی هستند که بتوانند نشان دهند عملی درست یا نادرست است (قانونگرایی اخلاقی Ethical Legalism).  البته حالت سومی نیز قابل تصور است و آن این است که هردو این دیدگاه ها درست باشند، یعنی در درستی یا نادرستی یک کار هم شرایط و وضعیت تاثیر داشته باشد هم اصول و قواعد.  چند مورد از نظریه های مهمی که در شاخه اخلاق هنجاری اخلاقی علم اخلاق مطرح شده اند از این قرار هستند:

  • نتیجه گرایی، پیامدگرایی، عاقبت اندیشی (Consequentialism) – معتقد است که ارزش اخلاقی یک عمل تنها به نتیجه و خروجی آن عمل و چیزهای دیگری که در ارتباط با آن عمل هستند، همچون انگیزه عامل یا قوانینی که اعمالی از آن دست را جبر می‌کنند  وابستگی دارد. لذا در این دیدگاه عمل خوب عملی است که نتیجه ای خوب بدهد و حسن و قبح را میتوان از روی مضار و فواید و منافع آن تشخیص داد.  زیر شاخه های معروف این نظریه عبارتند از:
    • سودمند گرایی، فایده باوری (Utilitarianism)  – معتقد است یک عمل درست است اگر نتیجه آن بیشترین لذت و کمترین درد را برای بیشترین مردم داشته باشد. بنتام، جان استوارت ميل و ماكياول از هواداران این دیدگاه بوده اند.
    • خودگرایی (Egoism) – معتقد است که شخص اخلاقمدار شخصی خود خواه است. بعبارت دیگر از نگر هواداران این دیدگاه شرط لازم و کافی برای اینکه عملی اخلاقی باشد این است که آن عمل بتواند خیر شخصی فاعل آن عمل را تا حداکثر زیاد کند و همه باید در این راه به حداکثر رساندن خیر های شخصی خود کوشا باشند. خودگرایی در اخلاق معمولاً با «خودخواهی» که بصورت یک دشنام استفاده می‌شود متفاوت است. روشن است که نخستین انتقاد به خودگرایی آن است که تفاوت عمده خودگرایی با سایر نظریه های اخلاق هنجاری در این واقعیت است که در این دیدگاه تنها خود فرد مطرح است و دیگران اساساً مطرح نیستند، اما مدافعان خودگرایی ممکن است پاسخ دهند که خود گرایی نیز مسئولیت هایی را نسبت به سایر انسانها تولید می‌کند زیرا یک شخص بدون توجه به دیگران و منافعشان نمیتواند منافع زیادی بدست بیاورد. لذا در این دیدگاه نیز منافع دیگران مطرح میشود. سوء تفاهم رایجی که معمولاً در فهم این دیدگاه وجود دارد این است که گمان میشود خودگرایی میگوید آنچه یک فرد فکر میکند به نفعش است خوب است، در واقع خوب است. حال آنکه این دیدگاه به تفکر خود فاعل اشاره ای ندارد بلکه یک عمل را بصورت عینی نگاه میکند و میگوید اگر عملی برای خود یک فرد خوب است، آنگاه آن عمل خوب است و برعکس.   ایان رند (Ayn Rand) بنیانگزار مکتب آبجکتیویسم (Objectivism) از مدافعان این دیدگاه است.
  • نا-نتیجه گرایی، نا پیامدگرایی، نا-عاقبت اندیشی (Non-consequentialism) – بر خلاف نتیجه گرایی معتقد نیست که خوبی یا بدی را میتوان از روی نتیجه تشخیص داد بلکه معتقد است ذات یک چیز میتواند حسن و قبح آن را معین کند، لذا بجای بررسی نتیجه باید به ذات و ماهیت توجه کرد و آنرا با معیارهایی سنجید. زیر شاخه های معروف این نظریه عبارتند از:
    • وظیفه گرایی (Deontology) – معتقد است که نتیجه اعمال را باید نادیده گرفت، و رفتار افراد باید بر اساس وظایف افراد باشد. یعنی صرف نظر از نتیجه یک عمل، اصول و قواعدی وجود دارند که نشان میدهند آن عمل، عملی شایست یا ناشایست است. لذا از نظر وظیفه گرایان عملی اخلاقی است که صرفاً با انگيزه و نیت رعايت قاعده اخلاقی و تكليف اخلاقی صورت بگيرد. کانت (Immanuel Kant) عمده ترین فیلسوف وظیفه گرا است، همچنین برخی از فلاسفه همچون جان لاک (John Locke) که معتقد بوده اند همه انسانها دارای حقوق مطلقی هستند، وظیفه گرا بشمار میروند. نمونه هایی از نظریه های وظیفه گرایانه از این قرارند:
      • تئوری امر تنجيزى (Categorical Imperative) کانت، معتقد است که ریشه اخلاق را در توانایی خردورزی انسانها میداند و قوانین اخلاقی تخلف ناکردنی و مطلق را خلق می‌کند و معتقد است که آدمی باید همواره بر اساس این قوانین و ضوابط جهانشمول و همیشه درست رفتار کند.
      • اصل عدالت، عملی درست است که عادلانه باشد، آدمی باید همواره بر اساس عدالت رفتار کند.
      • قراردادگرایی (Contractarianism) جان راولز (John Rawls) معتقد است رفتارهای اخلاقی رفتارهایی هستند که همه ما بر سر اخلاقی بودن آنها در صورتی که بی غرض بودیم توافق میداشتیم.
  • علم اخلاق فضیلت محور، اخلاق پاکدامنی (Virtue Ethics)- ارسطو شاید نخستین مدافع این دیدگاه باشد، این تئوری بجای اینکه روی رفتارهای انسانها تمرکز کند روی شخصیت ذاتی افراد تمرکز می‌کند.
  • نظریه فرمان الهی – درستی یا نادرستی هر چیز را میتوان از روی فرامین الهی دریافت.
  • اخلاق مبتنی بر مهر ورزی –رفتاری درست است که مهر آمیز باشد، و آدمی همواره باید رفتاری مهر ورزانه داشته باشد.
  • اخلاق مبتنی بر عدم خشونت –رفتاری درست است که خشونت آمیز نباشد و خشونت ناشایست است.
  • عاطفه گرایی- معتقد است که اخلاق عاطفه بنياد است لذا جايگاه آن در دل است نه درعقل. چيزهايي مانند خوبي يا دوستي و محبت را با دل حس مي كنيم نه اينكه باعقل بشناسيم. اين جريان فكري، به نمايندگي شوپنهاور، امر اخلاقي را يك امر حسي دروني و يك ميل و نه مسئله اي عيني و تجربي يا عقلي مي داند. برهمين اساس نيز معتقد است عمل براساس ضرورت عقلي، عملي اخلاقي نيست بلكه همراهي با يك جبر است ازنوع جبر عقلي.
  • قانون طلائی کنفسیوس– انسان باید با دیگران بگونه ای رفتار کند که انتظار دارد دیگران با او همانگونه رفتار کند.

پرسشی که باعث بوجود آمدن دو دیدگاه مخالف دیگر در علم اخلاق میشود این است که آیا تنها یکی از این اصول درست هستند و باقی اصول باطل هستند یا اینکه ممکن است بتوان دستکم برخی این اصول را در کنار هم درست دانست. به دیدگاهی که تنها یکی از این اصول و نظریه ها را پشتیبانی میکند و بقیه را نفی میکند یگانه گرایانه (Monistic) میگویند و به دیدگاه دیگر کثرت گرایانه (Pluralistic) میگویند.

دیدگاه دیگر در مورد اخلاق هنجاری همانطور که گفته شد جزئی نگری اخلاقی است، فلاسفه طرفدار این زیر شاخه از اخلاق هنجاری معتقدند که نمیتوان اصول و قواعد مشخصی را برای تعیین شایست یا ناشایست بودن یک عمل تعریف کرد، بلکه تنها شرایط و وضعیتی که کار در آن صورت میگیرد روشن میکند که آنکار درست است یا نادرست. بنابر این برای دریافتن درستی یا نادرستی یک عمل باید تنها شرایط را در نظر گرفت . اچ ای پریچارد، و دبلیو دی راس و اگزیستانسیالیست هایی همچون جان دیویی را میتوان از هواداران نامدار این نگرش به اخلاق هنجاری دانست.

شاخه فرااخلاق (Metaethics) از سویی دیگر راجع به این صحبت می‌کند که وقتی ما در بررسی مسائل اخلاقی هستیم و از خوب و بد صحبت میکنیم، در واقع ما راجع به چی صحبت میکنیم؟ پیشوند متا در این کلمه به متافیزیک بر میگردد، یعنی  وجود شناسی، لذا به تعبیری شاید بتوان گفت متااتیکز به معنی وجود شناسی علم اخلاق است.  مسائل متااتیکی مسائل درجه دومی هستند، یعنی این مسائل مسائلی پیرامون اخلاق هستند نه مسائل درون اخلاق. معمولاً شاخه متا اتیکز در ارتباط مستقیم با پرسشهای وجود شناسی (Metaphysics)، معنی شناسی (Semantics)، معرفت شناسی (Epistemology) و حتی روانشناسی (Psychology) است که در مورد مسائل اخلاقی مطرح میشوند. بعنوان مثال پرسشهایی همچون «آیا حقایق اخلاقی وجود دارند؟»، «آیا میتوان قضاوتهای اخلاقی را توجیه عقلی کرد؟» و پرسشهایی از این دست، پرسشهای متااتیکی هستند. بطور کلی فرااخلاق بیشتر در مورد اینکه آیا خوبی، بدی، شایست و ناشایست واژگانی ذهنی (Subjective) و ناشی از تخیلات و عواطف انسانی هستند و یا اینکه عینی (Objective) هستند و در عالم واقع چیزی را نمایندگی یا توصیف میکنند  یا نه بحث میکند.

نظریه های فرااخلاقی مهم معاصر را میتوان بر دو اساس مرتب کرد، یکی بر این اساس که آیا از نگر آنها اخلاقیات عینی هستند (مکتب واقع گرایی اخلاقی یا Moral Realism)  یا ذهنی (مکتب ضد واقع گرایی Moral anti-Realism)، باید توجه داشت که مدافعان اخلاقیات عینی نمیگویند تمامی حقایق اخلاقی عینی هستند بلکه میگویند این حقایق وجود دارند یا دستکم میتوان یک مورد از حقایق اخلاقی که عینی هستند را مثال زد. تعریف عینی و یا ذهنی بودن از این قرار است:

  • اخلاقیات عینی،حقیقتشان مبتنی بر وجود داننده این اخلاقیات (کسی که در مورد ارزش حقیقی این گزاره های اخلاقی قضاوت اخلاقی میکند) نیست، یعنی چه ما وجود داشته باشیم چه وجود نداشته باشیم و در هر شرایطی و بصورت جهانشمول دسته ای از گزاره های ارزشی اخلاقی یا ارزش خوب دارند یا ارزش بد. مثلاً اگر کسی بگوید که «شکنجه کردن یک شخص تنها برای تفریح و لذت بردن، همواره و بصورت جهانشمول بد (غیر اخلاقی) است» او در حال دادن این پیشنهاد است که برخی از مسائل اخلاقی عینی هستند. بنابر این عینی بودن اخلاقیات به معنی این است که گزاره هایی اخلاقی وجود دارند که بدون توجه به اینکه انسانها در مورد آنها چه فکر میکنند درست یا نادرست هستند یا اخلاقیات مستقل از ذهن انسانها هستند یا اینکه کشف شدنی هستند نه خلق و تعریف کردنی.
  • اخلاقیات ذهنی، نسبی گرایی اخلاقی، حقیقتشان کاملاً مبتنی بر وجود داننده این اخلاقیات است، مثلا اگر کسی بگوید «کشتن انسانها میتواند در شرایطی کار خوبی باشد و در شرایط دیگری کاری بد» او در واقع میگوید که «بد یا خوب بودن کشتن انسانها امری ذهنی است» و نمیتواند بصورت جهانشمول خوب یا بد باشد. بنابر این ذهنی بودن اخلاقیات به معنی این است که درست بودن یا نادرست بودن اخلاقیات به آنچه انسانها در مورد آنها فکر میکنند وابستگی دارد و یا اخلاقیات وابسته به ذهن انسانها هستند، یا اینکه خلق شدنی و تعریف شدنی هستند نه کشف شدنی.

یک سوء تفاهم رایج که در فهم عینیت و ذهنیت اخلاقیات وجود دارد این است که گمان میشود عینی بودن یا نبودن یک حقیقت اخلاقی مبتنی بر این است که آیا همه آنرا قبول دارند و بر اساس آن رفتار میکنند یا نه، حال آنکه عینیت اخلاقیات ارتباطی با اینکه افراد آنها را عینی بدانند و بر اساس آنها رفتار کنند ندارد. همچنین گاهی گفته میشود که اختلاف نظر فلاسفه بر سر عینیت اخلاقیات خود نشان میدهد که اخلاقیات عینی نیست، اشکال این سخن نیز این است که نظر فلاسفه را برابر با حقیقت میداند. البته این دو شبهه از شبهات بسیار مبتدی هستند ولی به دلیل رایج بودنشان مجبور به ذکر آنها هستیم.

روش ترتیب دیگر نظریه های فرا اخلاقی بر اساس این است که آیا گزاره های اخلاقی دارای معنی هستند (شناخت گرایی یا Cognitivism) و یا عاری از معنی هستند (ناشناخت گرایی یا Noncognitivism) معنی دار بودن یا نبودن در اینجا به این معنی است که آیا میتوان ارزشهای حقیقی درست و نادرست را به یک گزاره نسبت داد و در اثبات یا رد آن به روشهایی احتجاج کرد یا نه، آیا با خرد میتوان قضاوت اخلاقی کرد یا نه؟ از مسائل معروفی که در فلسفه اخلاق مطرح است مسئله ایست که با فرنام «مسئله است-بایسته است (Is-ought Problem)» شناخته میشود، این مسئله به این پرسش پاسخ میدهد که آیا میتوان حقایق اخلاقی را از حقایق دیگر انشقاق کرد یا نه؟ تمامی نظریه های فرااخلاقی شناختگرا پاسخ مثبت به این پرسش میدهند و سعی میکنند توضیح دهند که چگونه میتوان چنین ارتباطی را برقرار کرد. در اینجا من بر دومین اساس نظریه های مهم فرا اخلاقی را مرتب خواهم کرد یعنی نه بر اساس عینیت و ذهنیت این نظریه ها بلکه بر اساس شناختگرا بودن و یا نبودن آنها. (2)

  • شناختگرایی (Cognitivism)
    • تئوری خطای مکی (Mackie’s error-theory)، دیدگاهی است که میگوید حقایق عینی وجود ندارند و هیچ عملی نمیتواند بد یا خوب باشد، در نتیجه تمامی گزاره های اخلاقی نادرست هستند، جان لزلی مکی (J. L. Mackie) عمده ترین مدافع این دیدگاه است.
    • طبیعتگرایی (Naturalism) – اینکه حقایق اخلاقی وجود دارند که اینهمانی با حقایق طبیعی دارند یا بر اساس آنها شکل گرفته اند. از متفکران بیخدایی که در دوران اخیر از این دیدگاه متااتیکی دفاع کرده اند میتوان از، ردریک فیرت (Roderick Firth) ریچارد بوید (Richard Boyd) ، پیتر رایلتون (Peter Railton) و دیوید برینک (David Brink) نام برد. از نگر کسانی که مدافع این دیدگاه هستند حقایق اخلاقی زیر مجموعه ای از حقایق علمی هستند و استفسار اخلاقی با استفسار علمی تداوم می یابد، یعنی هر حقیقت اخلاقی را میتوان بگونه ای کاهش داد که به یک حقیقت طبیعی برسد و چون ابزار شناخت طبیعت علم است این دیدگاه حداکثر ارتباط را با علم دارد، چون طبیعت بیشترین رابطه با واقعیت را دارد لذا طبیعت گرایی را معمولاً عینی ترین دیدگاه متااتیکی میدانند. از نتایج طبیعت گرایی این است که انسانها هرچه طبیعت را بیشتر بشناسند و خردگراتر باشند بواسطه استخراج حقایق اخلاقی از حقایقی که در طبیعت موجود است در قضاوت درست در مورد گزاره های اخلاقی موفقتر خواهند بود.
    • شهودگرایی (Intuitionism) – اینکه حقایق اخلاقی وجود دارند که از نگر هستی شناسی یکتا هستند؛ به این معنی که آنها اینهمانی با حقایق طبیعی یا ماوراء طبیعی ندارند؛ حقایق اخلاقی توسط نوعی شهود اخلاقی شناخته می‌شوند. این دیدگاه در اوایل قرن 20 ام مدافعانی مانند جورج ادوارد مور (G.E. Moore)، و هنری سیدیک (Henry Sidwick) و سر ویلیام دیوید روس (W.D. Ross) داشت، اما متفکرین بیخدای زیادی امروز وجود ندارند که هنوز از این موقعیت به اخلاق نگاه کنند. از نگر کسانی که مدافع این دیدگاه هستند حقایق اخلاقی وجود دارند اما تداومی با استفسار علمی ندارند. منظور از درک شهودی یک چیز این است که بدون تجزیه و تحلیل های عقلی آشکار بتوان به حقیقتی رسید، یعنی بدون اینکه شخصی به استدلال و تعقل و تحقیق و تفکر به ذات و ماهیت یا نتایج یک عمل داشته باشد خود میفهمد که کدام کار بد است و کدام کار بد نیست این روش شبیه همان چیزی است که آنرا  گاهی علم حضوری در مقابل علم حصولی نیز میخوانند که بیشتر مورد نظر صوفیان و مورد انتقاد فلاسفه بوده است.
    • تئوری دستور الهی (Divine command theory)– میگوید چیزی خوب است که خدا میگوید خوب است و چیزی بد است که خدا میگوید بد است. افلاطون از زبان سقراط این دیدگاه را برای نخستین بار نقد کرده است و این نقد در ادامه خواهد آمد، این دیدگاه مدافعان معاصری همچون رابرت آدامز (Robert Adams) دارد.
    • تئوری مشاهده گر ایده آل (Ideal Observer Theory) -دیدگاهی است که میگوید حقایق اخلاقی را میتوان از نگر قضاوتی که یک مشاهده گر فرضی ایده آل در صورت وجود در مورد آنها میکرد، تفسیر کرد. یک مشاهده گر ایده آل هم معمولاً کسی تعریف میشود که افزون بر سایر ویژگی ها، شخصی بی طرف، کاملاً با اطلاع و خردگرا است.
    • نسبی گرایی اخلاقی، یا فرهنگ گرایی اخلاقی (Moral Relativism, Moral Culturalism) – دیدگاهی است که میگوید حقایق اخلاقی وجود ذهنی دارند که ارزش حقیقی یک گزاره اخلاقی از فرهنگ و جامعه ای به جامعه دیگری متفاوت است.
  • ناشناخت گرايى (Non-cognitivism) – بر اساس این دیدگاه هیچ حقیقت اخلاقی وجود ندارد و زبان اخلاقی برای ابراز حقایق استفاده نمی‌شود بلکه از آن برای نصیحت کردن و توصیه کردن و اظهار عواطف استفاده می‌شود. از نظر مدافعان این دیدگاه همچون چارلز استیونسون (C.L. Stevenson) زبان اخلاقی زبانی است آمیخته با عواطف که با هدف تحت تاثیر قرار دادن مخاطبین با نیروی این عواطف است. این دیدگاه بعدها توسط ریچارد مروین هر (R.M. Hare) و ویلیام فرانکنا (William Frankena) و افراد دیگری به تئوری پخته ای تبدیل شد که در آن منطق و خرد نقش اساسی بازی میکردند. از آنجا که از نگر کسانی که مدافع این دیدگاه هستند حقایق اخلاقی وجود ندارند، طبیعتاً تلاشی نیز برای بازبینی گزاره های اخلاقی انجام نمیگیرد بنابر این بی ارتباطی میان علم و اخلاق در این دیدگاه در حداکثر است.  با اینحال برخی از مدافعان این دیدگاه معتقد هستند که نصحیت های معتبر خردمحور، توصیه ها و اظهار نظرهای اخلاقی وجود دارند، دقیقاً همانطور که باورهای خردمحور علمی، تئوری ها و پیشبینی ها وجود دارند. سه نظریه مهمی که از ناشناختگرایی پدافند می‌کنند از این قرارند:
    • عاطفه گرایی (Ayer’s emotivism)- گفتن اینکه «فلان کار، کار خوبی است» تنها بیان یک سری احساسات است درست مانند احساساتی که در هنگام گفتن «بستنی با طعم موز خوب است (من بستنی با طعم موز را دوست دارم)».
    • شبهه واقع گرایی (Blackburn’s quasi-realism)- گزاره های اخلاقی از نظر زبانشناسی همانند ادعاهایی که میتوانند حقیقت داشته باشند هستند که میتوان آنها را درست یا غلط دانست ولی در واقع حقایق اخلاقی که بتوان این گزاره ها را به آنها نسبت داد وجود ندارند.
    • بیان هنجارها (Gibbard’s norm-expression) – کارکرد اصلی گزاره های اخلاقی، این نیست که حقیقتی را بیان کنند، بلکه این است که نظری تقدیری (Evaluative attitude) را در مورد چیزی که میتوان آنرا تقدیر کرد یا آنچه با هنجار ها خوب به نظر می آید را بیان کنند.
    • توصیه گرایی (Prescriptivism) – دیدگاهی است که در آن جملات حاوی گزاره های اخلاقی تنها جهت توصیه و نصیحت کردن آورده میشوند و معنی فراتر از آن ندارند، مثلاً «ویتامین سی خوب است»، از این دیدگاه یعنی «ویتامین سی بخورید!».

شاید هنوز فرق میان شاخه فرااخلاق و اخلاق هنجاری روشن نشده باشد، لذا اجازه دهید با مثالی تفاوت این دو شاخه را روشن تر کنم. فرض کنید من با دوستی در مورد این صحبت میکنم که آیا باید اسکناسی که در خیابان روی زمین افتاده است را بردارم یا بر ندارم، من معتقدم که نباید آنرا بردارم و دوستم معتقد است که باید آنرا بردارم. فلاسفه دو دسته پرسش در اینگونه موارد مطرح می‌کنند، دسته اول این است که کدام طرف درست میگوید و آیا برداشتن پول درست است یا بر نداشتن آن، پرسشهایی که در این حوزه مطرح میشوند به رده اخلاق هنجاری مربوط میشوند و پرسشهای دیگری نیز مطرح میشوند که در مورد خود پرسش » آیا باید اسکناسی که در خیابان روی زمین افتاده است را بردارم یا بر ندارم» و آنچه که وقتی این دو شخص دارند بر سر آن بحث می‌کنند، دارند واقعا راجع به آن صحبت می‌کنند مطرح می‌شود. پرسشهایی که در این حوزه دوم مطرح میشوند در رده فرااخلاق مطرح میشوند. متااتیکز راجع به علم اخلاق بحث میکند و اخلاق هنجاری راجع به خوب و بد. یکی از نویسندگان معاصر میگوید

متااتیکز در مورد این نیست که چه کارهایی را باید انجام بدهیم، بلکه در مورد این است که وقتی مردم راجع به اینکه چه کارهایی را باید انجام بدهند صحبت می‌کنند، چه کاری را دارند انجام می‌دهند. (3).

رابطه بین اخلاق و خدا و معرفی اخلاق سکولار

بعد از آنچه آمد، شاید هنوز این مسئله چندان برای کسانی که آشنایی چندانی با فلسفه اخلاق و مسائل آن ندارند آشکار نباشد اما واقعیت این است که بیشتر حملات پخته و عالمانه به بیخدایی از دیدگاه اخلاق، در مورد شاخه فرااخلاقی است نه در مورد شاخه اخلاق هنجاری زیرا مسائل مربوط به اخلاق هنجاری غالباً ارتباطی با خدا ندارند و مسائلی هستند که همه انسانها با آن در ارتباط هستند. از این گذشته اگر به تاریخ پدید آمدن و مطرح شدن تمامی نظریه های اخلاقی نگاه کنید میبینید که هرچه بیشتر تاریخ گذشته است و گنجینه تفکر آدمی غنی تر شده است فاصله بین این نظریه ها و دین و خدا و موهومات ماوراء طبیعی بیشتر شده است و همانطور که بشر به مرور زمان خدا را از علم بیرون کرده است در مرحله بعدی خدا را از فلسفه و اخلاق که زیر شاخه ای از آن هست نیز اخراج کرده و در مرحله بعدی وی را از اجتماع و سیاست نیز اخراج کرده است و تکامل فکری بشری وی را سکولار و سکولارتر کرده است. البته افزون بر این دلیل دیگری نیز برای این واقعیت وجود دارد و آن این است که جامعه غربی که قرنهاست مرکز تفکر و مدنیت است به جامعه ای کثرت گرا و سکولار تبدیل شده است که یگانگی در باورهای دینی ندارند حال آنکه جوامع باستانی وحدتگراتر بوده اند و اقلیت های دینی اگر هم وجود میداشتند بسیار کوچک بوده و حقوقشان نادیده گرفته میشده است.

بسیاری از خداباوران معتقدند که اخلاقیات عینی وجود دارند و وجود آنها نیز معلول وجود خدا است و اگر فرض کنیم خدا وجود نداشته باشد، آنگاه اخلاقیات عینی نیز وجود نخواهند داشت؛ از نظر این دسته از خداباوران بیخدایی در تناقض با وجود اخلاقیات عینی است و در نتیجه مروج بی اخلاقی است. این دسته از خداباوران حتی پا را فراتر گذاشته و میگویند یک شخص بیخدا به دلیل معتقد نبودن به وجود اخلاقیات عینی تنها بر اساس وضعیت روحی و روانی خود در هر زمان ممکن است رفتار کند و شخصی آنارشیست و بی اخلاق خواهد شد زیرا در نظر او اخلاقیات عینی نیستند بلکه ذهنی هستند، این مسائل و مسائلی از این دست اتهاماتی هستند که به بیخدایی از جانب خداباوران وارد میشود و من به رد آنها خواهم پرداخت اما علاوه بر رد اتهامات خداباوران که موضعی دفاعی است لازم است مبنا و پایه ای برای اخلاق سکولار نیز معرفی شود.

برای اینکه نشان دهیم بیخدایی با اخلاقیات عینی سازگاری دارد ابتدا باید مبنایی برای اخلاقیات غیر دینی تعریف و تشریح کنیم زیرا اگر این مبنی و پایه ساخته و تشریح نشود، هرگز نمیتوان به رفع اتهاماتی که خداباوران در مورد اخلاق به بیخدایی زده اند پاسخ کافی و مناسب داد. بهترین راه برای انجام این کار این است که نشان دهیم میتوان مبنا و اساسی برای اخلاق در نظر گرفت که مبتنی بر وجود خدا نیست. البته باید توجه داشته باشیم که منظور از گفتن «مبنای غیر دینی برای اخلاق» این نیست که بیخدایی و عدم وجود خدا را پیشفرض بگیریم بلکه تلاش بر این است که نشان دهیم اساساً اخلاق نیاز به وجود خدا ندارد. لذا حتی خداباوران نیز میتوانند پیروی از همین نظام اخلاقی سکولار بکنند بدون اینکه نیاز داشته باشند باورشان به خدا را کنار بگذارند و در واقع برای جلو گیری از شروری که معلول نظام اخلاقی باطلشان است باید چنین کنند.

پرسشهای اساسی اخلاقی که در مقابل بیخدایان وجود دارد این است که آیا درصورتی که خدا وجود نداشته باشد حقایق اخلاقی وجود خواهند داشت؟ اگر این حقایق میتوانند وجود داشته باشند، چگونه میتوان آنها را دانست؟ اگر نه حقایق اخلاقی وجود داشته باشند نه خدا وجود داشته باشد آیا توصیه های اخلاقی، ایده آل ها و غیره را میتوان خردمندانه دانست؟ به عبارت فنی تر بیخدایی سازگار با کدام نظریه های حسن و قبح و فرااخلاقی است؟

باید روشن باشد که بیخدایان ممکن است سه گونه موقعیت متااتیکی پیشرو در فلسفه امروزی را که در تعاریف نیز راجع به آنها توضیحات مختصری آورده شده اتخاذ کنند زیرا این سه دیدگاه به دلیل پیشفرض نگرفتن وجود خدا با دیدگاه بیخدایی هیچگونه ناسازگاری ندارند، این سه دیدگاه عبارت از طبیعتگرایی، شهودگرایی و ناشناخت گرایی است. مسئله دیگری که در اینجا مطرح میشود این است که ارتباط میان بیخدایی و این اساس و بنیان غیر دینی اخلاق چگونه است. مسلم است که بیخدایی بخودی خود هیچ ادعای اخلاقی را مطرح نمیکند که بخواهد ناسازگاری با این سه مکتب داشته باشد. از طرفی دیگر روشن است که اگر بیخدایی حقیقت داشته باشد آنگاه دیگر هیچ نظریه متااتیکی که خدامحور باشد نمیتواند از حقانیت و اصالت برخوردار باشد، حتی اگر این نظریه ها از نظرات و جنبه های دیگری نسبت به نظریه های غیر دینی برتری داشته باشند.

حال که دریافتیم بیخدایان میتوانند دستکم سه مکتب یاد شده را در حوزه متااتیکی اتخاذ کنند و در صورتی که چنین کنند دیگر در دیدگاه آنها اخلاقیات عینی خواهند بود، شایسته است به رفع اتهامات رایجی که از جانب خداباوران به بیخدایی در زمینه اخلاق زده میشود بپردازیم.

رد اتهامات رایج بی اخلاقی به بیخدایی

اتهاماتی که معمولاً خداباوران به بیخدایی در مورد ارتباط آن با اخلاق وارد می‌کنند معمولاً از سه دسته اتهامات خارج نیستند. دسته نخست اینگونه ادعا میکنند که برای اخلاقمدار بودن نیاز به انگیزه است و وجود انگیزه برای اخلاقمدار بودن تنها و تنها با وجود خدا میسر است لذا بیخدایان انگیزه ای برای اخلاقمدار بودن ندارند. دسته دوم میگویند که اخلاقیات عینی مشتق شده از وجود خدا هستند یعنی در صورتی که خدا وجود نداشته باشد دیگر خوب و بدی نمیتواند وجود داشته باشد و لذا حتی اگر بیخدایان برای اخلاقمدار بودن نیازمند به انگیزه نباشند یا انگیزه هم داشته باشند بازهم بیخدایی با اخلاقمداری ناسازگار است زیرا در صورت عدم وجود خدا حقایق اخلاقی نیز معدوم خواهند بود. سومین دسته از اتهامات به این قضیه اشاره دارند که دیدگاه ماده گرایی و یا طبیعت گرایی جهانی را متصور میشود که وجود حقایق اخلاقی در آن محال است و از آنجا که بیخدایی همراه با ماده گرایی یا طبیعت گرایی است، بیخدایی ناسازگاری بنیادین با اخلاقمداری دارد و در دیدگاه بیخدایی حقایق اخلاقی امکان وجود را ندارند. در اینجا بطور خلاصه و در حد بضاعت به بررسی هریک از این سه اتهام خواهیم پرداخت و نشان خواهیم داد که این اتهامات وارد نیستند و باطل هستند.

اتهام نخست بی انگیزه بودن بیخدایان برای اخلاقمدار بودن

پیش از پاسخ دادن و رد اتهامات رایجی که خداباوران به بیخدایی در این مورد میزنند، شایسته است کمی در مورد این پرسش اساسی و بسیار رایج تفکر کنیم که «اساساً چرا باید اخلاقمدار بود؟» این پرسش معروف کمی گنگ است بنابر این لازم است پیش از پاسخ دادن به این پرسش، آنرا به پرسشهای خرد تری که ممکن است از این پرسش فهمیده شوند تقسیم کنیم، دستکم چهار معنی را میتوان برای این پرسش در نظر گرفت:

1- هدف از دنبال کردن اصول اخلاقی چیست؟

2- چه چیزی باعث میشود که شخصی از اصول اخلاقی منتخب خودش پیروی کند؟

3- چرا دنبال کردن اصول اخلاقی شما، اخلاقی است؟

4- چرا اصول اخلاقی شما درست هستند؟

پاسخ به 1-هدف از دنبال کردن اصول اخلاقی چیست؟ این پرسش، در خود فرضی را نهان دارد و آن این است که دنبال کردن اخلاق ضرورتاً هدفی دارد و حال آن هدف مطلوب این پرسش است، این در حالی است که ممکن است بتوان بر روی اینکه آیا اساساً دنبال کردن اصول اخلاقی نیازمند هدف است یا نه شک کرد. اما با فرض اینکه پیروی از اصول اخلاقی نیاز به هدف دارد پرسش دیگری مطرح میشود و آن این است که آیا منظور از این هدف، هدفی است که انسان خود برای خود اختیار میکند یا اینکه از جانب چیز دیگری به او جبر میشود؟

برخی از فلاسفه معتقدند که اخلاق بطور ذاتی در آدمی موجود است، آدمی اصول اخلاق را از روی جبر دنبال میکند و هدفی را انتخاب نمیکند. آدمی اصول اخلاقی را دنبال میکند درست مثل آنکه آدمی تنفس میکند، این است که نمیتوان براستی گفت که آدمی هدفی را از روی اختیار اخلاق دنبال میکند، از این نقطه نظر اخلاق چیزی است که از پیش وجود دارد و جزئی از هستی است و ما اخلاق را با تفکر بوجود نمی آوریم بلکه با تفکر ارتباطی معرفتی با اخلاق برقرار میکنیم، لذا انسان در پیروی از یک سری اصول اخلاقی در هر زمانی مختار نیست بلکه ذات آدمی و فاعل بودن او ایجاب میکند که او جبراً از اصول اخلاقی خاصی پیروی کند بنابر این او خود برای پیروی از اصول اخلاقی، هدفی را اختیار نمیکند بلکه این هدف در فطرت و ذات او بعنوان انسان نهفته است، و در پاسخ به پرسش 2 به این مسئله بیشتر پرداخته خواهد شد. حال این پرسش مطرح میشود که این هدف نهفته در ذات آدمی چیست؟ پاسخ بسیار ساده است، کسب شادی!

هدف انسانها از دنبال کردن هر اصول اخلاقی در هر زمانی کسب شادی است. انسانها معمولا هر چیزی را برای چیز دیگری میخواهند، هر عملی را با هدفی انجام میدهند ولی تمامی این اهداف در نهایت به کسب شادی ختم میشوند و انسانها شادی را برای خود شادی میخواهند نه برای چیز دیگری. برای نمونه اگر از یک شخص مذهبی پرسش شود که او برای چه نماز میخواند، او خواهد گفت برای کسب رضایت خدا، اگر از او پرسیده شود که رضایت خدا را برای چه میخواهد او خواهد گفت برای به بهشت رفتن، اگر از او پرسیده شود که برای چه میخواهد به بهشت برود، او به همین ترتیب ادامه خواهد داد تا جایی که به «کسب شادی» برسد و او دیگر شادی را برای چیز دیگری نمیخواهند بلکه آنرا برای خود شادی میخواهد.

اما اینکه شادی چیست و چگونه میتوان شاد بود نیز بحث بسیار جالبی است و ارسطو پاسخ جالبی به این پرسش دارد در دیدگاه ارسطو برای تعریف شادی به تعریف فضیلت (Virtue) نیازمندیم. همه ما کسانی را میشناسیم که در حرفه ای مهارت دارند، مثلاً در نجاری عالی هستند. این افراد برای اینکه در امری اکتسابی عالی باشند ضرورتاً باید کارهایی را انجام دهند  مثلاً یک نجار عالی باید مدتی را به تمرین نجاری بپردازد. ارسطو معتقد است انسانها تلاش میکنند در انسان بودن هم عالی باشند، یعنی انسانی عالی باشند.  حال فضیلت یعنی انسانی عالی بودن، برجستگی اخلاقی داشتن و شادی  زمانی رخ میدهد که انسان عملی هماهنگ با یک فضیلت انجام میدهد-یعنی شادی آن چیزی است که انسانی برای انسانی عالی بودن انجام میدهد، در آن هنگام است که ماشین بیولوژیکی بدن احساس شادی را پدید می آورد بنابر این میتوان به پرسش 1 اینگونه پاسخ داد که انسان بطور ذاتی و فیزیولوژیکی شادی را میجوید و هدف او از دنبال کردن اصول اخلاقی نیز رسیدن به شادیست و این مسئله بین تمامی انسانها موجود است و انسانها به دلایل سخت افزاریشان سعی میکنند اخلاقمدار باشند! شکی نیست که نوع دوستی، همدلی و شفقت و دلسوزی در گونه انسانی ریشه هایی عمیق دارند و این مسئله ای ذاتی به نظر میرسد نه اکتسابی که ریشه در همان شادی جویی آدمی است، ممکن است افرادی معتقد باشند در میان سایر موجودات و حتی بافتهای بیولوژیکی ساده نیز رفتارهای و خصلتهای مشابهی وجود داشته باشد. ارسطو بعنوان نخستین یا دستکم یکی از نخستین فلاسفه ای که تلاش برای تنظیم نظام سازمانیافته ای از اخلاق کرد با اینکه در سایر آثار خود خدا را بسیار سهیم میدانست در بحثش پیرامون اخلاق هرگز از خدا استفاده ای نکرده است و اخلاق را مستقل از خدا مطرح کرده است.

دیوید هیوم فیلسوف اسکاتلندی معتقد است ریشه این کار را باید در سودی دانست که برای انسانها وجود دارد. انسانها با توجه به عواطفشان که ناشی از ویژگیهای فیزیولوژیکی بدنشان است در مورد شایست یا ناشایست بودن کارهای مختلف قضاوت میکنند. مثلاً وقتی میبینیم شخصی به گدایی یاری میرساند احساس خوبی نسبت به آن شخص به ما دست میدهد، وقتی میبینیم شخصی جیب شخصی دیگر را میزند احساس بدی به ما دست میدهد. هیوم معتقد است این احساس خوب یا بد، ناشی از تجربیات بشر است، بشر در کارهای مختلف سود و زیان های مختلفی را با توجه به تجربیات خود کشف میکند و این اکتشافها سبب میشود که آن احساسات به او دست بدهند.  مثلاً بشر در طول تاریخش و حیاتش دریافته است که دزدیدن از دیگران نتایج بدی را به بار می آورد و زیان آور است حال چه این نتایج زیان آور دیگران را تحت تاثیر قرار دهد چه خود شخص را، بنابر این برای کسی که این را دریافته است در هنگامی که با دزدی روبرو میشود احساس بدی نسبت به دزدی خواهد کرد.

بنابر این از آنجا که خود انسانها در نتیجه اعمالشان سهیم هستند اساساً بطور خودکار از اصول اخلاقی خودشان پیروی میکنند. حتی کسانی که باورمند به معاد هستند و به دلیل باور خود به معاد اخلاقمدار هستند نیز اینرا برای سود بیشتر (حوری، شراب بهشتی و سایر چیزهای خوب) و ضرر کمتر (شکنجه نشدن و سایر چیزهای بد) انجام میدهند و طبیعت انسان طبیعی و عادی این است که به نفع خود عمل میکند و در نتیجه اصول اخلاقی خود را پیروی میکند، و همان انسان که به نظر خداباوران میتواند برای منافع اخروی خود اخلاقمدار باشد میتواند برای منافع دنیوی خود نیز اخلاقمدار باشد. امکان مدح و ذم و بطور کلی نیازهای روانی انسان در هر حال به سهیم بودن انسان در نتیجه اعمالش کمک میکند و در بسیاری از موارد میتواند اگر نه علت اصلی دستکم انگیزه دهنده و آسانگر (کاتالیزور) برای پیروی از یک اصول اخلاقی باشد، لذا سیستم قضایی موفق سیستمی است که یک انسان را هرچه بیشتر در نتیجه اعمالش سهیم کند، اما عدم وجود مدح و ذم مسلماً به معنی سهیم نبودن انسان در نتیجه اعمالش نیست. از خداباوران بسیار شنیده میشود که میگویند اگر فلان کار را انجام بدهید نتیجه اش را خدا در همین دنیا در قالب یک بلا و بعنوان یک کیفر بر سر شما فرو خواهد فرستاد، و یا در صورت انجام فلان کار آدم «بد میبیند» اینها همگی نمونه های عامیانه است از بیان این حقیقت که آدمی در نتیجه کار خود سهیم است و اگر بد رفتار کند بد خواهد دید و اگر خوب رفتار کند خوب خواهد دید و برای شاد بودن ضروریست که انسان خوب باشد و هدف اصلی کتاب جمهوری افلاطون دقیقاً اثبات همین مسئله است و از همین رو این کتاب به کسانی که علاقه به این قضیه دارند توصیه میشود.

پاسخ به پرسش 2- همه انسانها قهراً از اصول اخلاقی خویش پیروی میکنند و نمیتوانند از اصول اخلاقی خویش پیروی نکنند، یا به عبارت دیگر قضاوتهای اخلاقی ما را مجبور به پیروی از نتایج این قضاوتها میکنند. شاید این ادعا کمی عجیب به نظر برسد اما با اندکی دقت میتوان صحت آنرا دریافت. دیدگاه قابل توجهی که برخی از فلاسفه و قدما همچون سقراط فیلسوف یونان باستان به آن باور داشته اند این است که اساساً بشر راهی جز پیروی کردن از اصول اخلاقی خود ندارد و همیشه انسانها با توجه به نظریه ها یا روشهای اخلاق هنجاری که در برخورد با کارهایی که در مورد آنها مختارند به ذهنشان میرسد، آنرا برمیگزینند که  خوبتر از باقی انتخابها به نظر میرسد، حتی هنگامی که به بدترین کارها دست میزنند. باید توجه کرد که این پرسش به «اصول اخلاقی یک شخص» اشاره دارد نه به «اصول اخلاقی درست» بنابر این، اینکه شخصی در پیروی از اصول اخلاقی خود دست به کاری بزند لزوماً به این معنی نیست که آن کار با اصول اخلاقی درست نیز انطباق داشته است.

برای نمونه وقتی دزدی در مقابل این انتخاب قرار میگیرد که آیا الماسی که توانایی دزدیدن آنرا دارد بدزدد یا نه و دزدیدن را اختیار میکند، او در محاسبات و بررسی های اخلاق هنجارانه اش (که ممکن است درست یا غلط باشند) به این نتیجه میرسد که دزدیدن این الماس خوبتر از ندزدیدن آن است و اگر به چنین دیدگاهی نرسد یقیناً اینکار را نخواهد کرد. ممکن است او بداند که دزدی کردنش کار ناعادلانه ای است اما اگر شخصی در زمانی دست به دزدی زده باشد یقیناً میتوان گفت که او در آن لحظه این عمل خود را خوب تصور کرده است و الا چنین کاری نمیکرد. ممکن است در نگاه اول فرض شود که دزد میداند دزدی کار بدی است و دزدیدن الماس کار خوبی نیست، اما در ذهن دزد، دزدی بطور قطعی بد نیست، بلکه میتواند در شرایطی خوب باشد، مثلاً یک دزد ممکن است هنگام دزدیدن الماس به این فکر بیافتد که این الماس گرانقیمت جزو اموال و دارایی های یک شخص یا گروه دیگر است و آن شخص و یا گروه برای بدست آوردن این الماس زحمت کشیده اند و دزدیدن آن منصفانه نیست، اما در مقابل آن به این فکر هم می افتد که صاحب این الماس از مزایای بیمه بهره میبرد و بیمه پول آنرا به آن شخص خواهد داد، یا اینکه درست است دزدیدن الماس یک شر است، اما شری اخلاقی است زیرا از وقوع شری بزرگتر جلوگیری میکند، به هر روی هرچه به ذهن دزد بیاید او در محاسبات و سبک سنگین کردن های خود به این نتیجه میرسد که دزدیدن الماس کار خوبی است و این مسئله همواره در تمامی اعمال انسانها پیش می آید و انسانها همیشه اینگونه برخورد میکنند. بنابر این دیدگاه اساساً اینکه به دنبال علتی غیر از خود انسان برای پیروی از اصول اخلاقی خویش بگردیم نابخردانه است، و انسانها مجبور به پیروی از اصول اخلاقی خود هستند و راهی غیر از پیروی از اصول اخلاقی خود ندارند. به عبارت دیگر قضاوتهای انسان در مورد یک عمل که معمولاً از روی یکی از تئوری های اخلاق هنجاری است به خودی خود به اندازه کافی آدمی را مجبور میکند که بر اساس آن قضاوت رفتار کند.

در مورد پرسش 3 و 4، باید گفت که این نوشتار از هیچیک از تئوری های اخلاق هنجاری و فرا اخلاقی دفاعی نمیکند بلکه تنها به بررسی ارتباط اخلاق با خدا میپردازد، بنابر این پاسخ به این پرسشها مجالی دیگر میطلبد و بر عهده مدافعان نظریه های مختلف است.

در طول تاریخ به بیخدایان اتهام وارد شده است که از هیچ چهارچوب اخلاقی عینی پیروی نمی‌کنند، برخی از آنها نمیتوانند باورمند به وجود حقایق اخلاقی بصورت عینی باشند، و برخی از آنها در حالی که باورمند به وجود حقایق اخلاقی هستند پیروی از آنها نمی‌کنند چون در دیدگاه بیخدایی انگیزه ای برای اخلاقمدار بودن وجود ندارد. بنابر این در هردو حالت از نظر کسانی که این اتهام را وارد می‌کنند بیخدایان بی اخلاق هستند. حال برای بررسی این اتهام لازم است ادعاهای مختلفی را مطرح کنیم، رادیکال ترین ادعایی که ممکن است مطرح شود این است که بدون خدا اخلاق وجود ندارد و هر بیخدایی بی اخلاق است، یعنی:

1. بدون اعتقاد داشتن به خدا محال است که کسی شخصیتی با اخلاقمداری بالا داشته باشد.

ادعای دیگر که به اندازه 1 رادیکال نیست میتواند اینگونه باشد که اگر چه ممکن است شخصی بدون اعتقاد به وجود خدا اخلاقمدار باشد، اما احتمال اینکه یک شخص بیخدا اخلاقمدار باشد کم است. یعنی:

2. احتمال این زیاد است که اگر شخصی بیخدا باشد، شخصیتی با اخلاقمداری بالا نیز نداشته باشد.

منتقد بیخدایی همچنین ممکن است بجای 1، و 2 ادعا کند که، احتمال اینکه شخصی بیخدا شخصیتی با اخلاقمداری بالا نداشته باشد بیشتر از این است که شخصی خداباور شخصیتی با اخلاقمداری بالا  نداشته باشد. یعنی:

3. احتمال اینکه شخصی بیخدا، دارای شخصیتی با اخلاقمداری بالا نباشد، بیشتر از این است که شخصی خداباور دارای شخصیتی با اخلاقمداری بالا نباشد.

حال باید روشن باشد که 1 نادرست است. پیروان دین جاینیسم (Jainism) بیخدا هستند، اما از اصول اخلاقی بسیار دقیقی پیروی می‌کنند که صدمه زدن به هر جانداری را ممنوع میدانند (4). از دیوید هیوم (David Hume) یکی از فلاسفه بزرگ بیخدا بعنوان شخصی که «بطور قدیس واری اخلاقمدار است» یاد شده است. (5)  از پرسی شلی (Percy Shelley) بیخدای معروف دیگری بعنوان شخصی بسیار اخلاقمدار یاد شده است (6). در واقع چون 1، یک ادعای کلی است  تنها کافی است که یک مثال نقض آورده شود تا نادرستی آن اثبات شود و میتوان یقین داشت که متعصب ترین دین داران نیز یقیناً میتوانند یک فرد اخلاقمدار را که بیخدا نیز هست را مثال بزنند.  لذا به همین دلیل ساده که خداباوران بی اخلاق در طول تاریخ وجود داشته اند و بیخدایان اخلاقمدار نیز در طول تاریخ موجود بوده اند میتوان به این نتیجه رسید که رابطه ضروری بین خداباوری و اخلاقمداری وجود ندارد یعنی هم میتوان خداباور بود و بی اخلاق و هم میتوان بیخدا بود و اخلاقمدار و وجود یک بیخدای اخلاقمدار منطقاً رابطه ضروری بین خداباوری و اخلاقمداری را که خداباوران سعی در اثبات آن دارند بطور کلی نابود میکند.

حال ممکن است شخص خداباوری که این اتهامها را مطرح می‌کند با این واقعیت ها موافقت نداشته باشد، آنگاه باید شک کرد که او منظورش از اخلاقمدار بودن این باشد که شخصی به خدا اعتقاد داشته باشد. یعنی به نظر میرسد تعریف او از اخلاقمداری این باشد که «شخص X، دارای شخصیتی اخلاقمدار است، اگر X خداباور باشد». اما از آنجا که «دارای شخصیتی اخلاقمدار بودن» معمولاً با این تعریف شناخته نمی‌شود، این بار بر گردن خداباور است که بگوید چه شواهد و اسنادی میتواند 1 را ابطال کند، و اگر 1 ابطال پذیر نباشد که اساساً حرفی خردمحور نیست و خداباور ادعای جدی ندارد بلکه مغلطه مصادره به مطلوب را مرتکب میشود. همینطور برای رد کردن 1 تنها کافی است که یک مثال نقض آورده شود، و همینکه من در این نوشتار رفتاری غیر اخلاقمدارانه را پیش نمیگیرم-برای نمونه به مخاطبین دشنام نمیدهم خود نشان میدهد که من (دستکم در این زمان) اخلاقمدارانه برخورد میکنم بنابر این رفتار من خود 1 را نقض میکند. افزون بر این 1 مستلزم تعریف دقیق «اخلاقمدار بودن» است و این تعریف باید زمان را نیز در نظر بگیرد یعنی تکلیف شخصی را که در زمانی اخلاقمدارانه عمل کرده است و در زمانی چنین نکرده است را نیز روشن کند زیرا اخلاقمدار خواندن یا نخواندن یک شخص بطور مطلق بسیار گنگ و نامفهوم است. بنابر این به نظر نمیرسد کسی بطور جدی مدعی درست بودن 1 باشد حال آنکه 1 را بیش از هر ادعای دیگری میتوان از خداباوران شنید و 1 به همین سادگی رد میشود و در سستی آن شکی نیست.

یک بیخدا ممکن است با گزاره 2 مشکلی نداشته باشد و آنرا تایید بکند، زیرا اشخاصی که بسیار اخلاقمدارند نادر و کمیاب هستند، و احتمال اینکه اشخاص دارای این کالای ناب نباشند بیش از این است که دارای آن باشند، بنابر این میتوان علاوه بر گزاره 2، گزاره زیر را نیز  درست دانست، زیرا این مسئله منحصر به بیخدایی نیست در میان خداباوران نیز مشابه همین گزاره صادق است:

‹2. احتمال این زیاد است که اگر شخصی خداباور باشد، شخصیتی با اخلاقمداری بالا نداشته باشد.

حال آیا ‹2 درست است؟ اگر درست باشند آنگاه 3 نادرست خواهد بود. چرا؟ شواهد عینی در مورد این ادعا بسیار گسترده هستند و تفسیر آنها دشوار است. قطعاً برخی از مطالعات نشان می‌دهند بین مذهب و ارتکاب جرم ، رفتار انسانگرایانه و تخلف ارتباطی  وجود ندارد، یعنی بیخدایان دست کم اگر از خداباوران اخلاقمدار تر نباشند حداقل به اندازه آنها اخلاقمدار هستند. بعنوان مثال تحقیقی توسط گرسوچ و الشیر (Gorsuch and Aleshire) که تا سال 1974 در مورد میزان باورمندی به مسیحیت و تبعیض های قومی انجام گرفته بود نشان داد که افرادی که کمتر در فعالیتهای کلیسایی شرکت میجویند بیش از کسانی که بسیار در این فعالیت ها شرکت میجویند رفتاری همخوان با تبعیض های قومی از خود نشان می‌دهند و کسانی که فعالیت زیادی در این زمینه دارند به همان اندازه از تحمل های قومی (بر خلاف تبعیض های قومی) برخوردار هستند که افرادی که اساساً به کلیسا نمیروند اینگونه هستند. نتیجه این تحقیق این بود که «داشتن موقعیتی ارزشی و قوی که به شخص اجازه میدهد خود را خارج از ارزشهای سنتی جامعه قرار دهد، در بروز دادن تحمل های قومی نقشی کلیدی را بازی می‌کند و افراد بسیار مذهبی به همان اندازه از این ارزشها برخوردار هستند که افراد غیر مذهبی» بنابر این گرسوچ و الشیر توصیه کرده اند که مذهبیون به همان اندازه اخلاقمدار هستند-حداقل در مسئله تحمل قومی که غیر مذهبیون اینگونه هستند. (7) همچنین همانگونه که ادلف گرانبوم (Adulf Grunbaum) اشاره کرده است، در ایالات متحده امریکا تقریبا 90% اجتماع به خدا معتقد هستند، و در مقایسه با برخی کشورهای اروپایی بویژه کشورهای اسکاندیناوی که کمتر از 50% مردم به خدا اعتقاد دارند، ایالات متحده آمار بیشتری از خودکشی و قتل و غیره را دارد. (8)

اما در مورد 3، در حال حاضر شواهد مستقیمی که بتوانند نشان بدهند 3 نادرست است وجود ندارد، از طرف دیگر شواهد معتبر برای اثبات 3 نیز وجود ندارد و در غیاب شواهد برای اثبات 3 میتوان گفت 3 قابل شک است. اما حتی اگر 3 را قبول کنیم این نیز نمیتواند به خودی خود نشان دهد که ارتباط مستقیمی میان بیخدایی و اخلاقمداری وجود دارد، زیرا ممکن است عوامل و خصایص دیگری در این شواهد نقش داشته باشند. بنابر این به نظر میرسد هیچکدام از این 3 ادعا که معمولاً توسط خداباوران مطرح میشوند نمیتوانند درست باشند و بیخدایان نیز میتوانند اخلاقمدار باشند. در میان برخی از حیوانات که بصورت گروهی زندگی می‌کنند مکانیزم های بسیار دقیق دفاع از حریم گروه جانوری، تغذیه جانورانی که مریض میشوند، تربیت کودکان برای زندگی بهتر و غیره وجود دارد که تمام این موارد به نوعی اخلاقمداری به شمار میروند، بنابر این به نظر میرسد اخلاق ارتباطی با خداباوری و دین نداشته باشد، مگر اینکه خداباوران معتقد باشند حیوانات نیز به دلیل خداباوری اخلاقمدار هستند، که در اینصورت، آنها باید این مسئله را اثبات کنند و این اثبات بسیار جذاب خواهد بود.

اما بدون توجه به اینکه این شواهد وجود دارند یا نه، دلیل اینکه خداباوران گمان می‌کنند بیخدایی با اخلاقمداری ناسازگاری دارد چیست؟ معمولاً این اتهام ارتباطی تنگاتنگ با معاد دارد، بیشتر خداباوران وقتی میگویند بیخدایان بی اخلاق هستند، صحنه روز محشر را در ذهن خود تصور می‌کنند که در مقابل دادگاه الهی ایستاده اند و یک موجود مطلقاً عالم و عادل در مورد اعمال آنها قضاوت می‌کند. آنگاه تصور می‌کنند که بیخدایان به چنین ماجرایی معتقد نیستند پس دیگر دلیلی برای اخلاقمدار بودن در دیدگاه بیخدایان وجود ندارد. این مسئله را میتوان بصورت زیر فرمولیزه کرد:

استدلال الف:

1.  اگر مردم باور نداشته باشند که خدا وجود دارد، آنگاه آنها دیگر دلیلی برای اعتقاد به اینکه «رفتار کردن بر اساس اخلاقیات عینی بطور مستقیم باعث پاداش گرفتن آنها خواهد شد و رفتار کردن علیه اخلاقیات عینی بطور مستقیم سبب مجازات شدن آنها نخواهد شد»، نخواهند داشت.

2. اگر مردم دلایلی برای باور به اینکه رفتار بر اساس اخلاقیات عینی سبب پاداش گرفتن می‌شود و رفتار بر خلاف اخلاقیات عینی سبب مجازات شدن می‌شود نداشته باشند، دیگر انگیزه ای برای رفتار بر اساس اخلاقیات عینی نخواهند داشت.

3. اگر مردم انگیزه ای برای رفتار بر اساس اخلاقیات عینی نداشته باشند، آنها بر اساس اخلاقیات عینی رفتار نخواهند کرد.

4- بنابر این اگر مردم به خدا اعتقاد نداشته باشند، بر اساس اخلاقیات عینی رفتار نخواهند کرد.

اما از آنجا که نشان دادیم بیخدایانی نیز ممکن است از اخلاقیات عینی پیروی کنند، باید دست کم یکی از فرضهای استدلال الف نادرست باشد. فرض شماره 2 مشکوک به نظر میرسد. مسلماً کسانی وجود دارند که پایبند به اخلاقیات عینی هستند و دلیل این پایبند بودنشان اعتقاد به پاداشها و مجازات های الهی نیست بلکه آنها به دلیل خوب بودن درونی و ارزش اخلاقی این اخلاقیات و همان مسئله کسب شادی و سود بدانها پایبند هستند. مثلا یک پزشک محقق ممکن است تمام باقیمانده عمر خود را صرف تحقیق بر روی نوعی از سرطان بکند تنها برای اینکه آن سرطان را از بین ببرد زیرا او تمایل و اشتیاق شدیدی برای از بین بردن شر دارد و سرطان را یک شر طبیعی میداند. همچنین ممکن است برخی از افراد به دلیل پاداشها و مجازاتهای مادی پر انگیزه شوند. مثلا یک میلیونر ممکن است میلیونها دلار پول را به سازمانهای خیریه کمک کند تا به پرستیژ و آبروی خود بیافزاید و یک شخص محتاط ممکن است از ترس اینکه دستگیر شود دست به دزدی نزند لذا اجر اخروی تنها انگیزه انسانها برای پیروی از اخلاقیات نیست و بدیل های دیگری نیز ممکن است تصور شوند.

فرض سوم نیز واقع گرایانه به نظر نمیرسد، بسیاری از مردم ممکن است انگیزه چندانی برای پیروی از اخلاقیات عینی نداشته باشند اما از روی عادت و یا تربیت و هنجار های اجتماعی اخلاقمدارانه رفتار کنند. از طرف دیگر نیز روشن است که همه کسانی که به خدا معتقد هستند و دیندار هستند نیز اخلاقمدار نیستند؛ مسلماً برخی از معتقدان به خدا قاتل، کودک آزار، زن ستیز، آدمکش، خائن و دزد هستند. حتی در مورد خداباوران اخلاقمدار نیز نمیتوان اطمینان داشت که اخلاقمدار بودن آنها بخاطر خداباوریشان و پاداش و مجازات های الهی باشد. اگر آقای الف به همسرش خیانت نکند، آیا این عمل او بخاطر باور او به معاد است یا به دلیل عشق او به همسرش و احترامی که برای او قائل است؟ رفتار او ممکن است انگیزه او را از خیانت نکردنش نشان ندهد، حتی ممکن است او خود نیز از انگیزه خود آگاه نباشد بنابر این روشن است که 3 نیز مردود است و ممکن است گاهی انسانها بدون داشتن انگیزه از اخلاقیات عینی پیروی کنند.

مشکل دیگری که این استدلال دارد این است که پاداش  و مجازات اخروی در همه ادیان و مذاهب و قرائتهای مختلف دینی از ادیان لزوما و تنها بر اساس رفتار انسانها در این دنیا نیست. بسیاری از مسیحیان معتقدند کسانی که مسیح را بعنوان خدایشان پذیرفته باشند به بهشت میروند و باقی مردم بدون توجه به رفتارشان به جهنم میروند. در تشیع و قرائتهای صوفیانه از اسلام نیز تقریباً همین مسئله به چشم میخورد. حتی در دیدگاه اصولگرایانه نیز برخی اعمال آنقدر ثواب دارند که میتوانند هر گناه دیگری را از بین ببرند و شخص مجرم را راهی بهشت کنند، مثلا شهدا بدون حسابرسی به بهشت میروند، نماز جماعت و یک دسته کارهای دیگر ثوابهای بسیار زیادی دارند و غیره. این مسئله مهم نه تنها استدلال بالا را رد میکند بلکه از ضعف های بزرگ اخلاقیات دین محور است.

استدلال الف آنقدر در نظر برخی از متکلمین مسیحی که در این زمینه فعال تر از سایرین هستند مشکوک و ضعیف است که برخی از آنها از آن دست برداشته اند و ادعاهای پخته تر دیگری را مطرح میکنند. یکی از این ادعاها آن است که خداباورانی میگویند: بیخدایان باید عدم وجود عدالت نهایی در جهان را بعنوان یک تراژدی بزرگ به رسمیت بشناسند که باعث میشود اخلاقمدار زندگی کردن بی معنی باشد. بنابر این استدلال انسانهای خوب و اخلاقمدار همیشه پیروز و سعادتمند نمیشوند و انسانهای بد و فاسد الاخلاق در بسیاری از اوقات پیروز میشوند. هرگاه خوب زندگی کردن و اخلاقمدار بودن سعادت، پیروزی و رفاه را به همراه نداشته باشد، آنگاه بخشی از انگیزه های انسانها برای خوب زیستن از آنها گرفته شده است. تنها خدا، یعنی یک موجود شکست ناپذیر با قدرت و عدالت کامل خود است که میتواند این مسئله را تضمین کند که اگر خوب زندگی کنید سعادتمند خواهید شد. اگر کسی اصول اخلاقی عینی داشته باشد اما دلایل خوبی برای دنبال کردن اصول اخلاقی عینی اش نداشته باشد، میتوانیم بگویم که او اصول اخلاقی نابخردانه ای دارد. این استدلال را اینگونه میتوان فرمولیزه کرد:

استدلال ب:

1. اگر خدا وجود نداشته باشد آنگاه تضمینی وجود نخواهد داشت که عدالت بر بی عدالتی و خوبی بر بدی پیروز خواهد شد.

2. اگر تضمینی برای پیروزی خوبی بر بدی و عدالت بر بی عدالتی وجود نداشته باشد، آنگاه اخلاقیات عینی بی معنی خواهند شد.

3. اگر اخلاقیات عینی بی معنی باشد، آنگاه پیروی از اخلاقیات عینی نابخردانه است.

4. بنابر این اگر خدا وجود نداشته باشد، آنگاه پیروی از اخلاقیات عینی نابخردانه است.

نتیجه استدلال ب بر خلاف استدلال الف با وجود بیخدایان با فضیلت و اخلاقمدار در تناقض نیست، زیرا فرض 4 سازگار با وجود افرادی اخلاقمدار و دارای فضیلت است که دلایل عقلی خوبی برای اخلاقمدار و با فضیلت بودن ندارند اما نابخردانه اخلاقمدارند. علی رغم اینکه استدلال ب از استدلال الف پخته تر است اما همچنان مشکل ساز است.  نخست اینکه در پذیرش برخی از فرضهای نهانی این استدلال دشواری هایی وجود دارد، برای نمونه به نظر میرسد این استدلال فرض میکند که وجود دنیایی ما کاملاً ناعادلانه است و این بی عدالتی را تنها میتوان با وجود آخرت جبران کرد. فرض 1 پرسشی مبنی بر انگیزه های خدا برای خلق کردن دنیایی ناعادلانه یا دستکم اجازه دادن به وجود بی عدالتی در این دنیا را بر می انگیزد، اما چرا دنیای سکولار و زمینی ناعادلانه است در حالی که آخرت عادلانه است؟ وجود بهشت نشان میدهد که انتخاب اخلاق با دنیایی بهتر از دنیای ما سازگار است، پس چرا خدا دنیای ما را «بهشت گونه» تر نیافریده است؟ فرض 2 باید باعث شود که خداباوران در لزوم مبارزه با بی عدالتی در زندگی سکولار ما شک کنند! اگر عدالت کامل در زندگی اخروی حاصل میشود اساساً چرا باید برای زدودن بی عدالتی در دنیا و در حال حاضر تلاشی کرد؟ طرح این مسئله از جانب خداباوران همانند این است که آنها تیری به سوی پای خود رها کنند و مسئله ای را مطرح کنند که گریبان خود را پیش از دیگران میگیرد. این دیدگاه خود یک دیدگاه ضد اخلاقی بسیار وحشتناک است، برای نمونه دژخیمان نظام جمهوری اسلامی این مسئله را زیاد مطرح میکردند که «اکنون ما اینها را اعدام میکنیم، اگر بیگناه باشند به بهشت میروند و اگر گناهکار باشند کمتر در آن دنیا عذاب میشوند»، آری باور به معاد در بسیاری از موارد حیات دنیوی انسانها را ضایع میکند، برای نمونه اسلامگرایان کودکان را که به عشق شهادت مسلح شده اند بر روی مین میفرستند و این کودکان با آن امید روی مین میروند و یا کمربند های خودکشی خود را منفجر میکنند که در آن دنیا دستشان به حوری های بهشتی برسد، لذا این مسئله نه تنها امتیاز خداباوری بر بیخدایی نیست بلکه نقطه ضعف آن است و زندگی خداباوران را تهی از معنی میکند و دین را به افیون تبدیل میکند چون پیروزی عدالت بر بی عدالتی را تضمین شده میپندارد و انگیزه را از انسانها برای کسب عدالت و نیک کرداری میگیرد!

گذشته از این مشکلات و پرسشهای اساسی که در مورد فرضهای نهان در این استدلال مطرح میشوند، فرض 2 اشکالاتی دارد. عدم وجود تضمین میتواند به این معنی باشد که پیروزی کردار عادلانه بر کردار شر، نا مسلم و غیر قطعی است! حال چرا اینکه پیروزی عدالت بر شر ممکن و نه قطعی است برای خداباور مدعی استدلال ب کافی نیست؟ برای نمونه یک مصلح سکولار که به ستیز با بی عدالتی های اجتماعی بر میخیزد، در بسیاری از اوقات به اینکه ستیز و تکاپویش یقیناً نتیجه مثبت خواهد داد، باور ندارد، اما همین که امکان تحصیل این نتیجه مثبت وجود دارد، هرچند این امکان بسیار کم باشد، همین امکان کم  وی را برای این تکاپو بسیار پرانگیزه میکند و دلیلی بسیار قوی به وی برای تلاش و تکاپو و ستیز با بی عدالتی میدهد. باور داشتن به اینکه احتمال پیروزی هرچند اندک وجود دارد، این افراد را اغلب علیه آن چیزی که بسیار محتمل تر (پیروزی بی عدالتی های اجتماعی) است پر انگیزه میکند. یک مصلح اجتماعی آنقدر برای هدفش ارزش قائل است که حتی امکان بسیار پایینی برای پیروزی، دلیلی بسیار بزرگ برای ادامه و انجام اصلاحگری به او میدهد. با توجه به پیچیدگی های دنیا و تحوّلات غیر قابل پیشبینی و حتی گاهی غیر قابل توصیف، دانستن اینکه پیروزی اخلاق سکولار در دنیا بر شر غیر ممکن است با هر میزان از اطمینان برای ما بسیار نادر است. این بی اطمینانی هنگامی که با ارزش بسیار بالای پیروزی اخلاقی ترکیب میشود یقیناً انگیزه بسیار بالا و کافی و دلیلی بسیار قوی را میتواند برای کردار اخلاقمدارانه و زیستن با فضیلت ایجاد کند پس بر خلاف 2 غیر قطعی بودن پیروزی خوبی بر بدی سبب بی انگیزه بودن آدمی برای اخلاقمدار بودن نمیشود.

با اینحال فرض کنید که بیخدایان میتوانستند بطور قطعی بدانند که شر در هزاره آینده پیروز خواهد شد. برای نمونه تصور کنید ما میدانیم که دسته ای از دیکتاتور ها که باعث میشوند هیتلر و استالین و خمینی در مقایسه با آنها فرشته به نظر بیایند حاکمان زمین در هزاره آینده باشند و در طول این هزار سال، شکنجه، مرگ و برده داری حاکم خواهد بود. همچنین فرض کنیم که بطور قطع میدانیم تمام آثار حیات بر روی کره زمین در اثر یک هولوکاست اتمی در سال 3000 از بین خواهد رفت. چرا این فرضها باید این معنی را برسانند که مردم دیگر نباید اخلاقمدار و دارای فضل باشند؟ آیا شهامت و شجاعت برای نجاتی اخلاق پسندانه در این دوران ارزش و فضیلتی بنیادین و اساسی و ارزشمند نیست؟ آیا تشریک دلسوزی ها و نیکوکاری بین مردم به آنها در راه مبارزه با حاکمان خونخوار و شرایط بد یاری نمیرسانند؟ آیا بشر به دانستن اینکه چگونه میتوان در زمینی اینچنین جهنمی زیست کند نیازی نخواهد داشت و از این منبع به شادی و سود نخواهد رسید؟ افزون بر این، علی رغم این واقعیت که بنابر فرضیه ما، سرانجام نیکی بر بدی پیروز نخواهد شد، عدالت سرانجام پیروز نخواهد شد و جامعه در نهایت بسیار ناعادلانه خواهد بود؛ افراد بافضیلت و اخلاقمدار ممکن است در گوشه ای از تاریخ و جغرافیای این جهان بی عدالت، جامعه ای عادلانه ایجاد کنند. مسلم است که کسی نمیتواند این حقیقت را که جامعه ای ناعادلانه که در آن چشمه هایی از عدالت وجود دارد و مردمان خوب و اخلاقمداری نیز ممکن است در آن یافت شوند بهتر از جامعه بی عدالت بدون چنین افرادی است، انکار کند و این مسئله نیز استدلال ب را دچار مشکل میکند.

یک نکته دیگر که با استدلال ب ارتباط دارد این است که میتوان استدلال کرد اگرچه فضیلت ارزشهایی درونی نیز دارد، باید آنرا تنها در قالب یک کل بزرگتر مورد توجه قرار داد، بصورتی که ارزش فضیلت و اخلاقمداری زمانی تکمیل میشود که با چیزهای دیگر ترکیب شده باشد، و این تکامل تنها در بینش دینی از جهان تضمین شده است. برای نمونه خداباوران ممکن است بگویند اگر چه فضیلت و اخلاقمداری ذاتاً دارای ارزشهایی است اما این ارزش را تنها در قالب یک کل میتوان قبول کرد و آن دیدار و عشق به خداوند است که در زندگی اخروی حاصل میشود. علی رغم بی پایه بودن چنین دیدگاهی یک بیخدا لازم نیست این گفته را رد کند، او میتواند بپذیرد که ارزش فضیلت اگر خدایی وجود داشته باشد ممکن است افزایش پیدا کند، اما این به آن معنی نیست که اگر خدایی وجود نداشته باشد اخلاقمدار بودن و فضیلت داشت بی معنی و پوچ باشد و هدف ما هم نشان دادن این مسئله است.

نتیجه میگیریم که اخلاقمدار بودن و فضیلت داشتن بدون دانش به اینکه نیکی بر بدی سرانجام پیروز میشود میسر است. حتی اگر ما بدانیم که سرانجام بدی بر نیکی پیروز میشود و بشریت بر اثر حوادث ناگوار نیست خواهد شد، باز هم اخلاقمدار بودن و فضیلت داشتن سودمند و با معنی است. افزون بر این فضیلت داشتن و اخلاقمدار بودن هنگامی که تنها احتمال پیروزی را بدهیم دارای ارزش میشود و ارزش بالای پیروزی برای آدمی انگیزه قوی و کافی برای اخلاقمدار بودن ایجاد میکند و نهایتاً اگر فرض کنیم فضیلت داشتن در دیدگاه خداباوری دارای ارزش بیشتری از دیدگاه بیخدایی است، حتی در آن هنگام نیز فضیلت ذاتاً و به خودی خود آنقدر به اندازه کافی دارای ارزش است که آدمی را پرانگیزه کند.

مسئله دیگر که باید در اینجا به آن اشاره کرد این است که در این دیدگاه بطور پنهانی از فرض بسیار بزرگتری استفاده شده است و آن هم فرض وجود حیات اخروی یا معاد است. معاد هیچ ارتباط منطقی با توحید ندارد و اثبات معاد نیازمند استدلالها و مدارک و شواهدی است که خداباوران به سادگی نمیتوانند از کنار آن عبور کنند و جواب قانع کننده ای برای اثبات آن و مسائل حاشیه ای همچون روح ندارند. این است که اساساً از آنجا که خداباوری مستقل از معاد است و ربطی به آن ندارد، یعنی اگر خدا وجود داشته باشد ممکن است معاد وجود نداشته باشد و اگر خدا هم وجود نداشته باشد ممکن است معاد وجود داشته باشد (!) اساساً این بحث بی ارتباط با موضع بیخدایی است، زیرا بیخدایی یک موضع فلسفی در قبال خدا است نه معاد. اگر چه با نادیده گرفتن این ایراد اساسی نیز باز این استدلال ره به جایی نمیبرد. نتیجه نهایی آنکه این اتهام به بیخدایی وارد نیست و چنین استدلالهایی در اثبات این اتهام موفق نیستند.

اتهام دوم انشقاق حقایق اخلاقی از حقیقت وجود خدا

خداباوران پس از تفکر در مورد رفع اتهامی که در بالا انجام شد ممکن است بپذیرند که اگر حقایق عینی اخلاقی وجود داشته باشند، بیخدایان نیز ممکن است انگیزه کافی برای پایبند بودن به اصول اخلاقی عینی داشته باشند، اما ادعا کنند که حقایق عینی اخلاقی مشتق شده از وجود خدا هستند و اگر خدا وجود نداشته باشد حقایق اخلاقی نیز وجود نخواهند داشت لذا اساسا در دیدگاه بیخدایی حقایق اخلاقی وجود ندارند که بیخدایان بخواهند به آنها پایبند باشند، لذا بیخدایی لزوماً بی اخلاقی را نتیجه میدهد. در ارتباط با وجود حقایق عینی اخلاقی و حقیقت وجود خدا مسئله ای معروف به معمای ائوتوفرون (Euthyphro) در فلسفه وجود دارد که مربوط به یکی از آثار ابتدائی افلاطون است و در آن سقراط اندکی پیش از دادگاهی شدن با ائوتوفرون مردی که عالم دینی محسوب میشده است روبرو میشود و از او میپرسد «آیا خدایان یک شخص مومن/پارسا و مقدس را دوست دارند چون او مقدس و مومن است یا اینکه او مقدس و مومن است چون خدایان او را دوست دارند؟». این پرسش سقراط در واقع به ارتباط وجود خدا و وجود اخلاقیات عینی ارتباط مستقیم پیدا میکنند. ریشه خوبی چیست؟ آیا خوبی خوب است چون خدا آنرا اراده میکند یا اینکه خداوند خودش خوبی را اراده میکند؟ آیا خدا به خوبی امر میکند یا خوبی چیزی است که خدا آنرا امر کرده؟ معمولاً هر خداباوری معتقد است که «خدا خوب است»، حال این گزاره که یک صفت را به خدا نسبت میدهد در حقیقت به چه معنی است؟ ارتباط میان خدا و خوبی میتواند یکی از حالات زیر باشد:

1- خدا خوب است- یعنی خوبی مستقل از خدا وجود دارد و خدا از خوبی پیروی میکند، یعنی چیزهایی خوب هستند و خدا آنها را خوب میداند و چیزهایی خوب نیستند و خدا آنها را خوب نمیداند، در این صورت چه خدا وجود داشته باشد چه نداشته باشد خوبی و بدی وجود دارند، ارزشهای اخلاقی بطور عینی وجود خواهند داشت و در نتیجه اخلاقیات عینی در دیدگاه بیخدایی نیز وجود خواهند داشت و از دیدگاه خداباوری دستورات الهی دیگر منبع اخلاقیات نیستند بلکه اطلاعاتی در مورد اخلاقیاتی که وجود دارند هستند و خود خدا نیز همچون ما تابع اخلاقیات است نه خالق آنها. همچنین این دیدگاه مشکلی را برای خداباوری بوجود می آورد و آن این است که خدا در اینصورت دیگر خوبی را خلق نکرده است پس دیگر او خالق همه چیز غیر از خودش نیست و افزون بر خدا چیزهای قدیم دیگری نیز وجود دارند که اتفاقاً در ذاتشان به تعبیر خود خداباوران اوجب از خدا هستند و این دیدگاه با بسیاری از دیدگاه های خداباوری از جمله اسلام در تناقض است.

2- خوب(ی از) خدا است- که در اینصورت وجود خوبی مشتق شده از وجود خدا است، یعنی وقتی چیزی خوب است که خدا آنرا خوب دانسته باشد و خدا هرچه را خوب بداند آن چیز خوب است. در این صورت دیگر معنی ندارد که خداباوران خدا را خوب بدانند مگر اینکه بگویند خوبی خدا به این معنی است که او از آنچه خود وضع کرده تخطی نمیکند که با خوب بودن تفاوت دارد، مشکل دوم این است که بنابر این دیدگاه اگر خدا میخواست که برای نمونه تجاوز و قتل عمد برای لذت و شکنجه افراد برای خنده فاعلین به این اعمال خوب باشند آنگاه این چیزها خوب میبودند که بعید است کسی چنین چیزی را واقعاً باور داشته باشد. در این دیدگاه دستورات خدا دل بخواهی و از روی هیچ منطق و اسلوبی نیستند پس در واقع حقایق اخلاقی نیستند و دلیلی ندارند ما حتی آنها را بپذیریم، دلیل اینکه باید از خدا پیروی کرد هم این نیست که او درست میگوید بلکه این است که او رئیس است یا بعبارت دیگر زورش از ما بیشتر است! از این مهمتر آن است که از این طریق دیگر اخلاقیات عینی وجود نخواهند داشت و چیزی به خودی خود خوب یا بد نخواهد بود بلکه خوبی و بدی به ذهن خدا بستگی خواهد داشت، و این همان چیزی است که خداباوران میخواهند به بیخدایی نسبت بدهند، آنها میخواهند بگویند که بیخدایی در تناقض با اخلاقیات عینی است، لذا در اینصورت آنها خود دچار این مشکل میشوند و این دیدگاه خداباوری است که ناسازگار با اخلاقیات عینی میشود نه بیخدایی. در میان متفکرین مسیحی لوتر، کالوین و کیرکگارد این دیدگاه را داشته اند.

3- خدا خود خوبی است- که این بی معنی است چون خوب بودن یک مفهوم است و خدا یک موجود است که ادعا میشود مصداقی از مفهوم خوبی است، حال چگونه میتوان بجای اینکه گفت یک موجود مصداق یک مفهوم است ادعا کرد که یک موجود خود یک مفهوم است، یعنی مفهوم را بجای برابر قرار نهادن با صفات یک موجود با ذات آن برابر نهاد، یعنی مثلاً بجای اینکه گفت سیب قرمز است گفت سیب قرمزی (قرمز بودن) است. همچنین در صورتی که خدا خود خوبی باشد آنگاه گزاره «خدا خوب است» برابر و هم معنی با «خدا خدا است» میشود که عبارتی بی فایده است و بدیهی است که هر چیزی خودش است! و اگر برای رفع این مشکل گفته شود که برابری خدا با خوبی، برابری ذات او با خوبی نیست بلکه حاکی از یک صفت یا خصیصه در ذات خدا است، آنگاه در واقع خداباور باز هم همان حالت 2 را تایید کرده است نه 3.  همچنین این پرسش اساسی پیش می آید که ذات خدا را چه تشکیل میدهد آیا او ذات خود را از روی اختیار انتخاب میکند (آنگاه حالت 2) یا اینکه این ذات از عوامل والاتری ریشه میگیرند و او به جبر ذات خود را داراست (آنگاه 1)؛ لذا چنین سخنی مشکل را حل نمیکند بلکه صورت مسئله را از خدا به ذات خدا تغییر میدهد (آیا خدا خوب است چون ذاتش خوب است یا ذات خدا خوب است چون خدا آنرا دارد؟) و پاسخ درستی به پرسش مطرح شده نمیدهد. این حالت را معمولاً متکلمین مسیحی برمیگزینند.

برترند راسل این مسئله را در کتاب «چرا من یک مسیحی نیستم» اینگونه مطرح کرده است:

اگر شما کاملاً اطمینان دارید که میان خوب و بد تفاوتی وجود دارد، آنگاه شما در این موقعیت قرار میگیرید: آیا این تفاوت معلول اراده خدا است یا نه؟ اگر مبتنی بر اراده خدا است، آنگاه برای خود خدا دیگر تفاوتی میان خوب و بد نیست، و دیگر عبارت «خدا خوب است»  بی معنی است. اما اگر شما نیز همچون متکلمین بگویید «خدا خوب است» آنگاه باید قبول کنید که خوبی و بدی جدا و مستقل از اراده خدا وجود دارند، زیرا اراده های خداوند خوب هستند و این خوبی ناشی از آن نیست که این اراده ها از جانب خدا هستند و اگر شما اینرا بگویید تایید کرده اید که خوبی و بدی از جانب خدا بوجود نیامده اند بلکه در ذاتشان منطقاً مقدم بر خدا هستند. (9)

افزون بر این مسئله که به تمامی خداباوران مربوط میشود و در باورهای آنها اخلال ایجاد میکند در منابع برخی از دیدگاه های خداباوری ویژه میتوان دریافت که به وجود اخلاقیات مستقل از وجود خدا اشاره شده است. برای نمونه به آیه زیر از قرآن توجه کنید:

سوره اعراف آیه 28

وَإِذَا فَعَلُوا فَاحِشَةً قَالُوا وَجَدْنَا عَلَيْهَا آبَاءَنَا وَاللَّهُ أَمَرَنَا بِهَا قُلْ إِنَّ اللَّهَ لَا يَأْمُرُ بِالْفَحْشَاءِ أَتَقُولُونَ عَلَى اللَّهِ مَا لَا تَعْلَمُونَ
و هنگامي كه كار زشتي انجام ميدهند ميگويند پدران خود را بر اين عمل ديديم، و خداوند بما دستور داده است! بگو خداوند (هرگز) دستور به عمل زشت نمي‏دهد آيا چيزي بر خدا مي‏بنديد كه نمي‏دانيد؟

در این آیه به مردمی اعتراض میشود که اعمال بدی را انجام میدهند و در توجیه اعمال خود میگویند که خدا آنها را به انجام چنین اعمالی دستور داده است، و گفته میشود که خدا دستور به عمل زشت نمیدهد، این بدان معنی است که عمل زشت و در نتیجه زشتی و خوبی (حسن و قبح) جدا از خدا وجود دارند و این خدا است که دستور به خوبی میدهد نه اینکه دستور خدا خوب باشد، یعنی برای فهمیدن اینکه آیا عملی را خدا توصیه کرده یا نه باید دید که آن عمل خوب است یا نه، به عبارت دیگر قرآن حالت 1 از حالات مطرح شده در بالا  را درست دانسته است، لذا مسلمانان بنابر این آیه هرگز نمیتوانند ادعا کنند که حقایق اخلاقی مشتق از حقیقت وجود خدا هستند و این  اتهام ربطی به مسلمانان ندارد.

برخی دیگر از خداباوران منظورشان از طرح این اتهام آن است که اگر کسی برای ما مشخص نکند چه چیزی درست است و چه چیزی درست نیست آنگاه ما ابزاری در اختیار نداریم که درستی یا نادرستی چیزی را با آن مشخص کنیم، بنابر این بدون وجود یک مرجع نمیتوان چیزی یا عملی را خوب و بد دانست، مثلاً اگر خدایی وجود نداشته باشد که به انسانها بگوید شکنجه کردن فرد بیگناه تنها برای لذت بردن کاری بد است، انسانها نمیتوانند خود این را درک کنند! این دیدگاه نیز با آنچه در بالا مطرح شد از ارزش تهی میشود و مشکل بزرگ دیگر آن این است که وجود خدا به معنی این نیست که این خدا صحبت هم میکند یا کتابی را به کسی دیکته میکند، خدایی که در این دیدگاه مطرح میشود مشخصاً خدای ادیانی است که مبتنی بر «وحی» هستند و در نتیجه چنین خداباوری پیش از مطرح کردن این ادعا باید «نبوت» را نیز اثبات کند در غیر این صورت دلیلی وجود ندارد که یک خداباور معتقد باشد خدا در زمینه های کتاب نویسی هم فعالیت میکند، اشکال دیگر این مسئله این است که با تمامی تئوری های اخلاق هنجاری غیر از «نظریه فرمان الهی» در تناقض است و تقریباً تمامی فلاسفه اخلاق با چنین نظری مخالفت دارند زیرا بخش بزرگی از فلسفه اخلاق به همین مسئله و تشریح روشهای مختلف برای ارزشگزاری حقایق اخلاقی اختصاص دارد و این نظر تنها هنگامی درست است که تمامی نظریه های اخلاق هنجاری را رد کند. شیوه های اخلاق هنجاری سکولار مختص بیخدایان نیستند و خداباوران نیز مجبورند از آنها پیروی کنند و هیچکدام از این شیوه ها اینگونه کار نمیکنند که عملی را خوب یا بد بدانند چون فلان شخص و یا فلان مرجع آنرا خوب یا بد دانسته است بلکه همانطور که توضیح داده شد یا بر اساس ذات آن عمل و یا بر اساس نتایج آن در مورد آن قضاوت میکنند. افزون بر این مشکل بزرگ دیگر آن است که روش معتبر و علمی درستی که بتوان به یاری آن با فرض اینکه خدا وجود دارد و صحبت هم میکند دریافت که کدام سخن از خدا است و کدام سخن از خدا نیست پی برد. همچنین بنابر آیه مطرح شده در بالا مسلمانان نمیتوانند مدعی چنین چیزی بشوند و در نهایت این موضع یکی از سخیف ترین و خطرناک ترین و حقیقتاً ضد اخلاقی ترین مواضعی است که یک انسان میتواند در قبال اخلاق اتخاذ کند و برای درستی گزاره های اخلاقی مرجعی غیر از ذهن انسان در نظر بگیرد. فاجعه آمیز ترین اتفاقاتی که در تاریخ افتاده است زمانی انجام گرفته است که قضاوتهای اخلاقی بجای اینکه بین دو گوش انجام بگیرند بین دو جلد یک کتاب از جانب افراد تک کتابی انجام گرفته اند. توضیحات و استدلالهای بیشتر در این زمینه در نوشتاری با فرنام «آیا دین ضامن اخلاق در اجتماع است» آمده است. بیشتر اوقات چنین مطالبی از جانب کسانی گفته میشود که با نظریه های اخلاق هنجاری آشنایی ندارند و طبیعتاً در صورت آشنا شدن با این تئوری ها متوجه میشوند که راه های معتبر تری برای تشخیص ارزش حقیقی گزاره های اخلاقی وجود دارد. گروهی ممکن است در پاسخ به این مسئله بگویند عقل آدمی کامل نیست که البته این سفسطه در نوشتاری با فرنام «عقل آدمی کامل نیست!» نقد شده است.

افزون بر این ایراد ها، اگر به جهان واقعیت نگاهی بکنیم میبینیم که خداباوری در مناطق مختلف اصول اخلاقی مختلفی را «مشتق» کرده است، انسانها بیشتر بر اساس باورهای اجدادشان ادیان را انتخاب میکنند و به همین دلیل است که بیشتر ساکنین شهر میلان مسیحی هستند و بیشتر ساکنین مدینه مسلمان هستند. از طرفی دیگر دین ظاهراً نتیجه اخلاق خدامحور است، و ادیان مروج اصول اخلاقی متفاوت و گاهی کاملاً متضاد با یکدیگر هستند، با در نظر گرفتن این واقعیت ها به این نتیجه میرسیم که در واقع خداباوری در عمل نه تنها یگانگی و عینیت در اخلاقیات را نتیجه نمیدهد بلکه دقیقاً برعکس آن ذهنی بودن اخلاقیات و اختلافات فاحش بر سر مسائل اخلاقی را نتیجه میدهد.از آنجا که اخلاقیات یک بیخدای اهل میلان و یک بیخدای اهل مدینه بر اساس خرد آنها و واقعیت ها است، آنها میتوانند به سادگی بر سر مسائل اخلاقی به توافق برسند چون مشترکات آنها محکمترین مبناهای ممکن فکری است، اما از آنجا که اصول اخلاقی یک مسیحی و یک مسلمان مبتنی بر اسطوره های نژادی و قومی و جغرافیایی و باورهای خرافی و اباطیل به ارث رسیده به آنها از اجدادشان است، آنها در نهایت مروج و هوادار دو گروه از اصول اخلاقی کاملاً مجزا و مختلف از یکدیگر خواهند بود. لذا اینکه خداباوران تصور میکنند با وجود داشتن خدا مسئله اخلاق حل میشود و اخلاقیات عینی میشوند کاملاً غیر واقع بینانه است زیرا سخنانی که این خدا گفته است یا دیکته کرده است از نظر باورمندان آن کاملاً متفاوت هستند، حال آنکه اصول عقلی و واقعیت ها همه جا یکسان هستند. در نتیجه خداباوری در عمل در دنیا موجب ترویج ذهنی گرایی در اخلاقیات میشود و خداباوران همان مشکلی را در جهان پدید می آورند که گمان میکنند گسترش بیخدایی آن مشکل را بوجود می آورد. چنین مسئله ای در جامعه پلورالیست غربی که برای تفاوت باورها و اندیشه ها احترام قائل است و طیف های فکری مختلفی را سخاوتمندانه و بزرگوارانه میزبانی میکند نه تنها نا کار آمد بلکه مرگ آساست.

افزون بر اختلافات بین دینها، درون هر دین هم تفاسیر و قرائت های مختلفی از اصول اخلاقی وجود دارد، کسانی وجود دارند که با پیروی از اصول اخلاقی مسیحیت تمام عمر خود را وقف رسیدن به بیماران و تهی دستان میکنند و کسانی هم وجود داشته اند که دانشمندان را با پیروی از همان اصول اخلاقی مسیحی سوزانده اند و غیر مسیحیان را شکنجه کرده اند و میلیونها سرخ پوست را کشته اند، و این در هر دینی رایج است. لذا کم مسئله ای نیست دریافتن اینکه اگر خدا وجود دارد امروز چه وضعیت روحی دارد، روی عادت ماهانه اش است و قاسم الجبارین و مکار است یا خوشحال و خوش اخلاق و سر کیف و در حالت رحمان و رحیم خود است، و از روی این وضعیت روحی اش چه میگوید و از ما چه میخواهد و به تعداد دینداران عالم برای این پرسش، پاسخ وجود دارد! پس گفتن اینکه خدا منبع اخلاق است نه تنها هیچ مشکلی را حل نمیکند بلکه باعث میشود میلیاردها اصول اخلاقی که همگی مبتنی بر حماقت آدمی است در تفسیر وضعیت روحی خدا و آنچه امروز از آدمی انتظار دارد و میخواهد بوجود بیاید و این خود موجب آنارشیسمی وحشتناک است و اگر سکولاریسم در جهان نبود خداباوران یکدیگر را همچنان میخوردند و به زن و بچه یکدیگر تجاوز میکردند یا آنها را به بردگی میگرفتند و اینرا نیز خواست خدایانشان میدانستند و مدنیتی که امروز در جهان وجود دارد در واقع حاصل فرود آمدن پتک پولادین سکولاریسم بر سر اخلاقیات دینی و خدامحور است. در واقع خود خدا هرگز (به فرض وجود) اصول اخلاقی معین و روشن و دقیقی را بر روی زمین نفرستاده است، بلکه همواره عده ای سیاست مدار و پادشاه و رهبر و روحانی و ارتشی هستند که ادعا میکنند خدا گفته است چنین کنید و چنان کنید. نمونه روشن از این اختلافات را میتوان میان تشیع و تمامی ادیان و مذاهب جهان دید. در تشیع یک مرد میتواند برای نیم ساعت با یک زن ازدواج موقت کند و با او تماس جنسی برقرار کرده و پولی به وی بدهد و خدای تشیع به گفته مراجع دینی تشیع از اینکار تازه خوشش هم می آید، حال آنکه این عمل در تمامی مذاهب دیگر اسلام و تمامی ادیان دیگر فوق العاده زشت و ممنوع دانسته میشود. لذا خداباوری و دین نه تنها اخلاق را کمکی نمیدهند بلکه آنرا ویران میکنند؛ و جا دارد حتی خداباورانی که عقلشان هنوز به اندازه متحجران دینی تخریب نشده است نیز به این مسئله پی ببرند و رفتار خود را بجای خدامحور کردن خردمحور کنند و دستکم دینشان را محدود به اسطوره ها و مزخرفاتی کنند که روی رفتار آنها تاثیری نمیگذارد و تنها خرد و واقعیت را منبع رفتار خود بدانند نه مزخرفات دینیشان را و در نتیجه شریعت و قوانین دینیشان را به سطل آشغال بیاندازند.

پس از طرح این مسائل مقدماتی اکنون شایسته است که به یکی از استدلالهای مطرح شده در وارد کردن این اتهام بپردازیم. این استدلال که به نظر میرسد مهمترین استدلال خداباوران باشد، استدلال از اقتضاء (Expediency)  نام گرفته است. این استدلال تلاش میکند بگوید که اعمالی نظیر شکنجه، برده داری، تنبیه بیگناهان و غیره وجود دارند که از نظر اخلاقی باید در هر شرایطی و به هر صورتی مطلقاً ممنوع باشند. این استدلال همچنین میگوید که در دیدگاه اخلاقی خداباوری این ممنوعیت ها وجود خواهند داشت ولی بیخدایان یا باید بر شهود و کشف ذهنی در این موارد قضاوت اخلاقی کنند یا اینکه از روی نتیجه گرایی به محاسبه نتایج این اعمال بپردازند. استدلال اینگونه ادامه پیدا میکند که از آنجا که روش اخیر تنها نسخه ای بسیار سفت و سخت از سودمندگرایی (Utilitarianism) است که در آن هر چیزی در شرایط خاصی ممکن است از نظر اخلاقی توجیه پذیر باشد، در نهایت تحلیل سکولارها از اخلاق مبتنی بر اقتضاء و مصلحت است. همچنین تکیه بر شهود های ذهنی نیز مبتنی بر عواطف ذهنی است، توسل به نتایج کاملاً مبتنی بر اقتضاء خواهد بود. استدلال از اقتضاء را میتوان به این صورت فرمولیزه کرد:

1- اگر وجود اخلاقیات عینی بدون وجود خدا ممکن است، آنگاه ممنوعیت جدی در قبال برخی اعمال ناشایست ضرورت دارد.

2- اگر ممنوعیت در قبال برخی از اعمال ناشایست ضرورت دارد، آنگاه اخلاق سکولار نباید مبتنی بر شهود و کشف ذهنی یا سودمندگرایی باشد.

3- ولی اخلاق سکولار یا باید مبتنی بر شهود و کشف ذهنی باشد یا مبتنی بر سودمندگرایی.

4- بنابر این وجود اخلاقیات عینی بدون وجود خدا محال است.

اجازه بدهید این فرض را درست بپنداریم که کشف و شهود ذهنی نمیتواند مبنایی قابل قبول برای اخلاقیات عینی باشد و روی وجه سودمندگرایی استدلال تمرکز کنیم. با توجه به تقریر بالا، استدلال از اقتضاء مشکلات زیادی دارد، نخستین مشکل این است که کل این استدلال بی ارتباط با اخلاقیات عینی به نظر میرسد. استدلال بطور نهانی فرض میکند که سودمندگرایی مبتنی بر حقایق اخلاقی نیست و بنابر این سودمندگرایان نمیتوانند به اخلاقیات عینی باورمند باشند. اما پرسشگری در مورد سود مبتنی بر حقایق اخلاقی هستند هرچند ممکن است این حقایق همان نوع حقایق اخلاقی مورد نظر فرد خداباور مدعی این استدلال نباشند. همانطور که در معرفی مختصر سودمندگرایی گفته شد نظر سودمندگرایان این است که حقایق اخلاقی کاملاً مبتنی بر نتایج ناشی از رخ دادن اعمال هستند. این استدلال باید فرض کند که حقایق اخلاقی مبتنی بر نتایج هستند. این فرض ممکن است درست یا نادرست باشد اما هیچ چیز را در مورد سازگار بودن یا نبودن حقایق اخلاقی عینی با بیخدایی نشان نمیدهد!

مشکل دوم این استدلال آن است که به نظر میرسد این استدلال بررسی های اصولی اخلاقی را با استدلالهایی که مبتنی بر محاسبه نتایج نیستند برابر میگیرد، اما سودمندگرایی خود مبتنی بر اصولی اینچنین است. برای نمونه، یک اصل اخلاقی سودمندگرایی میتواند این باشد که هر عملی باید لذت بیشتری نسبت به دردی که پدید می آورد، پدید بیاورد. مطمئناً این دیدگاه ممکن است با دیدگاه خداباوری سازگار نباشد، اما هیچ چیزی را در مورد اینکه اخلاقیات از دیدگاه بیخدایی مبتنی بر اصول هستند یا نیستند نشان نمیدهد.

مشکل سوم این استدلال آن است که فرض میکند شکنجه، برده داری و تنبیه کردن بیگناهان در هر شرایطی نادرست هستند. اما بر خلاف آنچه منتقدان ادعا میکنند، این اعمال ممکن است در برخی از شرایط درست و اخلاقی باشند. برای نمونه به این وضعیت فرضی توجه کنید: فرض کنید یک موجود فضایی شرور شما را مجبور میکند که کاری وحشتناک همانند شکنجه دادن یک کودک را انجام دهید. این موجود فضایی به شما این دو اختیار را میدهد که یا کودک را به سختی شکنجه کنید یا او تمام زمین را نابود میکند. آیا در چنین وضعیتی شکنجه کردن کودک کاری اخلاقی نیست؟

مشکل دیگر این استدلال آن است که فرض میکند سودمندگرایی تنها موضع اخلاقی است که بیخدایان میتوانند اتخاذ کنند حال آنکه چنین نیست و اتخاذ مواضع دیگر نیز کاملاً میسر است. روشن است که با توجه به این مشکلات این استدلال نمیتواند اتهام مطرح شده را به بیخدایی وارد کند.

اتهام سوم  پیشفرض گرفته شدن بی اخلاقی در دیدگاه ماده گرایی و طبیعت گرایی

به هر دلیل و علتی در میان خداباوران بسیار رایج است که فرض میکنند بطور مسلم هر بیخدایی ماده گرا یا طبیعت گراست، و در بسیاری از مواقع واژه «مادّی» در ترادف با «بیخدا» در ادبیات دینی دیده میشود. ماده گرایی در این زمینه معمولاً به این معنی فرض میشود که ماده فیزیکی تنها نوع واقعیت است و هر چیزی اعم از فکر، احساس، ذهن، اراده و مجردات منطقی و ریاضی را میتوان بر مبنای ماده فیزیکی توضیح داد. مدعیان وارد بودن این اتهام همچنین معتقدند ماده را نمیتوان ارزشگزاری اخلاقی کرد و اگر این فرضها درست پنداشته شوند این نتیجه گیری که بیخدایی با بی اخلاقی برابر است آسان و مسلم به نظر میرسد. این اتهام را بگونه ای رسمی تر میتوان اینگونه تقریر و فرمولیزه کرد:

1- اگر بیخدایان ماده گرا یا طبیعت گرا هستند نمیتوانند فرض کنند که حقایق اخلاقی وجود دارند.

2- بیخدایان ماده گرا یا طبیعت گرا هستند.

3- پس بیخدایان نمیتوانند فرض کنند که حقایق اخلاقی وجود دارند.

4- پس بیخدایان نمیتوانند باورمند به اخلاقیات عینی باشند.

این استدلال دارای دو ایراد اساسی است، نخست اینکه 2 درست نیست، همه بیخداها لزوماً ماده گرا نیستند. بیخدایی یک موضع فلسفی و تنها برابر با انکار یا نفی وجود خدا است و بس، بیخدایی ادعایی وجودشناسانه (Metaphysical) را در مورد اینکه چه واقعیت هایی میتوانند وجود داشته باشند و چه واقعیت هایی نمیتوانند وجود داشته باشند نمیکند. یک بیخدا کاملاً ممکن است به ماوراء طبیعت اعتقاد داشته باشد، به روح، جانوران ماوراء طبیعی و معاد نیز اعتقاد داشته باشد، لازمه بیخدا بودن تنها انکار یا نفی خدا است نه انکار ماوراء طبیعت.  بسیاری از بیخدایان متاخر معتقد بوده اند که ماده تنها یک نوع از وجود است، برای نمونه برترند راسل معتقد است که مجردات ریاضی واقعیت دارند. مسلم است که بسیاری از بیخدایان طبیعت گرایی را میپذیرند، یعنی باور دارند که تمامی اتفاقها را میتوان با قوانین و علل طبیعی و بدون نسبت دادن علل ماوراء طبیعی یا مربوط به ارواح توضیح داد اما طبیعت گرایی بطور خودکار ماده گرایی را نتیجه نمیدهد. اینکه یک پدیده طبیعی است لزوماً به این معنی نیست که آن پدیده مادی است. افزون بر این برخی از بیخدایان شهودگرایی (Intuitionalism) را بجای طبیعت گرایی باور دارند و معتقدند حقایق اخلاقی بصورت یگانه (sui generis) وجود دارند و نمیتوان آنها را برابر با خواص طبیعی یا ماوراء طبیعی دانست.

افزون بر فرض 2، فرض 1 نیز درست نیست، لزومی ندارد برای سازگار ساختن ماده گرایی با وجود حقایق عینی اخلاقی فرض کنیم که این حقایق فرم مادی دارند و قابل کاهش به ماده هستند، بلکه تنها کافی است پذیرفته شود که ماده را نیز میتوان ارزشگزاری اخلاقی کرد. خداباوران استدلال درستی در این مورد که وجود حقایق اخلاقی با ماده گرایی در تناقض است را ارائه نداده اند، تنها استدلالی که ارائه شده است و سعی میکند نشان دهد که چون واحد های کوچکتر مادی همچون مولکول ارزش اخلاقی نمیتوانند داشته باشند بنابر این واحد های بزرگتر همچون انسان هم نمیتوانند چنین ارزشهایی را در صورت مادی بودن داشته باشند، نیز به نظر میرسد مرتکب مغلطه ترکیب (مغلطه ای که در آن از روی خواص یک کل نتیجه گرفته میشود که خود آن کل نیز لزوماً آن خواص را داراست) میشوند.

در واقع نه تنها طبیعت گرایی با وجود حقایق اخلاقی در تناقض نیست بلکه گاهی نظریه های زیست شناسی برای توضیح دادن مسئله اخلاق که چیزی به غیر از داروینیسم و علل طبیعی نیست بسیار قابل تامل و منطقی به نظر میرسند، برای نمونه ریچارد داوکینز پیرامون این موضوع میگوید (+):

از منطق داروینیسم نتیجه می شود که واحدهایی از سلسله مراتب حیات که باقی می مانند و از صافی انتخاب طبیعی می گذرند، باید خودخواه باشند. واحدهایی که در جهان باقی می مانند آنهایی هستند که به بهای نابودی واحدهای هم مرتبه ی خود در سلسله مراتب حیات باقی مانده اند. در این زمینه، معنای خودخواه دقیقاً همین نوع بقاست. حال این پرسش پیش می آید که چه مرتبه ای از واحدهای حیات درگیر این ماجرا هستند؟ اساس ایده ی ژن خودخواه، با تأکید بر واژه ی ژن، این است که واحد انتخاب طبیعی (یعنی واحد خودخواه)، نه ارگانیسم خودخواه است و نه گروه یا گونه ی خودخواه، بلکه ژن خودخواه است. ژن است که به صورت اطلاعات در طی نسل های متوالی باقی می ماند و یا از میان می رود. بر خلاف ژن ها ( و شاید مم ها)، اندامه ها، گروه ها و گونه ها نمی توانند واحد مناسب انتخاب طبیعی باشند زیرا آنها نسخه های دقیقی از خود نمی سازند، و با هم درون انبانی از موجودات خود-تکثیرگر رقابت نمی کنند. اما ژن ها دقیقاً همین کار را می کنند. و «خودخواهی» ژن ها به معنای داروینی کلمه دقیقاً به همین سبب است.

واضح ترین روشی که ژن ها می توانند بقای «خودخواهانه» ی خود را تضمین کنند این است که اندامه های افراد را خودخواه برنامه ریزی کنند. در واقع، در بسیاری موارد بقای یک اندامه موجب بقای ژن های حاکم بر درون آن می شود. اما شرایط گوناگون، راهکارهای گوناگونی می طلبند. در برخی شرایط – که نادر هم نیستند – ژن خودخواه بقای خود را با واداشتن اندامه به رفتار نیکوکارانه تضمین می کند. امروزه این شرایط را به خوبی شناخته اند و به دو مقوله ی اصلی تقسیم بندی کرده اند. اگر یک ژن چنان بدن تحت فرمان خود را برنامه ریزی کند که آن بدن به خویشان ژنتیکی اش نیکی کند ، ژن از لحاظ احتمالاتی بخت بیشتری برای تکثیر خود می یابد. پس بسامد حضور چنین ژنی در انبان ژنی آن قدر افزوده می شود که نیکوکاری به یک هنجار بدل می شود. یک نمونه ی واضح این گرایش، نیکی به فرزندان است، اما این تنها نمونه ی نیکوکاری نیست. مثلاً زنبورها، مورچه ها و موریانه ها، و تا حد کمتری برخی از مهره داران مانند کورموش ها، نمس های هندی و دارکوب های کاج، جامعه هایی تشکیل می دهند که که در آنها خواهر و برادرهای بزرگ تر هوای قوم و خویش های کوچک تر جامعه ی خود را دارند (یعنی خویشانی را که با آنها ژن های مشترکی دارند). در حالت کلی، چنان که همکار فقیدم دبلیو دی هَمیلتون نشان داده، جانوران تمایل دارند که مراقب اقوام خود باشند؛ از آنها دفاع کنند؛ منابع خود را با آنها تقسیم کنند؛ خطرها را به آنها هشدار دهند، یا به شیوه های دیگر به خویشاوندان نزدیک خود نیکی کنند چرا که از لحاظ احتمالاتی، خویشاوندان جانور ژن های مشترکی با خود او دارند.

افزون بر این نظریه و نظریه های مشابه جامعه شناسی نیز در این زمینه اهمیت پیدا میکنند، انسانها وقتی در اجتماع زندگی میکنند مجبور به پیروی از اصول اخلاقی میشوند و برای این قضیه نیز نیازی به روح و ماوراء طبیعت نیست، انسان از دیدگاه مادی نیز هنگامی که در یک اجتماع تعریف میشود در قراردادهای اجتماعی قرار میگیرد که باید به آنها پایبند باشد زیرا نفع و بقای وی مبتنی بر پایبند بودن به این قواعد و قراردادهای اجتماعی است و این قضیه بسیار روشن و بدیهی است، پایه این قراردادهای اجتماعی هم روی این استوار است که انسانها با یکدیگر قرارداد میبندند که به یکدیگر خوبی کنند و به یکدیگر بدی نکنند، و برای انسانی که خوبی میخواهد ضروری است که به دیگران خوبی کند و بدی نکند، لذا انسانها در این قرارداد اجتماعی سود و منفعت دارند و همین ریشه بسیاری از رفتارهای اخلاقی انسانها است. بنابر این چنین اتهامی به بیخدایی نیز بی پایه است و نمیتواند نشان دهد که بیخدایی بی اخلاقی را نتیجه میدهد.

بررسی آماری میزان جرم و بزه در میان بیخدایان و خداباوران

گاهی تصور میشود که از روی مطالعات آماری میتوان به این نتیجه رسید که خداباوران در قیاس با بیخدایان بیشتر مرتکب جرائم میشوند، یا برعکس در تحلیل چنین ادعاهایی باید به چند نکته توجه داشت، نخست اینکه بیخدایی به خودی خود به معنی انکار و یا نفی وجود خدا است و بیخدایی یک مجموعه باور ها و دستور العمل ها، یک ایدئولوژی سیاسی و یا مکتب اخلاقی و اجتماعی و حقوقی نیست! لذا بیخدایی را علت مجرم بودن شخصی که افزون بر بیخدایی باورهای دیگری هم دارد دانستن کاملاً غیر منصفانه است، برای نمونه جنایات استالین را آیا باید به حساب بیخدایی او دانست یا نظام سیاسی که وی بدان معتقد بوده است؟ در نقطه مقابل در بسیاری از انواع خداباوری از جمله اسلام، باور به وجود خدا به یک باور تنها منتهی نمیشود بلکه همراه با مجموعه بزرگی از باورهای دیگر و دستور العمل ها و قواعدی است که یک مسلمان باید از آنها پیروی کند، لذا در برخی موارد با این قید که کردار یک شخص سازگار و برخاسته از قواعد و دستور العمل های یاد شده است میتوان آن نوع خداباوری را علت جرم رخداده دانست.

نکته دوم اینکه امکان تحقیق آماری بر روی تاثیر خداباوری یا بیخدایی بر روی یک شخص عملاً محال است زیرا هرگز نمیتوان همه سایر متغیرهایی که بالقوه امکان تاثیر گذاری بر کردار یک شخص را دارند ثابت نگه داشت و باور او نسبت به خدا را تغییر داد و کردار او را پس از تغییر باور دوباره مطالعه کرد، برای نمونه نمیتوان دانست که اگر استالین خداباور میبود دست به آن بزه کاری ها میزد یا نه، یا اگر خمینی بیخدا بود دست به جنایاتی که زده است میزد یا نه، اگر هیتلر خدا را قبول نداشت به قتل عام یهودیان و کولیها و افراد معلول دست میزد یا نه، اگر سعید حنایی خداباور نبود بخاطر وظیفه شرعی که بر خود احساس میکرد 16 زن را میکشت و به 13 زن تجاوز میکرد؟ آیا امام علی در صورتی که خدا را قبول نمیداشت به دستور پیامبر اسلام گردن چند صد یهودی را میزد؟ روشن است که در مورد این پرسشها میتوان نظریه پردازی کرد و حدسهایی را زد ولی این پرسشها را هرگز نمیتوان با تجربه پاسخ داد و آمار مستقیماً با تجربه و آزمون سر و کار دارد. چنین امکانی حتی در مورد فردی که باورش نسبت به خدا عوض شده است نیز وجود ندارد زیرا همانطور که گفته شد بقیه متغیر ها را هرگز نمیتوان به ثابت ها تبدیل کرد و مهمترین این متغیر ها زمان است که تثبیت آن کاملاً محال است. از این دو مسئله میتوان نتیجه گرفت که چنین مطالعات آماری اساساً پایه و اساس چندان محکمی نمیتوانند داشته باشند و نمیتوان از آنها نتایج درستی گرفت. برای نمونه از برخی از اسلامگرایان زمانی که اسلام به خشونت و انسان ستیزی محکوم میشوند شنیده میشود که میگویند در جنگ جهانی دوم بیش از هر جنگی که خداباوران در طول تاریخ کرده اند و شاید به اندازه تمام آنها انسان ها کشته شدند و تمامی طرفهای این جنگ را نیروهای سکولار و غیر دینی تشکیل میدادند، روشن است که حتی اگر طرفین این جنگ واقعاً بی دین بوده باشند نیز نمیتوان بی دینی آنها را علت جنگ دانست، دین تنها مشکل بشریت نیست! افزون بر دین چیزهای مخرب و مضر دیگری نیز وجود دارند! همچنین نمیتوان به قطع دانست اگر این طرفین خداباور یا دیندار بودند تعداد کشته های جنگ جهانی دوم از این بیشتر میبود یا نه، چون امکان چنین تجربه ای وجود ندارد.

البته در درستی این ادعا که نیروهای مختلفی که در جنگ جهانی دوم میجنگیدند غیر دینی بوده اند نیز میتوان شک فراوان ورزید زیرا برای نمونه هیتلر عمیقاً به خدا باور داشته است و اعلام نیز کرده است که با خود را در مقابل یهودیان قرار دادن به خواست خدا عمل میکند و طرف عمده دیگر این جنگ نیز امریکا است که ایدئولوژی خاصی که حتی وابستگی صوری به بیخدایی داشته باشد نداشته است، تنها طرف این جنگ که بیخدا بوده است شوروی بوده است که آنهم در جنگ جهانی دوم مظلوم واقع شده است و مورد تجاوز آلمان نازی قرار گرفته است! اما حتی اگر این سخن نیز پذیرفته شود، چنین استدلالی اشکالات بزرگی دارد که از جمله مهمترین آنها پیشرفت سلاح ها است، در صورتی که پیامبر اسلام هم میتوانست بجای سر بریدن با شمشیر از بمب اتم استفاده بکند و بجای سوار شدن بر الاغ و شتر در تانک و هواپیما بنشیند آنگاه معلوم میشد که او انسانهای بیشتری را میکشت یا کسانی که در جنگ جهانی دوم جنگیدند. ایراد بزرگ دیگر تفاوت جمعیتی دورانی که ادیان قدرت جنگیدن با یکدیگر را داشتند و جمعیت جهان در دوران جنگ جهانی دوم است، پس روشن است که این دسته از ادعاها کاملاً پوچ و عوامفریبانه هستند و کیفیت این جنگها نمیتواند ادعایی را در مورد بیخدایی اثبات کند. افزون بر این حتی اگر جنگ جهانی دوم را هم جنگ بین بی خدایان بدانیم، تنها یک جنگ است! حال آنکه بخش بزرگی از تاریخ را جنگهای دینی تشکیل میدهند و دین همواره بخش لاینفکی از جنگهای بشری بوده است، چه چیز میتواند به اندازه دین مغز انسان را تخریب کند و او را به جانوری تبدیل کند که هم دوست دارد بکشد و هم دوست دارد کشته شود؟ اما حتی اگر چنین استدلالهایی هم بتوانند نشان بدهند که برای برخی از مردم بیخدا بودن و اخلاقمدار بودن ممکن نیست یا بعید است، این مسلماً به آن معنی نیست که بیخدایی با اخلاق ناسازگاری دارد، درست مثل اینکه برخی از انسانها نمیتوانند با دهانشان سوت بزنند ولی این به آن معنی نیست که انسان نمیتواند با دهانش سوت بزند(!).

از سخنان نادرست دیگری که گاهی در اعتراض به بیخدایی گفته میشود نتایج اسفناک حکومتهای کمونیستی در جهان است که در دوران کوتاه حیات خود نتیجه ای بسیار منفی از خود در همه جا بویژه در شوروی سابق و چین فعلی به جای گذاشته اند. در پاسخ به این مسئله باید توجه داشت که ساختار حکومت های کشورهای کمونیستی بسیار شبیه به ساختار نظامهای خداسالار بسیار واپسگرا و قرون وسطایی بوده است. رهبران این کشور ها دقیقاً همان نقشی را بازی می‌کنند که فرعون ها، پاپ ها، خلیفه ها، مفتی ها، سلاطین و ولایت فقیه ها بازی کرده اند، حکومت های کمونیستی و اندیشه های کمونیستی تابحال نتوانسته اند نظامی غیر نظامهای دهشتناک تمامیت خواه و فاشیست ایجاد بکنند و کمونیست های سنتی به دنبال ایجاد دیکتاتوری پرولتاریا هستند و تا زمانی که چنین حکومت طبقاتی و واپسگرایی را دنبال کنند و به دنبال دموکراسی و حقوق بشر نباشند به نظر هم نمیرسد در آینده بتوانند نتیجه ای غیر از نتایجی که تاکنون گرفته اند بگیرند و نتیجه آن به دلیل باورهای غلط سیاسی آنها بهتر از تجربه چین، کوبا، شیلی، شوروی، کره شمالی، کامبوج از کمونیسم شود.

پرواضح است که اگر پاپ و سایر شخصیت های دینی را از قدرتی که در قرون وسطی (و در مورد ولی فقیه شوربختانه در حال حاضر دارد) بردارید ولی همان ساختار هرمی قدرت روحانیت را که در تمام نظامهای دینی میبینید در اختیار افرادی سکولار و بی دین و حتی اخلاقمدار قرار دهید هرگز نباید انتظار داشته باشید نتیجه ای بهتر از آنچه نظامهای دینی گرفته اند حاصل شود. تمرکز قدرت فساد می آورد و گفته می‌شود که اگر شما تمامی قدرت را به دست شخصی دهید یک قدرت اصلی را از او خواهید گرفت و او قدرت عدالت و انصاف او است. قدرت مطلق فساد مطلق می آورد. بنابر این در فاجعه ای که نظامهای کمونیستی تابحال به بار آورده اند بیخدایی را نمیتوان علت دانست بلکه بازهم ساختار قدرتی مشابه نظامهای دینی است که نظام های کمونیستی به کار گرفته اند و فاجعه آفرین بوده است. همین تمرکز قدرت در کشورهای کمونیستی از کمونیست ها کاملاً انسانهایی دین خوی پدید آورده است که مخالفین خود را با نام «دشمنان مردم» در مقابل عبارت های تهوع آور مشابه در نظام های دینی همچون «دشمنان خدا» و یا «محارب با خدا و پیغمبر و مفسد فی الارض» به بدترین حالت های قابل تصور شکنجه و نابود کرده اند. لذا نتیجه منفی که این حکومت ها به بار آورده اند را باید در ساختار سیاسی حکومتی آنها و همچنین باورهای غلط آنها همچون کمونیسم و نازیسم دید نه در بیخدایی آنها.

در میان اسلامگرایان عامی این باور بطور گسترده وجود دارد که بیخدایی متناظر با کمونیسم است. باید توجه داشت که باورهای کمونیستی نظیر سوسیالیسم، اینترناسیونالیسم، ماتریالیسم دیالیکتیک هیچکدام وابستگی بنیادین به بیخدایی ندارند و نه هر بیخدایی کمونیست است و نه هر کمونیستی بیخداست، افزون بر این اگر بیخدایی نیز همچون بسیاری از موارد در مورد خداباوری از روی عواطف و نادانی و تعصب توسط یک فرد گزین شود و بجای خرد محور بودن برای یک فرد تبدیل به یک باور دینی شود میتوان کاملاً انتظار داشت که وجود این داگما سبب رخ دادن نتایج مشابهی که معمولاً از دین خویان دیده شده است، بشود و کمونیست ها هم در بسیاری از مواقع از همین حالت رنج میبرند، کمونیسم علاوه بر اینکه اساساً ایده باطلی است و از این ایدئولوژی نمیتوان انتظار داشت که واقعیت عینی بهتر از آنچه تاکنون از خود بجای گذاشته است را تحقق بخشد (دستکم از نظر منتقدانش) در حکومتهای یاد شده دقیقاً همچون اسلام در جمهوری اسلامی بعنوان یک داگما به مردم تحمیل میشده است و با در نظر گرفتن تمامی این موارد کاملاً نابخردانه به نظر میرسد اگر کسی فاجعه های حکومتهای کمونیستی را ناشی از بیخدایی برخی سرکردگان این حکومتها بداند، لذا بیخدایی هنگامی که با کمونیسم و یا نازیسم همراه شود ممکن است فاجعه آمیز باشد اما روشن است که این ایراد از کمونیسم و نازیسم است نه از بیخدایی.

اما گذشته از این مسائل و مشکلات در مورد آمار میزان جرائم و بزه چندان اطلاعاتی در دسترس نیست به غیر از چند مورد. نخستین مورد آمار زندانهای امریکا است، این آمار که مربوط به سال 1997 است آمار باورهای دینی زندانیان امریکا را در یک نمونه اینگونه نشان میدهد +:

Response              Number      %
----------------------------  --------
Catholic               29267   39.164%
Protestant             26162   35.008%
Muslim                  5435    7.273%
American Indian         2408    3.222%
Nation                  1734    2.320%
Rasta                   1485    1.987%
Jewish                  1325    1.773%
Church of Christ        1303    1.744%
Pentecostal             1093    1.463%
Moorish                 1066    1.426%
Buddhist                 882    1.180%
Jehovah Witness          665    0.890%
Adventist                621    0.831%
Orthodox                 375    0.502%
Mormon                   298    0.399%
Scientology              190    0.254%
Atheist                  156    0.209%
Hindu                    119    0.159%
Santeria                 117    0.157%
Sikh                      14    0.019%
Bahai                      9    0.012%
Krishna                    7    0.009%
----------------------------  --------
Total Known Responses  74731  100.001% (rounding to 3 digits does this)

Unknown/No Answer      18381
----------------------------
Total Convicted        93112  80.259% (74731) prisoners' religion is known.

Held in Custody         3856  (not surveyed due to temporary custody)
----------------------------
Total In Prisons       96968

در سال 2004 بی بی سی اعلام کرد که جمعیت بیخدایان امریکا چیزی حدود 10% است (10) با این حساب باید انتظار داشته باشیم که 10% زندانیان نیز بیخدا باشند تا بتوانیم به این نتیجه برسیم که بیخدایان نیز دستکم به اندازه مسیحیان در امریکا به بزه و جنایت دست میزنند، اما شاهد هستیم که تنها دو دهم درصد از زندانی ها را بیخدایان تشکیل میدهند یعنی 99.8% جمعیت این زندانها خداباور هستند، لذا اگر قرار باشد باور به خدا یا ناباوری به خدا نقشی در کردار انسانها داشته باشد به نظر میرسد با توجه به این آمار بیخدایی بسیار تاثیر مثبت تری نسبت به خداباوری داشته است. افزون بر این آمار میتوان به این نکته اشاره کرد که کشور امریکا با جمعیتی که 90% اش را خداباوران تشکیل میدهند بیشترین نرخ بزه را در جهان دارد. البته این میتواند هم به این دلیل باشد که باقی کشورها بویژه کشورهای اسلامی آمار درستی از بزه ارائه نمیدهند و هم میتواند ناشی از نظام قضایی قوی امریکا باشد که بزهکاران را بیشتر از باقی کشورها دستگیر میکند اما به هر حال این آمار در مقایسه با کشورهایی مثل کشورهای اسکاندیناوی که نرخ بزه بسیار کمتری دارند و جمعیت بیخدایانشان نیز بسیار بیشتر از جمعیت بیخدایان امریکا است قابل توجه است. همچنین در سال 2005  از میان 127 شهر دنیا بهترین شهر دنیا برای زندگی کردن شهر ونکوور کانادا اعلام شد (11) و تصادفی نیست که 42% جمعیت این شهر را افراد غیر مذهبی شامل بیخدایان، ندانمگرایان، داروینیست ها و افراد بی دین تشکیل میدهند (12) جالب است که در همین آمار شهر تهران و کراچی جزو بدترین 10 جا برای زندگی کردن انتخاب شده اند.

مسئله دیگری که در این مورد ارزش مطرح شدن دارد این است که فرض کنیم تمامی زندانیان جهان را بیخدایان تشکیل میدهند و در زندانهای جهان هیچ خداباوری نیست. جمعیت زندانهای جهان در سال 2005 چیزی در حدود 9 میلیون نفر بوده است (13) و جمعیت بیخدایان جهان که شامل بودیست ها نیز به دلیل اینکه به خدا باور ندارند دستکم 21% جمعیت زمین است (14) که با توجه به جمعیت کره زمین که در حال حاضر حدود 6.6 میلیارد نفر است (15) جمعیت بیخدایان جهان میشود حدود 1.3 میلیارد نفر. 9 میلیون نفر از 1.3 میلیارد نفر برابر است با حدود هفت دهم درصد. با توجه به این داده ها، دو فرضیه پیش می آید:

1- کمتر از 1% بیخدایان مجرم و تبهکار هستند.

2- بیش از یک پنجم مردم جهان را بیخدایان جنایتکار و تبهکاری تشکیل میدهند که هنوز زندانی نشده اند.

فرضیه 2 بسیار غیر واقع گرایانه و غیر منصفانه است و گمان نمیکنم هیچ انسان منصف و عاقلی چنین باوری را داشته باشد، بنابر این تنها فرضیه 1 باقی میماند. نتیجه آنکه بیخدایی با فرض اینکه تمامی زندانیان جهان هم بیخدا باشند – که البته این فرض طبق آماری که قبلاً آورده شد بسیار بسیار فرض غلطی است، با اینحال کمتر از 1% بیخدایان دست به جرم و جنایت زده اند و من گمان میکنم که اگر قرار باشد یک باور روی رفتار انسانها تاثیر گذاشته باشد و تنها 1% باورمندان به این باور به جرم دست بزنند به هیچ عنوان نمیتوان آن باور را از نگر آماری باوری ضد اخلاقی و مشوق بزه و جرم دانست.

شاید این گفته ارتباط چندانی با موضوع این نوشتار نداشته باشد اما به نظر من با پیشرفت تکنولوژی از بسیاری از جرائم و تقلب ها کاسته خواهد شد. به راستی تکنولوژی هایی مثل  کارتهای اعتباری و حذف شدن پول بصورت کاغذ و سکه و مایکرو چیپ هایی که میتوان آنها را در زیر پوست قرار داد (و هم اکنون از آنها برای ردیابی حیوانات از طریق ماهواره استفاده میشود) و در نتیجه تمامی ارتباطات اقتصادی یک فرد و موقعیت جغرافیایی وی را در هر لحظه به دست آورد، تست DNA و غیره بدون شک بزودی میتوانند بسیاری از مشکلات امنیتی جهان را حل کنند، به سختی میتوان جرمی را در نظر گرفت که در صورت پیاده شدن این مقولات انسانها بتوانند مرتکب شوند و از دست قانون فرار کنند. البته سوء استفاده دولتهای فاشیست و انسان ستیز از این دست تکنولوژی ها که تازه در ابتدای راه هستند و جا برای پیشرفت بسیار زیاد دارند نیز میتواند بسیار تلخ و مرگبار باشد، اما با فاکتور گرفتن این تهدید اتفاقی که می افتد این است که نفع شخصی یک بشر با درست رفتار کردنش ارتباط بیشتری پیدا خواهد کرد و این خود همان چیزی است که خداباوران نگرانش هستند و تابحال از خدا برای رفع این معضل استفاده میکردند که البته در مقایسه با این تکنولوژی بسیار ناکار آمد خواهد بود و دیگر نیازی به حضرت عباس و دو طفلان مسلم و خدا و پیامبر و جن و فرشته و روح و آخرت و این مزخرفات برای اخلاقمدار بودن حتی برای کودن ترین انسانها باقی نخواهد ماند.

نتیجه از این بخش آنکه در عمل نیز بر اساس مطالعات تاریخی و آماری دلیل معتبر و مستندی برای محکوم کردن بیخدایان به بی اخلاقی وجود ندارد، و اظهار نگرانی خداباوران در این مورد بی اساس و از روی نادانی یا غرض ورزی و تعصبات مذهبی است.

منابع و توضیحات

1) در تاریخ مکاتب فکری که در اسلام شکل گرفته است معتزله دیدگاهی مشابه سودمندگرایی را مروج بوده اند، برای شرحی مختصر مراجعه شود به سخنرانی دکتر سروش پیرامون عقل اعتزالی.

2) برای دسته بندی های بیشتر از نگر عینیت و ذهنیت به اینجا و اینجا نگاه کنید.

3)- Hudson, W. 1970: Modern Moral Philosophy. London: MacMillan1970

4) Ninian Smart «Jainism», Encyclupedia of Philosophy, ed, Paul Edwards (New York: MacMillian and Free Press, 1967, vol 4. pp. 238-39

5) Jim Herrick, Against the faith, London, Glover and Blair, 1985, p 96.

6) Terry L.Meyers, «Percy Bysshe Shelley» Encyclupedia of Unbelief, ed. Gordon Stein, Amherst, N.Y, Prometheus Books, 1985, vol 2, p. 621

7) Richard L, Gorsuch and Daniel Aleshire, Christian faith and ethic prejudice: A review and interpretation of research, Journal for the scientific study of Religion 13, 1974, 281

8) Adolf Grunbaum, The poverty of theistic morality  +

9)- 1957 , Bertrand Russell, Why am I not a Christian, New York, Touchstone, Simon & Schuster, 1957

10) http://news.bbc.co.uk/1/hi/programmes/wtwtgod/3518375.stm

11)  http://news.bbc.co.uk/2/hi/business/4306936.stm

12)  http://en.wikipedia.org/wiki/Demographics_of_Vancouver#Religion

13)  http://www.kcl.ac.uk/depsta/rel/icps/world-prison-population-list-2005.pdf

14)  http://www.positiveatheism.org/writ/martin.htm

15) http://www.positiveatheism.org/writ/martin.htm

منابع اصلی که در این نوشتار من از آنها سود برده ام:

  • مبانی فلسفه اخلاق، رابرت ال هولمز، ترمجمه مسعود علیا، انتشارات ققنوس، تهران 1382.
  • An introduction to contemporary Methaethics, by Alexander Miller, Polity, Blackwell publishing press, 2003
  • Atheism Morality and Meaning,by Michael Martin, Prometheus books 2003
  • Stanford Encyclopaedia of Philosophy
  • Being good, Blackburn S., Oxford University Press 2001

چرا روح وجود ندارد؟

1- پیشگفتار.

مسئله وجود روح از مسائل بسیار اساسی در میان باورهای دینی و همچنین از کهن ترین باورهای انسانی است که در میان بسیاری از ملل رایج بوده و هنوز هم رایج است. بسیاری از دین خویان اعتقاد دارند حیات آنها تنها محدود به جسم آنها نمیشود و هر انسانی علاوه بر وجود مادی خود وجودی فرا مادی  نیز دارد که به آن روح گفته میشود. بر اساس باورهای اسلامی این روح در هنگامی که انسان خلق میشود به بدن او وارد میشود و بعد از مرگ او از بدن خارج میشود. این در حالی است که انقلاب علمی که در تاریخ بشر شکل گرفت تمام مفاهیم ماوراء طبیعی را از دنیای علم بیرون انداخت و به همین دلیل چیزی به نام روح در هیچ یک از رشته های علمی امروز به رسمیت شناخته نمیشود. از آنجا که زیر سوال رفتن روح باعث به زیر سوال رفتن بسیاری از باورهای دینی میشود و از آنجا که وجود روح باعث میشود افراد زیادی به وجود «دنیایی فراتر» (1) از دنیای حقیقی که روبروی ما است میشود و از آنجا که مسئله وجود روح همواره از خداناباوران و خردگرایان پرسش میشود، شایسته است که پیرامون آن توضیحاتی داده شود.

وجود روح توسط بسیاری از خداناباوران و خردگرایان انکار میشود. اثبات عدم وجود پدیده ای مثل روح بسیار دشوار است. تصور کنید عده ای به موجودی نامرئی و غیر مادی به نام «گوراگورا اعتقاد داشته باشند و ادعا کنند گوراگورا موجودی است که در هنگام عطسه کردن نزد انسانها می آید و انسانها را میبوسد. و بوسه او سبب عطسه انسانها میشود. هیچ کس نمیتواند گوراگورا را ببیند و یا او را لمس کند. حال آیا کسی میتواند اثبات کند که گوراگورا وجود ندارد؟ این باورمندان به گوراگورا ممکن است به شما بگویند هر گاه او شما را ببوسد شما عطسه کرده اید و هر گاه شما را نبوسد عطسه نخواهید کرد، و اگر شما این باور آنها را انکار کنید، آنها از شما خواهند پرسید، پس انسان برای چه عطسه میکند؟ اگر دلیلی علمی برای عطسه پیدا کنید و به آنها بگویید که عطسه کردن به این دلیل و به آن دلیل علمی است که اتفاق می افتد، ممکن است معتقدان به گوراگورا به شما بگویند «خوب ما نیز منکر این دلایل علمی نیستیم، اما گوراگورا هم همزمان با آن دلایل علمی شما را میبوسد، و اگر گوراگورا وجود نداشته باشد و شما را نبوسد شما هرگز عطسه نخواهید کرد.»

قضیه روح هم بسیار شباهت به مسئله گوراگورا دارد. روح از نظر گروهی از کسانیکه به وجود آن اعتقاد دارند دلیل اصلی و جوهر حیات است یعنی حیات وقتی آغاز میشود که روح به بدن وارد میشود و وقتی پایان میگیرد که روح از بدن خارج میشود، و از آنجا که روح پدیده ای طبیعی (Natural) نیست در حوزه بررسی علمی قرار نمیگیرد، و از نظر کسانیکه به ماوراء طبیعت (Supernatural) اعتقاد ندارند چون مدارک و دلایلی برای اعتقاد به چنین موضوعی وجود ندارد، همین ماوراء طبیعی بودن روح دلیل خوبی است برای انکار وجود آن. اما اگر وجود ماوراء طبیعت را ممکن فرض کنیم، نمیتوان اثبات کرد که روح وجود ندارد، مگر اینکه در وجود و تعریف روح تناقضی با خود آن و یا با سایر اصول استوار یافت شود و از اصل محال بودن اجماع نقیضین (تناقض چیست؟) اثبات کرد که وجود روح محال است. اما این نوشتار به یافتن و بحث کردن پیرامون چنین تناقضاتی نخواهد پرداخت، این نوشتار بیشتر تحلیلی علمی، تاریخی و فلسفی است از پدیده روح و همچنین تلاشی است برای پاسخ دادن به پرسشهای رایج در این زمینه و رد دلایل رایج غلطی که معمولاً برای اثبات وجود روح از آنها استفاده میشود.

زیرا همانگونه که در مورد گوراگورا یک انسان خردگرا (خردگرایی چیست؟) میتواند به دلیل اینکه مدارک علمی معتبر یا دلایل صحیح فلسفی برای اثبات وجود آن وجود نداشته باشد و در نتیجه به دلیل اینکه ایده وجود گوراگورا از فیلتر خرد عبور نمیکند منکر وجود گوراگورا شود، در مورد روح نیز دقیقاً مسئله به همین صورت است. در این نوشتار این واقعیت را که آنچه باورمندان به وجود روح معمولاً به عنوان دلایل خود برای اعتقاد به وجود روح بیان میکنند دلایل درستی نیستند نشان خواهیم داد، و نتیجه آن خواهد بود که در خواهیم یافت دلایل معتبری برای اعتقاد به روح وجود ندارد. بنابر این وجود روح را میتوان تنها به دلیل اینکه دلایل معتبری برای اعتقاد به آن وجود ندارد انکار کرد و نشان داد که این اعتقاد برخاسته از نادانی قدما بویژه افلاطون است که وارد باورهای دینی شده است. لذا خردمندانه ترین جایگاه نسبت به قضیه روح، جایگاه انکار است، مگر اینکه دلایل معتبری برای نفی وجود آن انکار شود.

2- ایده روح از کجا آمده است؟

نخستین چیزی که باعث شد انسانها به روح روی بیاورند مسئله حیات بود. انسانها همواره  بدنبال این بوده اند که ببینند حیات چیست و از کجا آمده است و پاسخ این پرسش خود را در یافتن فرق انسان زنده و انسان مرده جستجو میکردند تا اینکه بتوانند حیات را توضیح دهند و درک کنند. باورهای دینی اکثراً برخاسته از تلاش انسانهای بدوی و اولیه هستند، برای توضیح دادن چیزهایی که امروز علم به توضیح آنها میپردازد. بشر اولیه همواره در تلاش برای توضیح این مسئله و پاسخ به سایر پرسشهای اساسی اش دست به خلقت موجوداتی تخیلی و غیر طبیعی زده است که ارواح یکی از آن چیزها هستند.

در نظر انسانهای اولیه ابتدائی ترین و آشکار ترین تفاوتی که بین موجودی زنده و موجودی غیر زنده دیده میشود این است  که انسان زنده نفس میکشد و انسان مرده نفس نمیکشد. لذا این تنفس در نظر بسیاری از انسانهای اولیه بعنوان جوهر اصلی حیات مطرح شد، یعنی هرآنچه نفس بکشد از نظر ایشان زنده مینمود و هر آنچه زنده نبود نفس نمیکشید. برای همین است که روح همواره بطور مستقیم یا بطور غیر مستقیم در کتابهای دینی با تنفس در ارتباط است. در تورات روح با کلمه نشاما (נפשׁ) توصیف شده است، این کلمه دقیقاً همان کلمه ای است که برای نفس نیز استفاده میشود. در انجیل نیز که اصل آن به زبان یونانی نوشته شده است برای روح از کلمه سوکی (ψυχή)  استفاده شده است و این کلمه دقیقاً به معنی نفس و نفس کشیدن است. این کلمات هم در تورات و هم در انجیل بارها با معانی و مفاهیم دیگر همچون تنفس و حیات نیز استفاده شده اند. کلمه (Spirit) در زبان انگلیسی نیز خویشاوند با تنفس در زبان لاتین است. مصریان باستان نیز کلمه «کا» را برای توصیف ارواح استفاده میکردند که این کلمه نیز به معنی «تنفس» است، حتی در آیین هندو و همچنین در آیین بودایی نیز روح را (Ātman) میخوانند که برابر با تنفس است. روح حتی در قرآن نیز با نفس کشیدن درآمیخته است.  الله بر اساس قرآن روح خود را درون کالبد انسان می دمد، یا بعبارت دیگر «فوت» میکند.

سوره سجده آیه 9
ثُمَّ سَوَّاهُ وَنَفَخَ فِيهِ مِن رُّوحِهِ وَجَعَلَ لَكُمُ السَّمْعَ وَالْأَبْصَارَ وَالْأَفْئِدَةَ قَلِيلًا مَّا تَشْكُرُونَ.

آنگاه بالای او راست ، کرد و از روح خود در آن بدميد و برايتان گوش و چشمها و دلها آفريد چه اندک شکر می گوييد.

به این عمل معروف فوت کردن روح (نفخ روح) در چهار جای دیگر قرآن از جمله در (سوره حجر آیه 29، سوره انبیا آیه 91، سوره ص آیه 72 و سوره تحریم آیه 12) نیز اشاره شده است. نفخ روح در قرآن هم در مورد اولین انسان (آدم) آمده است هم در مورد تولد مسیح از مریم باکره و هم در مورد تمامی انسانها. البته این باور تنها باوری اسلامی نیست، دورگا یکی از خدایان هندو نیز مجسمه خود را ساخته است و بعد با دهان الهی خود روح دمیده است. بسیاری از انسانهای اولیه توضیحی بهتر از این به ذهنشان خطور نمیکرد که خدا ابتدا انسان را از مجسمه درست کرده است و بعد به وجود او حیات دمیده است و در نتیجه انسان که تنها یک کالبد سفالین و گلی مجسمه گونه بوده است دارای جان شده است، شاید به همین دلیل باشد که مجسمه سازی در برخی از ادیان همچون اسلام تقبیح شده است و حتی در برخی از دوره های تاریخ اولیه اسلام به شدت تحریم و تکفیر شده است و گروه های بنیاد گرا هنوز هم با مجسمه سازی مشکل دارند، زیرا به نظر میرسیده است که انسانهای مجسمه ساز در حال تکرار کاری الهی هستند و این کار بسیار کفر آمیز است، یکی از معجزات عیسی در قرآن نیز این است که مجسمه کبوتری را از گل درست کرده است و سپس به آن جان بخشیده است، آشکار است که افسانه ای بهتر برای خلقت به ذهن افرادی که این داستانها را سراییده اند نرسیده است. این نوع تصوّر های کودکانه که امروزه ذره ای ارزش علمی ندارند و بسیار شبیه به قصه های شنگول و منگولی است که مادربزرگها برای نوه هایشان تعریف میکنند هستند، در میان انسانهای اولیه و متاسفانه در ذهن انسانهای نیمه دیوانه امروزی منطقی و واقعی به نظر میرسیده و میرسند. در این میان افراد سودجو و زرنگی همچون پیامبر اسلام نیز از این قصه های کودکانه سوء استفاده کردند و با گول زدن انسانهای ساده اندیش برای قرنها به حماقت بشری دامن زدند و سبب امتداد این استحمار گشتند.

اگر تصور کنیم خداوند هر بار که انسان جدیدی بدنیا می آید یک مقدار از روح خودش را درون وجود او فوت میکند، و اگر فرض کنیم هر ثانیه سه بچه بدنیا می آیند، بر اساس گفته قرآن خداوند بیشتر شبیه یک پنکه یا کمپرسور باد است که دائماً باید روح خود را در پیکر انسانهای تازه تولد یافته فوت کند، و این خود یک شغل 24 ساعته برای خداوند است و او را از باقی مسئولیت هایش باز میدارد، تازه این درصورتی است که سایر جانداران روی زمین را بدون روح فرض کنیم، و تنها انسانها را دارای روح بدانیم. البته شاید خداوند از قبل مقدار زیادی فوت کرده است و روح ها را آماده کرده است و در یک صندوقچه یا کُمد الهی نگه داشته است و یکی یکی در هنگام تولد انسانها بطور خودکار به بدن آنها ارسال میشود.

از روی همین ارتباط مستقیم میان روح و تنفس در قرآن میتوان دریافت که ایده روح در قرآن نیز از همان جایی گرفته شده است که این ایده در تورات و انجیل گرفته شده است، در نتیجه روح نتیجه تلاش انسانهای اولیه است برای پیدا کردن جوهر اصلی حیات. یعنی معمایی که علم بیولوژی امروز به حل آن میپردازد. برای انسانهایی که هنوز گمان میکردند زمین صاف است، و شهابسنگ ها تیرهایی هستند که به سمت شیاطین شلیک میشوند، اولین پاسخی که برای پرسش «تفاوت موجود زنده و مرده چیست» به نظر میرسید، مسئله تنفس بود. برای او داد و ستدهای میکروسکوپی شیمیایی در بدن که ما آنرا متابولیسم بدن میخوانیم مشخص نبود، از نظر او مرده نفس نمیکشد و زنده نفس میکشد و این تنها تفاوت زنده و مرده است. و این ارتباط مستقیم کلمه تنفس با کلمه روح از لحاظ زبانشناسی سندی است بر این مدعا. برای قدما مشخص نبود که تنفس چیزی نیست جز دمیدن اکسیژن و مقدار زیادی نیتروژن، آنها تنفس را مسئله ای پیچیده تر از این مسائل میدیدند. از همین رو است که در «زنده» خواندن گیاهان بسیار دچار تردید بودند.

مسیحیان اینگونه به قضیه نگاه میکردند که خداوند ابتدا روح را در کالبد بدن می دمد و درون انسان زنده روح خدایی وجود دارد، و این در حالی است که ما در دنیایی پر از ارواح خبیث زندگی میکنیم. از همین رو است که مسیحیان وقتی کسی عطسه میکند او را با عبارات مذهبی تقدیس میکردند، یا حالتی جادویی به خود میگرفتند، مثلا بر روی سینه صلیب رسم میکردند، زیرا معتقد بوده اند وقتی کسی عطسه میکند ممکن است روحش به بیرون پرتاب شود و ارواح خبیثه که در اطراف او هستند و نفس شیطان به دلیل گناهان ما همه جا گسترده شده است ممکن است به سرعت وارد بدن او شده و جایگزین روح الهی در بدن او شود. از همین رو بود که مسیحیان اساساً بیماریهای انسانها را به دلیل محصور شدن آنها توسط ارواح پلید میدانستند. و با دعا خواندن و انجام مراسم مذهبی سعی میکردند ارواح خبیث را از وجود بیمار خارج کنند. در دوران انگیزاسیون بعضی اوقات افراد بیمار را شکنجه میکردند تا روح خبیث به زور شکنجه از بدن آنها خارج شود، هنوز هم در میان مسیحیان فرقه هایی همچون فرقه شاهدان یهوه وجود دارند که بیماران خود را نزد پزشک نمیبرند و تنها با دعا و نیایش آرزوی شفا یافتن آنها را دارند. ایرانیان نیز هرگاه کسی عطسه میکند به او میگویند «عافیت باشد»، ممکن است این رسم نیز از باورهای خرافی مشابه گرفته شده باشد.

البته این تسخیر شدن توسط ارواح همیشه بد نبود. روح القدس در عبارت یونانی که زبان اصیل انجیل است به معنی «تنفس مقدس» است. اگر این روح توسط تنفس به بدن وارد میشود انسانها میتوانستند از خدا وحی بگیرند و کتابهای متعدد انجیل و تورات به باور مسیحیان ناشی از ورود این روح به بدن نویسندگان این کتابها است. مسیح در انجیل روح القدس را با فوت به سمت حواریون خود میفرستد (یوحنی 20:22). در همین نوشتار این باور، یعنی جوهر حیات بودن روح به چالش کشیده خواهد شد.

دومین مسئله که باعث شده است انسانهایی به وجود روح اعتقاد داشته باشند بی اطلاعی آنها از مغز انسان است. تقریباً تمامی آنچه به روح نسبت داده میشود در حقیقت همان کارهایی است که مغز انجام میدهد. در همین نوشتار به سه نمونه بارز از این موضوع، یعنی هوشیاری، خواب دیدن و دژاوو اشاره خواهیم داشت. انسانهای پیشین از مغز و ساختمان آن و وظایف آن آگاه نبودند و نمیتوانستند حس کردن، هوشیاری، تفکر و حافظه را با اطلاعات محدود خود نسبت به مغز توضیح دهند، لذا تمام این کارها را به روح نسبت میدادند. البته از دیدگاهی وسیع تر بی اطلاعی نسبت به بدن و ساختمان آن که مغز را نیز شامل میشود باعث اعتقاد به روح بود. این درحالی است که امروزه آشکار است تمامی حس ها، حالت های روانی، و افکار باعث ایجاد سیگنالهای الکتریکی، مغناطیسی و متابولیکی در مغز میشوند که این سیگنالها را میتوان با دستگاه های مخصوص PET و  MRI ثبت کرد (2) و حتی در برخی موارد با ارسال سیگنالهای مصنوعی به مغز شبیه سازی کرد. لذا تمامی ویژگیهایی که قدما برای توضیح آنها به روح پناه میبردند امروزه از دیدگاه علمی همان کارهایی است که مغز انجام میدهد، و مغز برای انجام آنها نیاز به هیچگونه روح یا چیزی شبیه آن ندارد، مغز کاملاً ماهیتی طبیعی دارد و تمامی کارهایی که مغز انجام میدهد از لحاظ طبیعی قابل بررسی هستند. لذا پیشرفت علم در زمینه نوروساینس (3) که تلاش میکند احساسات، ادراکات، حالت های روانی، تفکر، حافظه، هوشیاری و غیره را به مغز نسبت بدهد دیگر جایی برای اعتقاد به وجود روح برای بیشتر دانشمندان باقی نگذاشته است.

سومین مسئله تمایل انسان به جاودانگی است. انسانها همواره از اینکه مرگ پایان وجود و حیات آنها باشد هراسان بوده اند و تمایل به جاودانگی داشته اند و بشر بدوی عادت داشت تمایلات خود را با واقعیت پیوند دهد، یعنی چون صرفاً تمایل داشت حیات پس از مرگی وجود داشته باشد، نتیجه میگرفت چنین حیاتی وجود دارد و از آنجا که میدیدند بدن انسان پس از مرگ متلاشی میشود بعدی غیر مادی را نیز برای انسان تصور میکردند، از نظر ایشان لازمه حیات پس از مرگ وجود روح بود.  در مورد این نوع طرز تفکر آلوده به سفسطه در نوشتاری با فرنام «وجود نداشتن خدا و آخرت غیر عادلانه است مگر میشود آخرتی وجود نداشته باشد.» توضیحات کافی آمده است. در کشف واقعیت  ها باید تمایلات را کنار گذاشت زیرا واقعیت ها بدون توجه به تمایلات ما وجود دارند. تمایل داشتن ما به مسئله ای باعث وجود داشتن آن نمیشود و عدم تمایل ما به واقعیتی باعث از بین رفتن آن واقعیت نمیشود. برای توضیحات بیشتر در مورد مسئله مرگ به نوشتاری فرنام «بعد از مرگ چه خواهد شد؟» مراجعه کنید.

تمامی این سه مسئله، پیش زمینه هایی هستند که انسانها بخاطر آنها به وجود روح اعتقاد پیدا میکنند. بررسی دقیق علمی و فلسفی این مسائل باعث شده است که روح از یک پدیده علمی و معتبر به یک پدیده دینی و محدود به باورهای افسانه ای مردم تبدیل شود و دیگر جایگاه چندانی در علوم بشری نداشته باشد.

3- بررسی علمی و فلسفی روح

پدیده روح در میان بسیاری از فلاسفه پیشین رایج بوده است تا اینکه کم کم فلاسفه کمتری به وجود آن معتقد شدند. باور به روح همچون باور به سایر چیزهای فراطبیعی از نظر تعدد باورمندان سیری کاملاً نزولی داشته است و امروزه بیش از هر زمان دیگری وجود روح توسط فلاسفه و دانشمندان انکار میشود.

3.1- تاریخچه ای مختصر از روح و تعاریف آن (4)

بررسی تاریخچه روح در فلسفه پیشاسقراطی را باید از هومر (در قرن 9 ام پیش از میلاد میزیسته است)، شاعری که آثار حماسی ایلیاد و ادیسه را به او نسبت میدهند و اساساً معلوم نیست که آیا چنین شخصی براستی در طول تاریخ وجود داشته است یا نه آغاز کرد. البته ممکن است در جاهای دیگر نیز فلاسفه و متفکرین دیگری به روح معتقد بوده باشند اما آنچه حداقل در مورد روح سر انجام به فلسفه فعلی غرب و حتی فلسفه اسلامی وارد شده است و تا امروز نیز همچنان وجود دارد بدون شک برگرفته شده از فلسفه یونان باستان است و بسیاری از باورهای باستانی در یونان نیز برگرفته از افسانه ها و اسطوره های یونانی همچون آثار هومر هستند. در اشعار هومر روح چیزی است که انسانها با جنگیدن آنرا به خطر می اندازند و در هنگام مرگ آنرا از دست میدهند، روح انسانها همان آخرین نفسی است که از تن یک جنگجوی در حال مرگ خارج میشود. روح در هنگام مرگ از بدن خارج میشود و به دنیای اموات میرود. بنابر این حضور روح شخص را از یک پیکر بیجان متفاوت میکند. اما این به آن معنی نیست که روح در بدن کار خاصی انجام میدهد. هومر هرگز نگفته است که روح فلان کار را انجام میدهد و مثلاً باعث هوشیاری انسان یا هر چیز دیگری است. در اشعار هومر تنها انسانها دارای روح میباشند و حیوانات روح ندارند.

نظریه تالس (639-546 پیش از میلاد). تالس دومین شخصی است که نظر او را پیرامون روح بررسی خواهیم کرد. علی رغم آنکه در اشعار هومر روح تنها به انسان تعلق میگیرد، تقریبا در تمام آثار یونانی متعلق به قرن پنجم پیش از میلاد مسیح روح که تنها جوهر حیات میباشد علاوه بر انسان به همه چیزهای زنده دیگر نیز اطلاق میشود، و روح همان تفاوت چیزهای زنده و غیر زنده است. و کلمه روح مترادف کلمه زنده به شمار میرود بعنوان مثال تالس معتقد بود مغناطیس یا کهربا به دلیل اینکه باعث حرکت آهن میشود زنده است و در نتیجه دارای روح است.

نظریه فیثاغورس (570-500 پیش از میلاد). او به ادامه حیات انسان پس از مرگ به واسطه رها شدن روح او از بدن اعتقاد داشت. زنوفان در مورد فیثاغورس گفته است که روزی از جایی رد میشده است و دیده است افرادی سگی را کتک میزنند، از آنها خواسته است آن سگ را کتک نزنند زیرا این سگ یکی از دوستان او بوده است که مرده است و او صدای روح دوستش را از آه و ناله این سگ شنیده است. فیثاغورس معتقد بود این روح دوستش است که ناله میکند نه سگ.

نظریه امپیدوکلوس (490-430 پیش از میلاد). وی از پیروان فیثاغورس همچون آناکساگوراس و دموکرتیوس گیاهان را موجودات زنده میدانست و در نتیجه معتقد بود گیاهان نیز دارای روح هستند و انسانها میتوانند با گیاهان روح رد و بدل کنند. امپیدوکلوس مدعی بود که در حیات پیشینش یک بته بوده است و البته پیش از آن یک پرنده و ماهی نیز بوده است.

نظریه هراکليوس (535-475 پیش از میلاد). هراکلیوس فیلسوف دیگری است که افکارش پیرامون روح متاثر از فیثاغورس بوده است و بسیار از او نقل قول میکند. هراکلیوس شاید اولین فیلسوفی باشد که علاوه بر حیات حرکت و خرد را نیز به وجود روحی که در سلامت و شرایط صحیح است نسبت داده است. هراکلیوس معتقد است «روح خشک، بهترین و هوشیار ترین است». او میگوید روح یک انسان مست مانند کودک خامی است که سکندری میخورد و نمیداند که به کجا میرود، هراکلویس معتقد بود که استفاده از مشروبات سکره آور روح انسان را خیس میکند و این خیسی روح حس های بدن را تخریب میکند. هراکلویس نیز مانند بسیاری از متفکران قرن پنجم و ششم پیش از میلاد معتقد بود روح ماهیتی مادی دارد اما از نوعی ویژه، برتر و کمیابتر از ماده، هوا و یا آتش ساخته شده است. هراکلیوس همچنین معتقد است روح و بدن انسان با یکدیگر دارای شباهت های بسیار هستند و تنها تفاوتشان در این است که روح از مواد برتری نسبت به بدن ساخته شده است، از این رو اساساً روح چیزی طبیعی به شمار میرفت نه فرا طبیعی.

نظریه افلاطون(427-347 پیش از میلاد). افلاطون شاگرد سقراط (470-399 پیش از میلاد) بوده است و قسمت زیادی از نوشتارهای اولیه افلاطون مربوط به نظریات سقراط میشود. میدانیم که سقراط به جرم کفر گویی در زمان خود اعدام شده است و از او هیچ کتابی باقی نمانده است، بنابر این ما سقراط را از زبان افلاطون میشناسیم. البته آنچه افلاطون به سقراط نسبت میدهد به نظر بسیاری از متخصصین لزوماً نظرات سقراط نیست، بلکه قطعاً افلاطون در بسیاری از موارد افکار خود را از زبان سقراط باز میگوید و او را به یک شخصیت داستانی تبدیل کرده است که در بازار و جاهای دیگر میرود و با مردمان مختلف پرسش و پاسخ میکند. بنابر این نظرات افلاطون پیرامون روح را میتوان در دو گروه از آثار او یافت، در آثار نخستین او که که احتمالاً از قول سقراط نظراتش را اعلام میکند و دوم در آثار موخر او که احتمالاً سقراط دیگر کاملا تنها یک شخصیت داستانی است.

سقراط بگونه ای از روح صحبت کرده است که گویا از دیدگاه او علاوه بر جوهر حیات بودن، روح ترکیبی از شخصیت و دانش قوه عقلانیت هر شخص نیز هست. نظرات سقراط واقعی یا سقراط خیالی افلاطون را  میتوان در کتاب معروف افلاطون فیدو (Phaedo) که چهارمین و آخرین گفتمان سقراط با شاگردانش پیرامون حیات پس از مرگ را نقل میکند و صحنه مرگ او و نوشیدن جام شوکران را نیز تصویر میکند دریافت. فیدو که در میان هواداران سنتی افلاطون به کتاب «پیرامون روح» نیز مشهور بوده است، مانند نمایشنامه ای است که در آن دو تن از پیروان سقراط با نامهای سیمیاس (Simmias) و سبس (Cebes) که به زندان آمده اند تا او را به کمک کریتو (Crito) شاگرد دیگرش از زندان رهایی بخشند، با استادشان سقراط گفتگو میکنند. در گفتمانی که میان سقراط و شاگردانش انجام میگیرد آشکار میکند که باور اکثریت در آن دوران این بوده است که روح پدیده ای مادی است که پس از مرگ همچون دود و نفس پراکنده و در نتیجه نابود میشود.

در فیدو از سقراط  چهار برهان برای جاودانگی روح آورده شده است که دارای اعتباری نیستند و بجز برهان آخر حتی  مورد قبول مخاطبان سقراط نیز قرار نمیگیرند. سقراط در مورد روح دچار شک بوده است و دیدگاه مستحکمی در مورد آن نداشته است و خود از نارسا و غیر معتبر بودن نتیجه براهینش آگاه بوده است. در کتاب جمهوری افلاطون نیز میتوان به این واقعیت دست یافت، گلاکون (Glaucon) از سقراط میپرسد «آیا هنوز درنیافته ای که روح ما جاویدان است و هرگز از بین نخواهد رفت»؟ سقراط شگفت زده به گلاکون نگاه میکند و میگوید «به زئوس (خدای خدایان یونان باستان) قسم که نه، من چنین چیزی را در نیافته ام، آیا تو در آن موقعیت (علمی) هستی که چنین چیزی را با اطمینان ادعا کنی؟». سقراط تنها میخواسته است نشان دهد به احتمال زیاد بر خلاف باور رایج در آن دوران روح پدیده ای مادی همچون پیکر انسان نیست و چیزی متفاوت با سایر مواد است که قابل دیدن و یا بطور کلی حس کردن نیست، همچنین آنقدر که بدن و جسم در معرض تخریب شدن و نابود شدن قرار میگیرد روح به دلیل متفاوت بودن جنس اش به اگر در معرض تخریب شدن باشد حداقل به اندازه بدن در معرض تخریب شدن نیست و دوام بیشتری دارد، نه آنکه فنا ناپذیر و نابود ناشدنی باشد. سقراط همچنین معتقد است روح تجزیه شدنی نیست، یعنی از قسمتهای مختلف ریزتر پدید نیامده است. برهان چهارم سقراط که قوی تر از باقی براهین او است تلاش میکند این نظریه او را استحکام بیشتری بخشد. او با پیشفرض اینکه روح او احتمالاً چندین بار تناسخ یافته است و حیات بر روح مبتنی است استدلال میکند که روح فنا ناپذیر است، که البته به دلیل اینکه فرض وجود روح مورد توافق نیست، توضیح دادن و رد کردن نظر او در مورد حیات پس از مرگ بی ارتباط با این نوشتار است.

بخش دوم نظریات افلاطون پیرامون روح را در کتاب مهم دیگر او که «جمهوری» نام دارد و برخی از خوانندگان سنتی آنرا کتاب «پیرامون عدالت» خوانده اند، میتوان یافت. در این کتاب، افلاطون نظریات متفاوتی با آنچه در فیدو آمده است نسبت به پدیده روح ابراز داشته است. افلاطون عدالت را حالت عالی روح میداند و به همین دلیل جمهوری نیز میتواند نور فراوانی بر نظریه افلاطون در مورد روح بتاباند. در این کتاب نیز روح هم جوهر حیات ارگانهای زنده به شمار میرود و هم جوهر عقلانیت و تمام فعالیتهای فکری بشری. سقراط خیالی در جمهوری استدلال میکند که عادل بودن همواره بهتر از ناعادل بودن است و این را ناشی از آن میداند که روح عادل از روح نا عادل همواره شاد تر است.

در کتاب چهارم جمهوری دیدگاه تازه ای نسبت به روح مطرح میشود، این دیدگاه تازه حاکی از آن است که روحی که وارد بدن میشود حداقل دارای سه جنبه است، خرد، جان و تمایل. در جمهوری میتوان اطلاعات زیادی راجع به هر کدام از این جنبه ها و اینکه روح چگونه کار میکند پیدا کرد. خرد از نظر افلاطون به دانش و حقیقت متصل است، برای درک بهتر این نظر باید با عقیده افلاطون در مورد حقیقت و تمثیل غار او آشنا شد. افلاطون معتقد است ما انسانها درون غاری هستیم و تنها سایه هایی از واقعیتهایی که خارج از غار وجود دارند و بر روی دیواره غار منعکس میشوند میتوانیم ببینیم. وی معتقد است هر آنچه ما میبینیم اصل آن چیز نیست، بلکه اصل آن چیز در دنیایی دیگر که دنیای حقیقی است وجود دارد و ما در دنیایی مجازی هستیم. حال منظور او از اینکه میگوید روح با حقیقت متصل است این است که روح انسان در بند این غار نیست و میتواند با دنیای حقایق رابطه برقرار کند. سقراط خیالی در جمهوری همچنین جنبه تمایل روح را بسیار در ارتباط به سکس، پول، غذا، نوشیدنی و غیره میداند. مهمترین تفاوتی که میان فیدو و جمهوری در تشریح مسئله روح وجود دارد نقش بیشتری است که افلاطون در جمهوری به جوهر حیات بودن روح داده است.

نظریه ارسطو (384-322 پیش از میلاد). نظر ارسطو که در کتاب «پیرامون روح» (5) بسیار از فلاسفه پیشین تکامل یافته تر است. ارسطو روح را در این کتاب خود از تمامی جنبه ها و فعالیتهایش بررسی کرده است. ارسطو معتقد است تمامی فعالیتهای حیاتی ارگانهای زنده بدن همچون حرکت، تغذیه، و تفکر با روح در ارتباط است و این ارتباط را در کتابش شرح میدهد. بنابر در نظریه ارسطو، روح نوعی ویژه از طبیعت است، که باعث تغییر و ایستایی در بدن موجودات زنده همچون حیوانات، گیاهان و انسان میشود. با توجه به اینکه روح در تئوری ارسطو خود عامل فعالیتهای حیاتی ارگانهای بدن است آشکار است که او نیز همانطور که در فیدو در مورد روح صحبت شده است، معتقد است روح چیزی مادی همچون بدن نیست.

مسئله دیگری که در نظریه ارسطو پیرامون روح دارای اهمیت است این است که ارسطو معتقد است روح برای انجام فعالیتهای حیاتی یاد شده نیاز به ارگانهای بدنی دارد، اما از آنجا که ارسطو هیچ ارگانی از بدن را مسئول تفکر نمیدانست، معتقد بود که تفکر تماماً توسط روح و بدون واسطه بدن و بطور مستقل انجام میگیرد، اما او معتقد است از آنجا که تقریباً در تمام فعالیتهای فکری انسانها حس کردن نیز دخیل است، ارگانهای حسی بدن (همچون چشم، گوش و…) نیز همواره باید در فعالیت باشند، بنابر این ارسطو بر خلاف افلاطون معتقد نیست که روح میتواند بدون بدن وجود داشته باشد و به فعالیت خود ادامه دهد. همچنین از آثار ارسطو مشخص میشود که او قلب انسان را جایگاه روح میدانسته است، یعنی از نظر ارسطو روح عامل تفکر انسان است و در قلب هر انسانی جای دارد، شاید همین ایده یونانی باشد که به قرآن راه یافته است و سبب شده است اعراب جایگاه تفکر را در قلب بدانند (6).

نظریه اپیکروس (341-270 پیش از میلاد). اپیکروس یک اتم گرا (Atomist) است، و در بررسی روح نیز اتم گرایی خود را کنار نمیگذارد. او همه چیز بغیر از عدم، همه را در نهایت ساخته شده از اجزاء کوچکتر یعنی اتمها میداند. منابع مشخصی از اینکه اپیکروس روح را متشکل از چه اتمهایی میدانست وجود ندارد، او احتمالاً روح را ساخته شده از اتمهای آتش و یا باد و یا چیزهای مشابهی میدانسته است. اپیکروس که سعی میکرد گرما در بدن و بسیاری از چیزهای دیگر را همواره با معرفی کردن اتمهای مختلف توضیح دهد، و از آنجا که درک حسی در لیست اتمهای او به هیچ اتمی نسبت داده نشده بود گمان میکرد حس کردن و دریافت حسی از محیط (دیدن، بوییدن، شنیدن و…) نیز احتمالاً باید برخاسته از خواص و فعالیتهای مرموز اتمهایی همچون اتمهای روح باشد. در سنت اپیکروسی روح همچنین همان چیزی است که احساسات، تعقل و تمایلات را باعث میشود. بعنوان مثال لوکرتیوس از پیروان اپیکروسیسم، معتقد است که روح دو قسمت دارد، قسمت نخست قسمت خردمندی و عقلانیت است که او این قسمت را «ذهن» مینامد و قسمت دیگر آن قسمت غیر عقلانی و نابخردانه است، و مسئولیت دریافتهای حسی است که لوکرتیوس آنرا بطور مغشوشی «روح» مینامد. اپیکروس همچنین همچون برخی از دیگر از فلاسفه یاد شده روح را دلیل حرکت اعضای بدن نیز میداند. اپیکروس بعد از دموکرتیوس به ماده گرا بودن و انکار خدا معروف است.

نظریه رنه دکارت (1596-1650 میلادی). دکارت فیلسوف و ریاضیدان فرانسوی از فلاسفه دیگری است که به وجود روح اعتقاد داشته است. دست آوردهای فلسفی دکارت در مورد روح در میان جوامع امروزی بشری بیش از هر باور دیگری در این مورد رایج هستند. در زمان دکارت چیزهای زیادی، از جمله حیات، حرکت و غیره به روح نسبت داده میشد رنه دکارت در زمستان سال 1631-32 به دنبال تجسّسات و مطالعات عدیده قبلی خود در ضمن اینکه مستقیماً به تشریح بدن جانداران اعم از حیوان یا انسانها میپرداخت، رساله ای با فرنام «انسان» را به زبان لاتین نوشت که این نوشته او برای اولین بار در سال 1662 میلادی. یعنی 12 سال بعد از فوت دکارت) در شهر لیدن هلند چاپ شده است. دکارت بعد از این مطالعات به این نتیجه رسید که دو کاربرد دیگر که به روح نسبت داده میشد یعنی حرکت و رشد در واقع به روح ارتباطی ندارند و بدن انسان و حیوانات میتوانند بدون وجود روح حرکت و رشد کنند. اما وی کاربرد سومی که برای روح در زمان او وجود داشت یعنی روح عاقله و یا هوشیاری (Consciousness) را انکار نکرد. از نظر دکارت روح همان چیزی است که حس میکند (میبیند، میشنود، میبوید و…)، فکر میکند، به یاد می آورد، تخیل میکند، تصمیم میگیرد و نگران میشود (7). دیدگاه دکارت یعنی استقلال و جدایی ذهن از بدن به دوگانگی (Dualism) معروف است و این دیدگاه آنچنان که در آینده توضیح خواهیم داد اکنون توسط اکثر فلاسفه و دانشمندان به دلیل اینکه نمیتواند به بسیاری از مسائل پاسخ دهد دیدگاهی مردود شمرده میشود (8). دیدگاه دکارت در مورد دوگانگی ذهن و بدن پرسشی اساسی را مطرح میکند که در فلسفه ذهن با نام «مسئله بدن و ذهن» از آن یاد میشود و این مسئله از این قرار است که اگر ذهن (روح) از بدن جدا است، چگونه میتواند بر بدن تاثیر بگذارد و رابطه علی چگونه میتواند بین روح و بدن برقرار شود؟ یا بطور دقیقتر چگونه میتواند بر بدن و رفتار آن تاثیر بگذارد؟ و این پرسش از مهمترین مسائلی است که در مورد دیدگاه دکارت مطرح میشود.

دکارت که شخصی بسیار مذهبی بوده است و تمام تلاشهای خود را برای اثبات حقانیت باور دینی خود یعنی آیین کاتولیک ها انجام داده است برای یافتن پاسخ این پرسش دست به تلاشهای عملی نیز زده است، همانطور که گفته شد او در مطالعاتش به تشریح بدن انسانها در مرده شور خانه و حیوانات پرداخته است و سرانجام به این نتیجه رسیده است که روح از طریق غده صنوبری (9) که در مغز است با بدن رابطه برقرار میکند و از آن به بعد است که تصمیمات روح توسط «ارواح حرکتی» که در بدن وجود دارند موجب ترتیب اثر دادن به این تصمیمات روح میشوند. صاحبنظران معتقدند  غده صنوبری مغز به این دلیل توجه دکارت را جلب کرده است که در سر انسان تمام اعضا بجز غده صنوبری، دو عضو بصورت قرینه موجود است، مثلا، دو چشم و دو گوش وجود دارد و غده صنوبری که شبیه حرف P است تنها عضو یکتا در سر انسان است، وی از آنجا که میدانست تجربیات ما یگانه هستند و دوگانه نیستند نتیجه گرفته است که روح باید از طریق این غده صنوبری با بدن رابطه برقرار کند زیرا در مغز قرینه ای برای آن وجود ندارد، و البته این دیدگاه امروزه از دیدگاه علمی بیشتر شبیه یک شوخی است.

آشکار است که این باورهای رنه دکارت برخاسته از نا آگاهی او از ساختمان مغز انسان بوده است و او همانطور که با مطالعه ماهیچه ها و استخوان های حیوانات و انسانها به این نتیجه رسید که روح عامل حرکت نیست اگر امروز وجود میداشت با مطالعه مغز انسان احتمالاً به این نتیجه میرسید که روح عامل هوشیاری نیز نیست و مغز به تنهایی این وظیفه را بر عهده دارد. البته رنه دکارت در تلاش برای اثبات خدا و قیامت در کتابی که به دانشگاه سوربن تقدیم کرد به نظر خود براهینی برای اثبات ادعای خود آورده است (10) اما این دلایل مدتها است که رد شده اند و منسوخ حساب میشوند و همچنین با داده های علمی نیز همخوانی ندارند. جدا نبودن عقلانیت انسان از بدن او بعد از اثبات حتی توسط عده ای از فلاسفه بیخدا اصلی برای اثبات عدم وجود خدا قرار میگیرد. دکارت حیوانات را دارای ذهن و هوشیاری نمیدانسته است و بنابر این آنها را عاری از روح میدانسته است، زیرا او هوشیاری را به داشتن زبان میدانسته است و البته با تردید گفته است که حیوانات دارای زبان نیستند و در نتیجه روحی ندارند و تنها ماشین هایی هستند که بسیار خوب طراحی شده اند. بنابر این دکارت روح را جوهر حیات نمیدانسته است و معتقد بوده است بدون روح نیز میتوان زنده بود اما نمیتوان هوشیاری داشت.

نظر امانوئل کانت(1724-1804 میلادی). امانوئل کانت فیلسوف خداباور دیگر نیز به وجود روح اعتقاد داشت اما معتقد بود روح را نمیتوان با خرد نشان داد و وجودش را اثبات کرد. اما او معتقد بود که انسان به ناچار باید به این نتیجه برسد که روح وجود دارد زیرا وجود روح برای توسعه دین و اخلاق ضرورت دارد. کانت بطور کلی معتقد است مسائلی همچون وجود خدا و روح و جاودانگی انسان در حوزه بحث نظری نیستند و نه میتوان وجود آنها را اثبات کرد و نه میتوان وجود آنها را رد کرد. البته نظریات کانت تنها در صورتی قابل توجه و تعمق است که سامانه فکری متافیزیکی ویژه وی مورد توافق و قبول باشد و معتبر شناخته شود.

3.2- تناقضات در تعریف روح

گذشته از تعاریف قدیمی روح، روح مسلماً آنگونه که خداباوران امروزی به آن معتقد هستند ماهیتی فیزیکی و طبیعی ندارد و مسئله ای ماوراء طبیعت است و تنها فراطبیعت گرایان میتوانند به وجود چنین چیزی اعتقاد داشته باشند. یعنی از دید کسانیکه طبیعت گرا هستند روح تنها به دلیل ماوراء طبیعی بودنش از هیچگونه ارزش علمی و فلسفی برخوردار نخواهد بود. اما مسئله ای که باید به آن توجه کرد این است که خداباوران از طرفی معتقدند روح پدیده ای غیر مادی است و از طرف دیگر معتقدند روح در بدن انسان است. یعنی برای روح مکان و جایی را تعریف میکنند و این تناقضی آشکار است. چیزی که حالتی طبیعی و مادی نداشته باشد نمیتواند «درون» چیز دیگری (یا حداقل درون چیز طبیعی و یا مادی دیگری) قرار بگیرد. تنها چیزهایی میتوانند درون چیزهای دیگر قرار بگیرند که فضا اشغال میکنند. و چیزهایی که فضا اشغال میکنند یقیناً طبیعی هستند. بنابر این روح از آنجا که نمیتواند هم طبیعی و هم غیر طبیعی باشد، با فرض اینکه میتواند «درون» بدن باشد اساساً در تعریف خود دارای تناقض است.

وقتی کسی میگوید قلب در بدن است، این بدان معنی است که برای قلب جایگاهی در بدن وجود دارد که معمولاً آن جایگاه در سینه و سمت چپ است. حال وقتی خداباوران میگویند روح در بدن است نیز باید بگویند روح در کجای بدن است؟ اگر بگویند روح در تمام بدن هست، باید به این نتیجه رسید که وقتی اعضای بدن شخصی قطع میشود، قسمتی از روح او نیز قطع میشود و آن شخص دارای دو روح میشود و قسمتی از روح او از بدن کنده میشود. همچنین لابد وقتی اعضای بدن دو شخص با یکدیگر تعویض میشوند مقداری از روح آن دو نیز با یکدیگر تعویض میشوند، آشکار است که این باوری پوچ است.

از طرفی دیگر برای روح مسائل بسیار عجیبی همچون حرکت مطرح میشود. میگویند روح انسان بعد از مرگ به سمت خدا بازمیگردد. این جمله به این معنی است که خداوند در نقطه ای قرار گرفته است و روح در نقطه ای دیگر و این روح باید آن مسیر را طی کند تا بخدا برسد. بازهم برای روح جا و مکان در نظر گرفته شده است. حرکت کردن پدیده ای کاملاً فیزیکی است. رفتن روح از نقطه ای به نقطه دیگر به معنی این است که روح در زمان و مکان محصور است، و چنین چیزی لزوماً چیزی طبیعی است. درحالی که روح بر طبق تعریف چیزی غیر طبیعی است. حتی برخی از خداباوران معتقدند روح انسان پرواز میکند. پرواز کردن نیز عملی است که برای غلبه بر جاذبه زمین انجام میگیرد، جاذبه زمین چگونه میتواند بر روی پدیده ای غیر مادی تاثیر بگذارد؟ همچنین بسیاری از خداباوران معتقدند که روح به بدن انسان دمیده میشود، آیا چیز غیر مادی را میتوان دمید؟  آشکار است که خداباوران در تصورشان از روح بسیار خام و گیج هستند و این تناقضات نشان میدهد که خود نمیدانند به چه باور دارند. و همچنین آَشکار است که بنابر اصل تناقض (تناقض چیست؟) چیزی که درون خود تناقضی داشته باشد نمیتواند وجود داشته باشد، در نتیجه وجود این دسته از تناقضات در تعریف روح، باعث میشود که وجود روح محال باشد.

3.3- آیا حیات انسان به روح انسان وابسته است؟

همانطور که گفته شد یکی از اصلی ترین دلایلی که باعث شد انسانها روح را اختراع کنند، تلاش آنها برای توضیح دادن مسئله حیات بود. وابسته دانستن روح و حیات انسان به یکدیگر مانند آن است که انسان را ماشینی فرض کنیم که تا زمانی که روح در آن است کار میکند و به مجرد اینکه روح از بدن خارج شود از کار می افتد. این دیدگاه البته در گذشته مورد تایید بسیاری از فلاسفه و دانشمندان بوده است اما امروزه دیگر چندان ارزش علمی ندارد. همانطور که گفته شد خداباوران بسیاری معتقدند که در هنگام مرگ روح انسان از بدنش خارج میشود و به دنیای دیگر میرود. در مورد خارج شدن روح از بدن انسان پرسشهای زیادی مطرح میشود. روح انسان به کدام یک از ارگانهای بدن در ارتباط است و چه زمانی بدن را ترک میکند؟

خداباوران معتقدند پس از مرگ روح پیوند خود را با بدن قطع میکند و یا از بدن خارج میشود، پرسش این است که آیا روح زمانی که قلب از کار بایستد بدن را ترک میکند؟ یا در زمانی که مغز انسان از کار بایستد؟ بسیار پیش آمده است که افرادی مرگ مغزی داشته اند اما قلب آنها هنوز کار میکرده است. آیا در چنین شرایطی روح از بدن خارج شده است یا نه؟ آیا روح صبر میکند تا ببیند قلب یا مغز کی از کار می افتد تا در آن زمان بدن را ترک کند؟ در برخی از مواقع افرادی به کما میروند و چندین سال مغز آنها فعالیت نمیکند ولی تمامی اعضای بدنشان بطور عادی کار میکنند، این افراد با تغذیه خونی زنده نگاه داشته میشوند و اگر این تغذیه خونی قطع شود به سرعت تمامی اعضای بدنشان از کار خواهد افتاد، آیا روح نشسته است تا ببیند کی سرم از بدن این انسان قطع میشود تا بعد از بدن او مهاجرت کند؟ اگر در چنین شرایطی مغز شخصی عوض شود، او به حیات خود ادامه خواهد داد. زیرا تنها مشکل بدن او مغز او است. اما اگر این مشکل حل نشود او بلافاصله بعد از قطع شدن منبع تغذیه بدنش خواهد مرد.

تکلیف کسانیکه که قلبشان با قلب انسان دیگری عوض شود چیست؟ آیا روح این افراد با هم عوض میشود؟ احتمالاً در چند دهه آینده پزشکان قادر خواهند بود که مغز انسانها را نیز با یکدیگر عوض کنند. در آن شرایط بر سر روح چه می آید؟ اگر مغز انسانی از کالبدی به کالبد دیگر وارد شود آیا روح آندو شخص نیز بین این دو بدن جابجا میشود؟ اگر تمام اعضای بدن یک انسان از جمله مغز او به اشخاص دیگر پیوند زده شوند بر سر روح او چه خواهد آمد؟ آشکار است که در مسئله خارج شدن روح از بدن با پیشرفت علوم پزشکی و قابلیت تعویض اعضای بدن تناقضات بسیاری دیده میشود. آیا دوقلوهای به هم چسبیده دو روح دارند؟ اگر یک روح دارند، بعد از جداسازی آنها در صورتیکه جراحی موفقیت آمیز باشد چه بر سر روحشان خواهد آمد؟ آیا این روح نیز جراحی خواهد شد؟ و اگر دو روح دارند چگونه است که رفتن روح یکی از آنها از کالبدشان معمولا باعث بیرون رفتن روح دیگری نیز میشود؟ آیا میتوان دو روح را در یک بدن قرار داد؟ امروزه میدانیم که اگر با یک جسم برنده، جسم پینه ای (Corpus Callosum)، توده ای از عصبهای مغزی که دو نیمکره مغز را به یکدیگر وصل میکنند را ببریم دو ذهن متفاوت  و مستقل خواهیم داشت (11)، آیا در این زمان روح شخص نیز تبدیل به دو روح میشود؟ تا زمان معینی پس از مرگ بسیاری از اعضای بدن هنوز میتوانند کار کنند، و میتوان این اعضا را به بقیه بیماران پیوند زد، اگر روح با مرگ بدن را ترک میکند چگونه است که بسیاری از اعضای بدن پس از ترک روح از بدن همچنان کار میکنند؟ چرا ناخنها و موهای افراد مرده تا مدتی پس از مرگ آن شخص نیز به رشد خود ادامه میدهند؟ حتی در بسیاری از مواقع میتوان اعضای بدن را بدون داخل کردن آنها در بدنی دیگر، با ایجاد شرایط مصنوعی آزمایشگاهی زنده نگاه داشت، بعنوان مثال تقریباً همه میدانند که سلولهای خونی را میتوان بیرون از بدن نیز زنده نگه داشت، بدن به غیر از سلول چیز دیگری ندارد و سلول برای زیستن به عوامل مشخصی همچون اکسیژن و مواد غذایی نیازمند است که میتوان با ایجاد مصنوعی آن عوامل هر سلول را زنده نگاه داشت، بنابر این در تئوری زنده نگه داشتن تمامی اعضای بدن ممکن است، اما در عمل ایجاد شرایط مصنوعی برای برخی از آنها هنوز به دلیل ضعف فن آوری پزشکی میسر نشده است. برای پزشکان این مسئله مانند روز روشن است که در آینده بسیار نزدیک بانکهای اعضای بدن ایجاد خواهد شد تا افراد بتوانند اعضای بدن را که دچار مشکلاتی میشوند با اعضای بدن مردگانی که اعضای بدنشان را زنده نگه داشته اند عوض کنند. در تئوری اگر بتوان چنین کاری را در مورد تمامی اعضای بدن انجام داد، میتوان انسانی را بطور موقت کشت و در آینده او را دوباره زنده کرد. اعضای بدن انسانها را میتوان بگونه ای بسیار شبیه (12) از روی ساختار سلولی همانند سازی (Cloning) کرد. این مسائل همگی بیانگر آن هستند که اطلاعات پزشکی و دانش بشر از آناتومی بدنش باعث بوجود آمدن تناقضات بسیار در وجود روح بعنوان جوهر حیات شده است، و این تناقضات را تنها با تعریف علمی حیات که تعریفی کاملاً طبیعی و غیر وابسته به ماوراء طبیعت و روح و خدا است تا حدود زیادی حل کرد.

در باورهای قرآنی حیات انسان مبتنی بر روح او و خارج شدن روح او در دست الله است و روح تنها در زمانی از بدن خارج خواهد شد که الله چنین اجازه ای به آن بدهد (13)، و همچنین زمان خارج شدن روح از بدن و مرگ انسان در لوح محفوظی در نزد خدا از پیش مقرر شده است. این درحالی است که امروز به دلیل پیشرفت مسائل پزشکی و بهداشتی میزان عمر انسانها بسیار بیشتر شده است و همچنان رشدی فزاینده دارد. چگونه است که الله برای انسانهای پیشین عمر کوتاه تری و برای انسانهای امروزی عمری بلند تر مقرر کرده است؟ آیا خارج شدن روح از بدن دلیل مرگ است و یا اختلال در یکی یا تعدادی بیشتر از ارگانهای حیاتی بدن؟ آیا عوامل طبیعی است که باعث طولانی شدن حیات بشر شده است یا ارواح و اشباح و روابطی که موجودی موهوم همچون الله برایشان در نظر داشته است؟ جالب است که افراد در کشورهای مختلف دوران حیات بیشتری دارند، مردم در سوئد و ژاپن و آمریکا عمر طولانی تری نسبت به مردم قم و مکه و مشهد دارند. آیا شرایط زیست محیطی است که باعث میشود افراد مدت بیشتری را عمر کنند و یا الله در نوشتن میزان عمر افراد در آن کتابچه مسخره اش دچار تبعیض نژادی شده است و برای کفار ساکن آمریکا و ژاپن و سوئد عمر بیشتری بریده است؟ انتخاب با شما است، آشکار است که هر انسان خردگرا و معقولی توضیحات علمی را به داستانهای کودکانه دینی ترجیح میدهد.

علاوه بر مسئله خارج شدن روح از بدن در داخل شدن روح به بدن نیز پرسشهای بسیاری وجود دارد. اگر روح جوهری لازم برای حیات است چرا فقط انسانها باید روح داشته باشند؟ تمام موجودات زنده در این صورت باید دارای روح باشند. و این مسئله به تک سلولی ها نیز کشیده میشود. مسئله آنجا جالبتر میشود که این تک سلولی ها به مرور زمان تکامل یافته و موجودات پر سلولی را ایجاد کنند. آیا ارواح هر کدام از این تک سلولی ها با یکدیگر جمع میشوند و روح بزرگتری را برای جانور پر سلولی ایجاد میکنند؟ یعنی آیا ارواح نیز با یکدیگر جمع پذیرند؟ در هنگام تولد انسان چه زمانی روح به بدن او وارد میشود؟ در کدام مرحله از مراحل رشد جنین خداوند روح را در وجود او فوت میکند؟ آیا در هنگام باردار شدن یک تخمک است که روح به تخمک فوت میشود؟ اگر اینگونه است باید توجه داشت که در برخی از موارد تخمک بعد از بارور شدن تقسیم بر دو تخمک دیگر میشود و باعث بوجود آمدن دو جنین و گاهی تقسیم بر شش تخمک بارور شده و باعث تولید شش جنین میشود. آیا روح نیز با این تقسیم شدن، تقسیم و تکه تکه میشود؟

طول عمر انسانها با پیشرفت علوم و بهداشت بیشتر شده است، انسانها بطور محسوسی از گذشته بیشتر زندگی میکنند، عمر انسانها در 100 سال گذشته بطور متوسط 20 سال افزایش پیدا کرده است و این تنها به این دلیل است که شرایط زیستن بهتری برای زیستن انسان بوجود آمده است. انسانها در سال 1997 بین 70 تا 80 سال بطور متوسط زندگی میکنند، این در حالی است که در سال 1900 بین 45 تا 50 سال زندگی میکردند (14). در آینده نیز احتمال آن میرود که انسانها بتوانند بسیار بیشتر زندگی کنند. حال انتخاب شما کدام است؟ آیا با این اوصاف  باید اعتقاد داشت که خداوند در قرون اخیر در قراخواندن روح از بدن انسان درنگ بیشتری کرده است و  حضرت عزرائیل را دیرتر برای گرفتن جان انسانها و خارج کردن روح از بدن ارسال میکند؟ یا اینکه حیات آدمی مسئله ای کاملا مادی و مرتبط با شرایط محیطی و بدن او است؟ آشکار است که قضیه ورود و خروج روح از بدن کاملا یک داستان کودکانه و خرافه ای مضحک است.

پیشرفتهای سریع در بیولوژی و ژنتیک باعث شده است مسئله حیات امروزه بسیار روشنتر از آنچه در گذشته بوده است باشد. ژنها نقشه هایی هستند که سلولها بر اساس آنها ساخته شده و در کنار یکدیگر قرار میگیرند. ژنها نیز خود موادی شیمیایی هستند که توسط انتخاب طبیعی (15) در امتداد زمان تکامل می یابند. ایجاد تغییرات در ژنتیک باعث بوجود آمدن موجودات متفاوتی میشود. ممکن است برای انسانها این بسیار تکان دهنده باشد که تقریباً 99% DNA یک انسان با ژنهای یک بوزینه مشترک است و تنها همان 1 درصد باقیمانده است که باعث میشود انسان، انسان باشد و بوزینه بوزینه (16) و این مسئله هم اکنون که ژنهای هر موجود زنده را میتوان رمزگشایی کرد و همچون کتابی مورد مطالعه قرار داد به همان اندازه در نزد دانشمندان واضح است که رابطه تبدیل انرژی به ماده انیشتن برای آنان واضح است. برای بیولوژیستهای مدرن امروزی بسیار روشن و واضح است که مسئله حیات را میتوان در حد فعل و انفعالات شیمیایی و فیزیکی کاهش داد و کاملاً آنرا از لحاظ طبیعی شرح داد و هیچ نیازی به داستانسرایی و یاری طلبیدن از اشباح و ارواح در این علم، برای توضیح مسئله حیات وجود ندارد. اگر یک بیولوژیست بگوید وقتی روح به کالبد وارد شود، آن کالبد زنده میشود و اگر خارج شود آن کالبد میمیرد، بقیه بیولوژیستها در سلامت فکری او شک خواهند کرد، زیرا ماوراء الطبیعت به دلیل غیر علمی بودنش از دنیای علم اخراج شده است اما اینگونه توضیحات که امروز منحصر به افراد دین خوی است، در میان قدما جایگاه و ارزش علمی داشته است. برای بیولوژیستها هیچ چیز مانند «نیروی حیات» و یا موجودات مرموز و نیروهای مرموز معنی نمیدهد و نیازی به وجود آنها هم دیده نمیشود. اما برای کسانیکه اطلاعی از بیولوژی ندارند و مدتها مشتری خرافات دینی بوده اند درک این مسئله دشوار است.

برای بوجود آمدن یک موجود زنده اساساً هرگز نیازی به حضور روح وجود ندارد، امروزه میتوان موجودات زنده تک سلولی را تنها از مواد شیمیایی  ساخت (17) و همچنین هم اکنون میتوان عمل لقاح را بطور مصنوعی در آزمایشگاه انجام داد و سپس با قرار دادن آن در رحم مادر، باعث بدنیا آمدن یک نوزاد جدید شد. انتظار میرود تا چند سال آینده بتوان رحم مصنوعی را نیز ایجاد کرد و بدون نیاز به انسان، انسان جدیدی را تولید کرد و حتی نطفه را نیز بطور مصنوعی ساخت و یا تغییر داد. با در نظر گرفتن این مسائل نابخردانه است اگر تصور کنیم مسئله حیات نیازمند به وجود روح است، مگر اینکه تصور کنیم خداوند نشسته است تا ببیند در کجا حیاتی در حال شکل گرفتن است و در کدام آزمایشگاه دانشمندان مشغول ایجاد حیات هستند، تا اندکی در آن از روح خود فوت کند.

علاوه بر مسائلی که مطرح شد، ارتباط روح با حیات انسانی مباحث اخلاقی مفصلی را نیز به همراه می آورد. بعنوان مثال کدام خدای ظالمی ممکن است روح را به بدن کودکان عقب مانده بفرستد؟ چرا باید خداوند روح را به بدن کودک ناقص الخلقه بفرستد؟ چرا خداوند روح را به جنینی که قرار است تنها چند ساعت پس از زنده شدن بمیرد بفرستد؟ چرا خداوند بچه هایی که دست و پا ندارند را حیات میبخشد؟ اگر خداوند از بچه هایی که از طریق تماس جنسی غیر مشروع از لحاظ دینی مخالف است چرا به بدن چنین بچه هایی روح میفرستد؟ آیا این مسائل با نیک بودن و مهربان بودن خداوند در تضاد نیست؟ ممکن است خداباوران فاسد الاخلاق که همواره آشکار ترین مسائل اخلاقی را زیر سوال میبیرند و به فاسد ترین موجود ممکن که همان خدایشان باشد «نیک» میگویند بگویند، خوب ما چه میدانیم؟ حتماً حکمتی در کار است. حتماً خیری در کار بوده است. اما این حتم را خداباوران از کجا آورده اند؟ اگر ما نمیدانیم که چنین مسائلی موجب شر است  (که میدانیم اما خداباوران منکر حقایق اخلاقی این چنینی هستند چون به ضرر باورهای خرافیشان تمام میشود) از کجا میدانیم که موجب خیر است؟ چرا خداباوران نادانی خود را به سود خداباوری تمام میکنند؟ همانگونه که تمام مسائلی که در واقعیت شر هستند و در صورت وجود خدا معلول رفتار خدای خداباوران است، توسط خداباوران انکار شده و خیر خوانده میشود، تمامی مسائلی که آنها آنرا خیر میشمارند نیز میتواند شر به شمار آید. اگر فرض بر نادانی انسان و نادیده گرفتن نظام اخلاقی درونی و اجتماعی انسان باشد، دیگر از کجا میتوان فهمید آنچه خدا کرده است خوب است یا بد؟ بنابر این اساساً مرتبط دانستن روح با حیات، و امتیاز صدور روح را منحصر به خدا دانستن در تناقض با فرض نیک سرشت بودن خدا (خداوند چیست؟) است و خدای نیک سرش نمیتواند منبع روح و حیات باشد.

3.4- آیا هوشیاری (Consciousness) انسان به روح وابسته است؟ (18)

همانطور که از تاریخچه اعتقاد به روح پیداست، از اصلی ترین دلایل اعتقاد به روح، این گمان بوده است که هوشیاری انسان وابسته به وجود روح او است، قالب باورمندان به پدیده روح ادعا کرده و میکنند که میان ذهن (Mind) انسان و مغز او تفاوت است و تفکر و هوشیاری او برخاسته از مغز او نیست، بلکه ناشی از روح او است. اما این دیدگاه امروز چندان دارای ارزش علمی نیست و با واقعیت های علمی سازگاری ندارد. بررسی ها و تحقیقات مختلف علمی که محصول آخرین پیشرفتها در زمینه تکنولوژی پزشکی است هر روز بیشتر از دیروز نشان میدهند که حتی احساسات و عواطف انسان نیز مستقیماً برخاسته از فعالیتهای فیزیکی مغز او است.

بسیاری از فلاسفه و دانشمندان در گذشته تصور میکردند مغز و ذهن انسان از یکدیگر جدا و مستقل هستند اما هرچه تکنولوژی مشاهده و آزمایش مغز (بویژه  Nuclear Magnetic Resonance ،Positron emission tomography scanning و مطالعات مربوط به جریان خون در مخ) پیشرفت کرد، بررسی و زیر نظر گرفتن دقیقتر مغز در هنگام اتفاقات احساسی و غیره میسر شد و در نتیجه در نظر دانشمندان تفاوت میان ذهن و مغز کمتر و کمتر شده است و هر روز بیشتر از گذشته مشخص شده است که زبان، فعالیتهای فکری و حسی و حتی شخصیت انسانها همه و همه ناشی از فعالیت مغز او هستند.

لذا اکثر دانشمندان رشته های مربوط به مطالعه مغز معتقد هستند که هوشیاری انسانها برخاسته از فعالیت مغز آنان است. بعنوان مثال باور علمی بر این است که پردازشهای انسان برای مهارتهای زبانی در نیمکره سمت چپ مغز او انجام میگیرد، قسمتهای مربوط به سخن گفتن بر روی قشر تازه مخ (Neocortex) و فعالیتهای مربوط به دیدن در نیمکره سمت راست. رسیدن آسیب به بادامه مغز سبب اخلال در حافظه اعلانی (Declarative Memory) میشود. گلدستین (Goldstein) معتقد بود تحریک کردن بخشهایی از نیمکره چپی مغز، موجب ایجاد ترس و استرس در یک شخص میشود. وابستگی رفتارهای انسانها به ساختمان مغزشان تا آنجا پیش میرود که رابرت هار (19) معتقد است مغز برخی از مجرمین خطرناک با سایر انسانها بطور آشکاری تفاوتهای فیزیکی دارد، مثلاً در مغز این بیماران اتفاقهایی که در بخش مربوط به مهارتهای زبانی مغز می افتد با مغز سایر انسانها متفاوت است. این افراد به آسانی حوصله شان سر میرود و کلافه میشوند، و با اینکه قوانین اجتماع را میشناسند از شکستن آنها لذت میبرند و احساس گناهی نمیکنند. (20) بنابر این با توجه به تمام این مطالعات میتوان گفت که عواطف انسانی نیز همچون هوشیاری او کاملاً محصول فعالیتهای بدنی او و بطور دقیقتر مغز او هستند و هرگاه انسانی عواطف و احساساتی از خود نشان میدهد تغییرات ویژه ای در سیستم عصبی و ساختمان مغز او رخ میدهد، که شاید بتوان در آینده با شبیه سازی کردن این تغییرات باعث شد همان عواطف و احساسات در انسان بروز یابد.

در  مورد ریشه و شالوده هوشیاری انسان دو دیدگاه علمی، بر سایر دیدگاه ها چیرگی دارند، یک دیدگاه فیزیکی کاهش گری (Reductionism) است. کاهش گری بطور کلی در علم به این معنی است که طبیعت چیزهای پیچیده را میتوان با بررسی طبیعت اجزاء تشکیل دهنده آنها تشخیص داد، بنابر این در نوروساینس کسانیکه خود را پیرو این اندیشه میدانند معتقدند که رفتار مغز و بطور کلی تمام فعالیتهای مغزی بشری از جمله هوشیاری، تعقل، احساسات، عواطف و غیره را میتوان در رفتار سلولهای مغزی جستجو کرد. از مهمترین پشتیبانان این تئوری فرانسیس کریک (1916-2004) کاشف DNA انسان است که به دلیل این اکتشاف خود جایزه نوبل را در سال (1962) بطور مشترک با دانشمندان دیگری به خود اختصاص داد. فرانسیس کریک بعدها به نوروساینس رو آورد و بسیاری معتقدند که بیخدایی او باعث شد به این علم روی بیاورد. آخرین کتاب او «فرضیه حیرت انگیز»  (21) بطور کامل به این قضیه میپردازد و فرضیه روح را از دیدگاه علمی به نقد میکشد. کریک معتقد است «شما هیچ چیز نیستید به غیر از مشتی اعصاب» و «شما چیزی نیستید… مگر رفتار تعداد زیادی از گروه های عصبی و مولکولهای وابسته به فعالیتهای عصبی». کریک و طرفداران اندیشه او معتقدند هوشیاری انسان ناشی از ارتباطات هیپوتلاموسی و لایه های قشری مغز است و تنها در صورتی وجود خواهد داشت که برخی از ناحیه های قشری (شامل ناحیه شماره 4 و 6) مدارهای ارتعاشی داشته باشند.

دیدگاه دیگری که در مورد مغز و کاربرد آن مطرح است، دیدگاه فیزیکی غیر کاهش گری است، معتقدان به این گرایش باور ندارند که با نگاه کردن به تک تک سلولها و مولکولهای مغز میتوان به ماهیت هوشیاری انسان پی برد. راجر ولکات اسپری (22) بیولوژیست دیگر که او نیز جایزه نوبل در رشته پزشکی را به خود اختصاص داد از مهمترین پشتیبانان این تئوری است. وی معتقد است هوشیاری یک ویژگی برون آمده از مغز است، اما بر اساس این دیدگاه به هیچ عنوان با کاهش گری نمیتوان به ماهیت واقعی هوشیاری انسان پی برد. هوشیاری یک رابطه متقابل با مغز دارد و این رابطه را میتوان در اتفاقاتی که در مخ می افتد دید، بر اساس این باور، هوشیاری انسان در مغز تجسد می یابد، این دیدگاه را به هیچ عنوان نباید با دوگانگی که دکارت مطرح کرده است و در همین نوشتار پیرامون آن توضیحاتی داده شد اشتباه گرفت. این دیدگاه فعالیتهای مغزی و روانی را فعالیتهای درونی و برونی یک مجموعه از اتفاقات پیچیده میداند که در مجموع هوشیاری انسان را نتیجه میدهد.

در حال حاضر رایج ترین باور در میان فلاسفه ذهن و متخصصان رشته های علمی این باور است که ذهن انسان همچون نرم افزار و بدن (مغز) انسان همچون سخت افزار است و این دو بر روی هم هوشیاری انسان را نشان میدهند، و باور به جدا بودن هوشیاری و ذهن از بدن دیگر باوری کهنه است که دکارت در آن نقش آدمی کاهی را بازی میکند. کنجکاوی انسانها در مورد ذهن، و اینکه چگونه ذهن انسان با بدن او در ارتباط است همواره مسئله ای بحث بر انگیز بوده است و فلاسفه مختلفی از افلاطون، ارسطو گرفته تا دکارت تقریباً هر کدام به نوعی از دوگانگی روی آورده اند. در 200 سال گذشته شواهد علمی انباشته شده روی هم بطور پیوسته و در 40 سال گذشته با دقت بسیار بالا و شتاب بیشتر فاصله و تفاوت میان ذهن و مغز را کم کرده است. در حالی که تحقیقات بسیار پیچیده مولکولی و روانی همچنان ادامه دارند هم اکنون کاملاً واضح است که هر زمان چیزی در ذهن رخ میدهد، تغییری نیز در مغز حاصل میشود و برعکس.

یکی از استدلالهای رایج برای اثبات وجود که به دلیل راه یافتن به کتابهای درسی در میان مردم نیز رواج یافته است این است که سلولهای بدن بعد از مدتی بطور کامل تغییر پیدا میکنند و انسان از لحاظ مادی به موجودی دیگر تبدیل میشود. بعنوان مثال اگر شخصی در 18 سالگی مرتکب جرمی شود این شخص در 40 سالگی تقریباً تمامی سلولهای بدنش عوض شده است و دیگر همان انسان پیشین نیست، از همین روی لزوماً بعد دیگری از انسان وجود دارد و آن بعد روحانی و معنوی او است.

این استدلال بسیار مضحک است، از نظر سازندگان این استدلال اگر دست کسی در 20 سالگی قطع شود، نمیتوان او را در 40 سالگی نیز تنها به دلیل اینکه تمام سلولهای بدنش عوض شده دوباره شناخت و فهمید که این انسان همان انسان است. این استدلال تلاش دارد بگوید که برای اینکه انسانها بتوانند خودشان بمانند حتماً باید یک سری ویژگیهای بدنی آنها ثابت بماند، و البته به اشتباه تصور شده است که با فرض تغییر یافتن تمامی سلولهای بدن، دیگر هیچ چیز در بدن ثابت نخواهد ماند. این درحالی است که سلولهای بدن از روی اطلاعات ژنتیکی وراثتی ساخته و حتی اداره میشوند، یعنی بدن را میتوان همچون یک رایانه دارای سخت افزار و نرم افزار دانست، تغییر یافتن سخت افزار بدن لزوماً باعث تغییر یافتن نرم افزار بدن نمیشود، با مرگ هر سلولی اطلاعات ژنتیکی برای تشکیل سلولی که همان وظایف را بر عهده دارد برای جایگزین شدن سلولهای بعدی فراهم آمده است. درست مانند اینکه سخت دیسک رایانه ای را عوض کنیم اما اطلاعات آن رایانه را عوض نکنیم. در چنین شرایطی میتوانیم تصور کنیم که این رایانه همان رایانه است که از قبل وجود داشته است، و این انسان نیز همان انسان پیشین است. لازم به ذکر است اطلاعات ژنتیکی نیز همچون نرم افزارهای رایانه ای ماهیتی کاملا مادی و سخت افزاری دارند و بدون وجود سخت افزار نمیتوانند وجود داشته باشند.

بدن انسان از این نظر کاملاً شبیه رایانه و یا هر ماشین الکترونیکی دیگری هستند. امروزه توسعه دانش در زمینه ذهن (هوش) مصنوعی (Artificial Intelligence) و الگوریتمهایی که خود را میتوانند ترمیم کنند در فلسفه ذهن تحولات شگرفی را حاصل کرده اند و همانگونه که گفته شد بسیاری از دانشمندان معتقدند ذهن و بدن درست همانند سخت افزار و نرم افزار کامپیوتر هستند.

4- پیامبر اسلام و قرآن و نظرات اسلامی پیرامون روح.

در تاریخ اسلام ماجرای جالب و تأسفباری در مورد مسئله روح وجود دارد. عقبه بن ابی معیط و نضر بن الحارث  دو تن از مشرکین مکه بودند که تصمیم میگیرند پیامبر اسلام را آزمایش کنند. آنها سه سوال برای پیامبر اسلام مطرح میکنند که یکی از آنها در مورد مسئله روح بوده است. و پیامبر اسلام که در مورد روح اطلاعی نداشته است اینگونه از پاسخ دادن فرار میکند.

اسراء 85

وَيَسْأَلُونَكَ عَنِ الرُّوحِ قُلِ الرُّوحُ مِنْ أَمْرِ رَبِّي وَمَا أُوتِيتُم مِّن الْعِلْمِ إِلاَّ قَلِيلاً
تو را از روح می پرسند بگو : روح جزئی از فرمان پروردگار من است و شما را جز اندک دانشی نداده اند.

این دو شخص بعدها در جنگ بدر اسیر مسلمانان میشوند، مسلمانان باقی اسیران این جنگ را به مدینه آوردند و به فدیه آزاد کردند اما پیامبر اسلام در میان راه بدر تا مدینه، دستور میدهد که این دو شخص کشته شوند و امام علی بن ابوطالب این دو شخص را گردن میزند. آشکار است که محمد احساس تنفر و حقارت شدیدی از این مچ گیری میکرده است و از آنها عقده ای به دل داشته است و در وقتی که میتواند عقده و کینه خود را خالی کند اینگونه ناجوانمردانه این دو اسیر را بدون اینکه حتی بتوانند از خود دفاعی بکنند تنها از روی خصومت های شخصی و مچ گیری های آنها که سبب رسوایی این پیامبر دروغین میشد، با بیرحمی تمام میکشد. (23)

اما گذشته از این ماجرا آشکار است که محمد در مورد مسئله روح بسیار گیج بوده است و از همین رو است که نمیتواند پاسخ خوبی به این مسئله بدهد و از این رو است که مسئله را به گردن دوست خیالی اش الله انداخته است. گیجی محمد در مورد روح را میتوان در قرآنش نیز دید. اساساً در قرآن حرفی از ماوراء طبیعت زده نمیشود و تمامی باورهای دین خویان اسلامی برخاسته از تلاش فلاسفه و نوابغ دنیای اسلام است که پدیده روح را از فلاسفه یونان گرفته و آنرا تئوریزه کردند. بعنوان مثال محمد در قرآنش به فرشتگان بال داده است؛ در (سوره فاطر آیه 1) میگوید که فرشته ها دو، سه و یا چهار بال دارند. اگر فرشتگان موجوداتی غیر طبیعی هستند چه لزومی دارد دارای بال باشند؟ بال پرندگان برای آن است که با حرکت دادن آن بتوانند بر جاذبه زمین غلبه کنند و از جایی به جای دیگر بروند. در مغز محمد گویا هر چیز که قرار است پرواز کند باید بال داشته باشد برای همین است که او به فرشتگان کتاب قصه اش نیز بال میدهد.

محمد همچنین در مورد جبرئیل فرشته ای که قرار است پستچی باشد و پیغامهای خدا را برای او بفرستد دچار گیجی شدیدی بوده است. در برخی جاها او را روح القدس میخواند، در بعضی جاها او را فرشته میخواند. همانطور که گفته شد نام روح القدس به این دلیل در مسیحیت روح القدس است که مسیحیان معتقدند این روح یا نفس وارد بدن میشود و از این طریق است که شخصی از خدا وحی میگیرد. اما محمد از طرفی دیگر مدعی بود که از جبرئیل وحی میگیرد.  و از آنجا که روح القدس یکی از عناصر تثلیث است و محمد تثلیث را در قرآنش رد و به شدت تکفیر کرده است و مسیحیان معتقد به تثلیث را کافر میخواند (سوره مائده آیات 72 ـ 73)، دچار این گیجی و تناقض گویی میشود. گاهی جبرئیل را روح نامیده است و در جایی او را از ملائکه بشمار برده است و این درحالی است که فرشته و روح دو چیز مختلف هستند. در جاهای دیگر کلمه روح در کنار فرشتگان آمده است، و روح بعنوان یک اسم خاص استفاده شده است، مثلاً در (سوره قدر آیه 4) آمده است که در شب قدر ملائکه و روح به زمین فرستاده خواهند شد و در (سوره معارج آیه 4) گفته شده است که روح بهمراه فرشتگان به سمت خدا عروج میکند، در سه جای دیگری قرآن از روح القدس بعنوان کسی که عیسی را تایید کرده است نام آورده شده است (سوره بقره آیات 87 و 253 و سوره مائده آیه 110) و در جایی به خود قرآن کلمه روح را اطلاق کرده است (سوره شوری آیه 52)، بنابر این در قرآن کلمه روح در موارد مختلفی استفاده شده است و موجب پدید آمدن بحث ها و پرسشهای زیادی شده است که مفسرین قرآن به جزئیات آن پرداخته اند اما خود معترفند که نمیدانند روح چیست (24).

اساساً در قرآن و کتابهای قدیمی اسلامی حرفی از ماوراء طبیعت زده نمیشود. تمامی اتفاقهای قرآنی و اسلامی کاملاً طبیعی هستند. قرآن از کلمه غیب، یعنی غیر قابل دیدن استفاده میکند نه غیر طبیعی و یا فراطبیعی (25)، در کتابهای اولیه اسلامی حتی در بسیاری از مواقع جبرئیل سوار بر خر میشود و در روی زمین راه میرود (26). در باورهای اسلامی موجوداتی که امروزه ماوراء طبیعی خوانده میشوند تماماً طبیعی هستند، محصور در زمان هستند و حتی جا و مکان  نیز دارند. بعنوان مثال باور رایج در میان مسلمانان است که بر روی شانه های انسانها دو فرشته نشسته اند که یکی اعمال خوب انسان را مینویسد و دیگری اعمال بد انسان را، این باعث میشود که این فرشته ها هم محصور در زمان و هم محصور در مکان باشند، زیرا جایگاهشان بر روی شانه ها است (حال اگر کسی شانه اش را از دست بدهد فرشته بیچاره کجا خواهد نشست؟) و همزمان با اعمال شخص رفتارش را ارزیابی کرده و ثبت میکنند، و هر چیز که محصور در زمان و مکان باشد لزوماً چیزی طبیعی است.

در باورهای اسلامی حیات پس از مرگ نیز کاملاً طبیعی گزارش شده است. بسیاری از مسلمانان گمان میکنند که این روح انسان است که در روز قیامت در بهشت وارد خواهد شد. این درحالی است که در قرآن گفته شده است که خداوند ذرات بدن شما را جمع آوری خواهد کرد. معاد اسلامی کاملاً مسئله ای جسمانی است. در قرآن همچنین گفته میشود که دست و پای شما علیه شما در روز قیامت شهادت خواهند داد. گذشته از اینکه شهادت دادن اعضای بدن در روز قیامت همچون باقی باورهای اسلامی بسیار نابخردانه و کودکانه است، این مسئله امروزه از آنجا که اعضای بدن انسانها با یکدیگر پیوند زده میشود بسیار مضحکتر به نظر میرسد. تصور کنید شخصی بر اثر تصادف دست خود را از دست بدهد و پزشکان دست شخص دیگری را به دست او پیوند بزنند. در روز قیامت کدام دست است که علیه او شهادت خواهد داد؟ آیا دست خودش علیه او شهادت خواهد داد یا دست دومی که مربوط به شخص دیگر بوده است؟ آشکار است که این دو دست باید هردو علیه آن شخص شهادت بدهند. البته ممکن است مسلمانان بگویند اول آن دست اصلی شهادت خواهد داد بعد این دو دست با یکدیگر عوض خواهند شد و دست دوم بجای دست اول خواهد نشست و علیه شخص شهادت خواهد داد، بنابر این در روز قیامت مقدار زیادی جراحی باید انجام بگیرد.

حال مسئله را یک مقدار پیچیده تر کنیم. آشکار است که تمام سلولهای بدن انسان ساخته شده از مواد غذایی هستند که شخص مصرف میکند، و این مواد غذایی ساخته شده از اتمها هستند. از طرفی همه انسانها بعد از مرگ تجزیه شده و ذرات بدنشان به طبیعت بازمیگردد و اصلاً بعید نیست که بعدها این اتمها دوباره وارد بدن شخص دیگری شوند و در نتیجه سلولهای او را تشکیل بدهند. بنابر این میتوان گفت قسمتی از ذرات بدن هر انسانی احتمالاً قبلاً ذرات بدن شخص دیگری بوده است. حال جمع آوری ذرات در روز قیامت توسط الله تنها در صورتی ممکن است که همه افراد از ذرات یکتای بصورت مستقل تشکیل شده باشد، درحالی که اینگونه نیست. فرض کنید شخص A مقدار X از ذرات بدنش را از بدن شخص B گرفته باشد. حال این X در روز قیامت در بدن چه کسی جمع خواهد شد؟ شخص A یا شخص B؟ مقدار X به چه کسی متعلق خواهد بود و علیه چه کسی شهادت خواهد داد؟ مسئله جالب و کلاسیک دیگری از همین نوع وجود دارد که اسلامگرایان در طول تاریخ تلاش کرده اند برای آن پاسخهای معقولی را فراهم کنند اما ره به جایی نبرده اند. این مسئله از این قرار است که اگر فرض کنیم شخصی پس از مرگ شخصی دیگر را بخورد و اعضای بدن شخص خورده شده، تبدیل به اعضای بدن شخص خورنده شود، در معاد جسمانی بر سر بدن فرد اولیه چه خواهد آمد؟ آشکار است که این قصه های کودکانه ای همچون معاد جسمانی مورد قبول هیچ خردمندی نخواهد بود، به همین دلیل است که حتی بسیاری از  فلاسفه ای که مسلمان نیز بوده اند همچون پور سینا و فارابی نیز معاد جسمانی را رد کرده اند، یا دست کم عقلانی بودن و قابل اثبات بودن آنرا محال دانسته اند و به همین دلیل است که امام محمد غزالی است پور سینا را کافر و از «روسای ضلال» (سرکردگان گمراهی) خطاب کرده است (27).

مسئله دیگری که امروزه با آن روبرو هستیم مسئله تغییر جنسی است. بنابر مسائل خاص بیولوژیکی برخی از انسانها دو جنسه به دنیا می آیند (معلوم نیست الله به چه دلیل چنین کاری را با مخلوق خود کرده است) و یا اینکه به هر دلیل جسمی و یا روحی دیگری هویت جنسیشان برابر با جنس مخالفشان هست (28) و امروزه با پیشرفت تکنولوژیکی در زمینه پزشکی این افراد میتوانند تغییر جنسیت بدهند. آیا با تغییر جنسیت دادن این افراد روحشان نیز تغییر جنسیت میدهد؟ تکلیف این افراد در بهشت چه خواهد بود؟ آیا در آن دنیا باید به دنبال حوری های بهشتی بیافتند و یا الله آنها را شوهر خواهد داد؟ احتمالاً مومنان خواهند گفت در بهشت هر آنچه مومن بخواهد برایش میسر است (29)، بنابر این اگر مومنی همجنسگرا (همجنس گرایی چیست؟) هم باشد میتواند با بقیه مومنان هم جنس خود رابطه جنسی برقرار کند. اگر چنین کاری در بهشت ممکن است چرا بر روی زمین غیر ممکن است و مسلمانان خود را در مقابل حقوق همجنسگرایان اینقدر آزار میدهند؟ از این گذشته بنابر گفته قرآن اگر همه چیز برای مومنان مهیا است آیا مومنان میتوانند در بهشت با همسران رسول الله هم همبستر شوند؟ آیا کودکانی همچون عایشه در بهشت از دست پیامبر اسلام در امان خواهند بود؟ نعوذاً بالله با خود خدا چطور؟ اگر همه چیز میسر نیست پس چرا قرآن به آن اشاره ای نکرده است؟

علاوه بر تمام این مسائل، در دین اسلام حتی خود خدا نیز موجودی کاملاً طبیعی است. در قرآن نوشته شده است که الله دو دست دارد (سوره ص آیه 75، و سوره الزمر آیه 67). برخی از مفسرین قرآن کلمه «ید» برای الله را به «قدرت» ترجمه کرده اند، این درحالی است که در قرآن کلمه ید بصورت «مثنی» استفاده کرده است، یعنی گفته است دو دست دارد و یکی دست چپ و دیگری دست راست است، اگر قرار است ید به قدرت ترجمه شود، قدرت را باید «دو قدرت» ترجمه کرد و مفسرین قرآن نمیتوانند چنین خطای آشکاری را ماست مالی کنند. سلفیان (معروف به وهابی ها) معتقدند منظور از دست واقعاً همان دست است و نیازی نیست که اینگونه آیات در قرآن را بصورت غیر جسمانی در نظر بگیریم، و به نظر میرسد که واقعاً پیامبر اسلام خدا را اینگونه انسانگرایانه تصور میکرده است. الله همچنین دارای صورت است (سوره انعام آیه 52، سوره رعد آیه 22، سوره کهف 28، سوره روم 38 و 39) و مومنان قرار است الله را در قیامت «ببینند» و با او لقاء کنند، یعنی الله قابل دیدین نیز هست (سوره یونس آیه 7) الله دارای چشم است (سوره طه آیه 39)، الله دارای ساق پا است (سوره القلم آیه 42، برای توضیحات دقیقتر مراجعه شود به صحیح بخاری جلد نهم، کتاب 60، شماره 441 و صحیح بخاری جلد نهم، کتاب 93، شماره 532  و برای ترجمه های بیشتر رجوع شود به ترجمه صاحب محدث دهلوی، ترجمه فیض الاسلام، ترجمه عباس مصباح زاده، ترجمه محمد کاظم معزی، ترجمه حاج محمود یاسری، ترجمه اشرفی تبریزی، همچنین مراجعه شود به ترجمه آیت الله مکارم شیرازی برای اینکه بدانیم چگونه یک آیت الله مفتضحانه دروغ میگوید و کلمه مفرد را جمع میکند)، الله حرکت میکند و در روز قیامت در صف فرشتگان «می آید»، یعنی حرکت میکند (سوره الفجر آیه 22). همچنین قرار است الله در روز قیامت بر تخت (عرش) بنشیند و چند فرشته او را حمل کنند (سوره الحاقه آیه 17)، و همچنین فرشته ها دور عرش الله گرد آمده اند ( سوره غافر آیه 7 و سوره الزمر آیه 75) . الله در قرآن بر اساس رفتار انسانها عکس العمل نشان میدهد، عصبانی میشود، خوشحال میشود و این مسئله به دلیل آنکه الله تابع رفتار انسانها است نشان میدهد که انسانها به نوعی کنترل بر روی الله دارند. و همچنین نشان میدهد که الله نیز محدود به زمان است و در زمان و مکان مشخصی به سر میبرد. اینها همه و همه گواه این مسئله هستند که خالق الله اسلامی، یعنی پیامبر اسلام از مسئله ای به نام ماوراء طبیعت کاملاً بی اطلاع بوده است و اباطیل خود را بگونه ای کاملاً طبیعی سراییده است، و درکی که مسلمانان امروزه از خدا بعنوان موجودی فراطبیعی دارند، تماماً برخاسته از تلاش و تحقیقات فلاسفه ای است که ماوراء طبیعت را از یونانیان باستان آموخته اند نه از برخاسته از خود اسلام و این تفاسیر فلسفی مورد اعتراض بسیاری از علمای اسلام بوده است.

5- بررسی برخی دلایل رایج برای باور به روح

جدا از استدلالها و دلایلی که فلاسفه و دانشمندان برای باور به روح داشته اند، مسائل مشخصی معمولاً در میان مردم باعث اعتقاد به وجود روح میشود که پرداختن به برخی از این مسائل خالی از ارزش نیست.

5.1- احضار روح

جلسات احضار روح معمولاً به دو طریق مختلف صورت میگیرند. در طریقه اول افراد حروف الفبا را بگونه ای مرتب میچینند و سپس شیعی که حرکت دادن آن آسان است (مثلاً یک لیوان یا نعلبکی) را در وسط میگذارند و دستهایشان را روی آن جسم که قابلیت حرکت دارد قرار میدهند. در اسباب بازی فروشیهای کشورهای غربی تخته هایی چوبین فروخته میشود که تخته اوجا (30) نام دارند و حروف الفبا روی آنها به همراه کلمات «درود و بدرود» و «آری و نه» روی آن چاپ شده است و جسمی شبیه ذره بین نیز همراه آن ارائه میشود. افرادی که اطراف این تخته مینشینند سوالی را مطرح میکنند و بعد دستهایشان را روی جسم متحرک میگذارند و شخصی جسم را حرکت میدهد و بر روی حروف الفبا یا روی یکی از کلمات میبرد. برخی از مردم گمان میکنند این حرکت ها مربوط به موجودات ماوراء طبیعی همچون روح و جن هستند، اما شک گرایان پیشنهاد میکنند که این حرکت بطور خودآگاه یا ناخودآگاه توسط کسانی که در جلسه حضور دارند انجام میشود. این شک گرایان توصیه میکنند که چشمهای کسانیکه در جلسه حضور دارند بسته شود و نتوانند چیزی را ببینند، و بعد جای حروف الفبا عوض شوند یا تخته اوجا چرخیده شود، در اینصورت دیده خواهد شد که یا جسم محرک حرکت نمیکند و یا اینکه پاسخهای بی سر و ته و غلطی دریافت میشود و این نتیجه تنها به این دلیل میتواند حاصل شود که حرکت جسم متحرک اساساً توسط کسانیکه در جلسه حضور دارند انجام بگیرد نه از طرف موجودات نامرئی.

به فعالیتهای ماهیچه ای که بطور ناخودآگاه توسط بدن انجام میگیرد و سبب حرکت میشود، نیروی ایدیوموتور (31) گفته میشود. آزمایشهای علمی انجام شده توسط ویلیام جیمز، دانشمند انگلیسی مایکل فارادای و روانشناس امریکایی ری هیمن نشان دادند که بسیاری از اتفاقاتی که مردم آنها را به موجودات ماوراء طبیعی و ارواح وغیره نسبت میدهند در حقیقت برخاسته از همین نوع حرکتهای ناخودآگاه ماهیچه ای هستند. بنابر این تمامی جلساتی که در آنها بدن افراد شرکت کننده به نحوی در انجام آزمون نقش دارد را میتوان برخاسته از این حرکت ایدیومتریک دانست. آشکار است که شخص خود پاسخ پرسشهایی که میکند را میداند و از آنجا که خود در حرکت دادن جسم متحرک نقش دارد، پاسخی درست نیز به پرسشهای خود خواهد داد. یک روش مسلم و بسیار ساده دیگر برای نشان دادن واقعیت اینگونه جلسات این است که افراد  دستشان را از روی چیزی که حرکت میکند بردارند، اینگونه خواهند دید که جسم از حرکت بازخواهد ایستاد.

نوع دوم این گردهم آیی ها برای احضار روح اندکی پیچیده تر از نوع اول است. در این گردهم آیی ها ارواح سخن میگویند. در برخی از موارد شخصی که ادعای احضار روح را میکند ادعا میکند که تنها او است که میتواند صدای روح را بشنود و دیگران تنها در صورتی میتوانند صدای روح را بشنوند که آمادگی اش را داشته باشند، و ممکن است اگر آمادگی اش را نداشته باشند دیوانه شوند(!). برای همین شخص مدعی معمولا خودش تنهایی صدا را با گوش شنوا میشنود و بعداً برای بقیه تعریف میکند که روح چه گفته است. در برخی موارد هم صداهایی می آید ولی فقط شخص مدعی است که معنی آن صداها را میفهمد. در این موارد شخص مدعی خود بطور مستقیم یا غیر مستقیم صداها را تولید میکند. در برخی از موارد نیز هیچ صدایی نمی آید، این در مواقعی است که شخصی خردگرا در مجلس وجود داشته باشد و بخواهد مچ گیری کند، در این مواقع گفته میشود که در مجلس انرژی منفی وجود دارد و یا به هر بهانه دیگری اجرای نمایش متوقف میشود. در چنین شرایطی ارواح خجالتی نمایان نمی شوند.

هیچیک از ادعاهای احضار روح تابحال در شرایط آزمایشی و مشاهدات علمی با موفقیت انجام نشده اند، در تمامی مراحلی که در اینگونه مراسم انجام میشود به نوعی تقلب و کلاهبرداری وجود دارد. موسسه جیمز رندی مبلغ 1 میلیون دلار به هرکس که بتواند هر عملی فراطبیعی را انجام دهد پاداش خواهد داد. تارنمای زندیق نیز در صورتیکه هر شخصی از سرتاسر جهان چنین عملی را بتواند در شرایطی آزمایشگاهی و علمی نشان دهد این تارنما را از روی اینترنت حذف خواهد کرد. برای اطلاعات بیشتر به چالش‌ها مراجعه کنید. تا زمانیکه چنین اتفاقی نیافتاده است، میتوان فرض کرد که مدارک و شواهد معتبر و محکم و قابل توجهی در این زمینه وجود ندارد و اعتقاد به آنها بی اساس است.

ادعای احضار ارواح قدمت بسیاری دارد. در تاریخ و افسانه های بسیاری دیده میشود که در کنار پادشاهان و حاکمین همواره جادوگران ستاره شناسان، پیش گویان، جنگیرها و افراد مشابه موجود بوده اند و حتی از جایگاه بالایی نیز در اجتماع برخوردار بودند و اطلاعات راجع به دشمنان و غیره را از این راه ها بدست می آوردند و به پادشاهان ارائه میدادند.  جالب است که این داستانهای خالی از حقیقت و کاملاً خرافی به قرآن نیز راه یافته اند. در قرآن نیز در برخی از موارد جادوگران نقش آفرینی میکنند. مثلاً در (سوره بقره آیه 102) آمده است که شیاطین به برخی از مردم جادوگری آموخته بودند، و در داستان موسی نیز جادوگران دست به جادوگری میزنند. واقعیت داشتن جادوگری در قرآن تایید شده است و جای بسیار تاسف است که افراد دانایی خود را باورمند به این کتاب میدانند.

اما امروزه اگر رئیس جمهوری یا پادشاهی بجای تکیه بر اطلاعات بدست آمده از سرویس های اطلاعاتی کشور یا سایر منابع معتبر اطلاعاتی، بر گفته های یک پیشگو، جن گیر، و یا آخوندی که با امام زمان در تماس است، تکیه کند بسیار بی خرد و فرومایه به نظر خواهد آمد. مطمئناً اگر با احضار روح و صحبت با اجنه میشد اطلاعات نابی بدست آورد، دولتهای دنیا هزینه های هنگفتی برای بدست آوردن اطلاعات صرف نمیکردند و بجای آن یکی دو شخص که در احضار روح تبحر دارند را استخدام میکردند تا مکان اختفای مجرمین و افراد تحت پیگرد را آسان تر بیابند.

مسئله ای که در اینجا باید به آن اشاره کرد این است که ارواح قرار است طبق تعریفشان ماوراء طبیعی باشند، و چیزهای طبیعی قابل دریافت حسی نیستند، یعنی اگر بتوان چیزی را ببینید، لمس کنید و یا بشنوید  آن چیز دیگر ماوراء طبیعی نیست، و از آنجا که در تمامی این نوع آزمونها از قبیل عکس گرفتن از ارواح، ضبط کردن صدای ارواح، احضار روح و غیره، مدعیان آنها ادعا میکنند میتوانند نمودهایی طبیعی از روح را بگونه ای قابل دریافت حسی نشان بدهند، ننیجه این آزمونها چه درست چه نادرست کاملاً بی ارتباط با روح است.

5.2- دژاوو

قضیه دژاوو یا دجاوو نیز از دیگر مسائلی است که باعث میشود بسیاری از مردم معتقد به وجود روح شوند. این مسئله وقتی رخ میدهد که انسان برای نخستین بار با صحنه ای مواجه میشود و گمان میکند که از قبل آن صحنه را دیده است و با آن آشنایی دارد. کلمه دژاوو در زبان فرانسوی به معنی «از پیش دیده شده» است و توسط امیل بویراک (1851-1917) به این حالت اختصاص داده شده است و بعنوان یک اصطلاح علمی برای آن در آمده است. همچون بسیاری از سایر باورهای دینی و فراطبیعی که انسانها دارند اعتقاد به روح به دلیل تجربه دژاوو نیز ریشه در نادانی افراد از طبیعت، و در این مورد بخصوص در مورد طبیعت مغز خودشان دارد. پدیده دژاوو هیچ ارتباطی با روح و مسائل رویایی دیگر ندارد، هرچند اسلامگرایان و بسیاری از سایر دین خویان تا آنجا که میتوانسته اند از این نادانی مشتریان خود استفاده کرده اند و خرافات خود را به مردم قبولانده اند. بسیاری از خرافه گرایان معتقد به تناسخ روح دژاوو را در ارتباط مستقیم با زندگی پیشین انسانها میدانند، اما توضیحی که یک خردگرا در مورد پدیده دژاوو دارد میتواند یکی از سه حالت زیر باشد.

در بسیاری از موارد انسان گمان میکند که این اولین باری است با چنین صحنه ای روبرو میشود، این درحالی است که وی قبلا نیز در همان موقعیت قرار گرفته است و با همان صحنه روبرو شده است اما در بار اول توجه کافی به محیط نکرده است یا اینکه به هر دلیل دیگری اطلاعات مربوط به آن موقعیت در حافظه او تضعیف شده باشد. مثلا اگر شخصی 50 سال سن داشته باشد و چندین کتاب خوانده باشد اصلا عجیب نیست که در موقع خواندن یک کتاب که جدیداً خریداری کرده است با خود بگوید «آیا من این کتاب را قبلاً نخوانده ام؟». بنابر این در بسیاری از موارد این احساس به ما دست میدهد زیرا واقعاً قبلا این اتفاق افتاده است اما در حافظه ما کمرنگ شده است یا ما آنرا بطور کامل به یاد نمی آوریم. پدیده دژاوو البته کاملا متفاوت با فراموشی یا گیجی است، احساسی که در این مواقع به انسان دست میدهد احساس گیجی نیست، بلکه احساس تعجب و شگفتی است.

در برخی از موارد ممکن است انسان توصیف های شفافی از آن صحنه را از قبل از دیگران شنیده باشد یا خودش در مورد آن صحنه و موقعیت تفکر کرده باشد و در تخیلات خود آن موقعیت را تصور کرده باشد و حدس زده باشد و بنابر این وقتی با آن صحنه روبرو میشود احساس آشنایی با آن صحنه بکند.

توضیح علمی پدیده دژاوو در ارتباط مستقیم با فرایند حافظه انسان است. در مغز قسمتهای مختلفی وجود دارند که هرکدام با گذشته، حال و آینده سر و کار دارند. بطور کلی قسمتهای فوقانی مغز با آینده، قسمتهای نزدیک به گیجگاه با گذشته و قسمتهای زیرین با حال سر و کار دارند. در شرایط عادی قسمتهای فوقانی وقتی فعال میشوند که انسان به فکر آینده است و در مورد رفتارهایی که از خود نشان خواهد داد فکر میکند و قسمتهای نزدیک به گیجگاه زمانی فعال میشوند که انسان به خاطرات گذشته خود می اندیشد. در ساختار مغز انسان بادامه (Amygdala) است که مسئولیت هشیاری ما را در زمان حال را بر عهده دارد.  بادامه همچنین به احساسات ما از اطراف تون و رنگ میبخشد. وقتی شما یک خودرو را میبینید که به سرعت به سمت شما می آید به سرعت عکس العمل از خود نشان میدهید و خود را به طرف پیاده رو پرتاب میکنید، این عکس العمل همان کاری است که بادامه در مغز انسان آنرا هدایت میکند. بادامه همچنین باعث تغییر سریع چهره انسان در عکس العمل به اتفاقاتی که اطرافش می افتد میشود. مثلا وقتی انسان ضربه ای را از محیط دریافت میکند، وقتی خبر مرگ کسی را میشنود و یا وقتی که ناگهان صدای بسیار بلندی را میشنود ناگهان چهره اش تغییر می یابد. این تغییر چهره سریع نیز فعالیت بادامه مغز انسان است.

این عکس العمل ها نیازمند پردازش بسیار سریع در مغز انسان است و این دقیقاً همان کاری است که بادامه مغز انسان در آن تخصص دارد. بادامه انسان همچنین به انسان احساس زندگی کردن در زمان حال را میدهد و در هر ثانیه 40 بار با توجه به اطلاعاتی که از محیط دریافت میشود حالت و احساسی جدید را به انسان القا میکند. این فعالیت بادامه در شرایط عادی آنقدر سریع است که معمولا توسط انسان احساس نمیشود و تنها با آزمایشهای دقیق میتوان آنرا تشخیص داد.

هیپوتالاموس عضو دیگری از مغز است که برای توضیح مختصری در مورد پدیده دژاوو باید به آن بپردازیم. هیپوتالاموس مسئولیت حافظه کوتاه مدت انسان را بر عهده دارد و این واقعیت از آنجا پیدا شده است که اختلالات هیپوتالاموسی معمولا موجب اختلالات شدید در حافظه کوتاه مدت انسان میشوند. هیپوتالاموس باعث میشود تا ما در زمان حال قرار بگیریم و احساس در زمان حال بودن به ما دست بدهد. افرادی وجود دارند که هیپوتالاموسشان صدمه دیده است و هرگز قادر نیستند چیزهایی را که بعد از صدمه دیدن مغزشان برایشان اتفاق افتاده است به یاد بیاورند.

بخش دیگر مغز که مسئولیت حافظه بلند مدت را برعهده دارد لایه پاراهیپوکمپال (Parahippocampal) نامیده میشود. این قسمت از مغز در واقع متشکل از سلولهای متعددی است که سطح مغز را و اطراف هیپوتالاموس را فرا گرفته اند و در ارتباط بسیار نزدیک با هیپوتالاموس هستند.

معمولا ارتباط این سه بخش مغز با یکدیگر بسیار سریع انجام میگیرد. ما اطلاعات را از محیط میگیریم و آنرا در حافظه کوتاه مدت خود نگه میداریم و بعد با حافظه بلند مدت خود مقایسه میکنیم و تصمیم گیری کرده عکس العملی نشان میدهیم. اما دژاوو وقتی پیش می آید که اطلاعات دریافت شده از محیط بجای پردازش شدن در بخشی از مغز که مسئول پردازش زمان حال است (بادامک) به دلایل خاصی در قسمتهای مربوط به حافظه کوتاه مدت یا بلند مدت (هیپوتالاموس یا لایه پاراهیپوکمپال) پردازش شوند. در این شرایط چیزهایی که از محیط توسط مغز دریافت میشوند برای انسان احساس «خاطره بودن» میدهند و در اینجا است که حالت دژاوو به انسان دست میدهد. باید توجه داشت که مغز انسان با تغییرات شیمیایی فعالیت میکند و در برخی از موارد تغییرات شیمیایی صحیحی انجام نمیگیرد و آنچه در زمان «حال» انجام میگیرد بگونه ای حس میشود که انگار در «گذشته» انجام گرفته است.

دژاوو را میتوان حتی بطور مصنوعی نیز ایجاد کرد. ویلدر پینفیلد (Wilder Penfield) در سال 1955 آزمایشی را انجام داد که در آن شوکهای الکتریکی ضعیفی را به قسمتهای مربوط به حافظه بلند مدت مغز (پاراهیپوکپال) وارد کرد و نتیجه آن شد که هشت درصد کسانیکه در آزمایش شرکت کردند خاطرات گذشته خود را در زمان حال تجربه کردند. یعنی برای مدتی که زیر آزمایش بودند گمان کردند که در گذشته زندگی میکنند.

در مقابل تجربه دژاوو تجربه دیگری نیز وجود دارد که جامیاس وو (هرگز ندیده) نام دارد. این حالت وقتی رخ میدهد که انسان وقتی با چیزی که بارها با آن سر و کار داشته است روبرو میشود احساس میکند که هرگز آنرا ندیده است و آنرا تجربه نکرده است، مثلا وقتی با دوست خود صحبت میکند فکر میکند که این شخص را هرگز نمی شناخته است و یا وقتی در اتاق خود نشسته است گمان میکند که هرگز این مکان را نمی شناسد. این تجربه نیز همچون پدیده دژاوو، یک انحراف یا خطای مغزی است و میتوان با توجه به اطلاعات موجود فعلی در مورد مغز آنرا توضیح داد. این انحراف تقریبا مانند گرفتن زبان انسان و یا حرکتهای عضلانی ناخواسته و ناگهانی در بدن است.

جامیاس وو به اندازه دژاوو رایج نیست اما برای گروهی از انسانها بویژه انسانهای مسن اتفاق می افتد. آمار نشان میدهد که تقریباً دو سوم انسانها حداقل یکبار تجربه دژاوو را داشته اند و یک سوم باقی آنرا تجربه نکرده اند.

5.3- رویا دیدن در هنگام خواب

در یک دوران زندگی عادی هر انسانی حدوداً 6 سال از عمر خود را در خواب دیدن میگذراند. خواب دیدن همواره برای انسان یکی از عجایب بوده است و توضیحات بسیار مختلفی در طول تاریخ برای تشریح خواب و عوامل پدید آورنده آن توسط افراد مختلف ارائه شده است. بسیاری از مردم اعتقاد دارند خواب دیدن آنها متاثر از وجود عالمی فرا مادی است و وجود روح است که سبب میشود انسان بتواند خواب ببیند. نیچه میگوید «در روزهای خشن شکل گیری فرهنگ، انسان معتقد بود که دنیای حقیقی دومی را در رویاهایش کشف میکند، و ریشه تمام ماوراء طبیعت از آنجا آغاز شد. بدون رویا دیدن انسان هرگز موقعیت اختراع این جهان غیر مادی را بدست نمی آورد. شکل گیری اندیشه وجود روح بصورت یک کالبد نیز به همین نوع تفسیر از خواب باز میگردد. وجود خیالی ارواح ظاهرا باعث بوجود آمدن ایده وجود اشباح و در نتیجه خدایان شد.» (32). بسیاری از دین شناسان، روانشناسان و مردمشناسان معتقدند دیدن مردگان در خواب سبب میشد تا انسانهای بدوی و انسانهای نیمه بدوی امروزی (33) مرگ را پایان حیات انسانها ندانند و تصور کنند انسانهای مرده هنوز به نوعی وجود دارند و از طریق خواب میتوان با آنها رابطه برقرار کرد؛ لذا همین مسئله همانطور که نیچه میگوید باعث شد انسان دنیای دیگر و نیروهای مرموزی را متصور شود.

این درحالی است که خواب دیدن هیچ ارتباطی به وجود روح ندارد. حیوانات نیز بر اساس آزمایشهایی که انجام گرفته است خواب میبینند، همچنین تحقیقات علمی نشان داده اند، افرادی که مادرزاد نابینا هستند و هرگز بینایی نداشته اند، در هنگام خواب رویاهای تصویری نمیبینند، زیرا مغز این افراد با دیدن آشنا نیست و تجربه آنرا ندارند، این افراد رویا را با سایر حس های بدنشان تجربه میکنند، مثلا آنرا لمس میکنند یا میشنوند یا می بویند. لذا اگر نظر این افراد را صحیح فرض کنیم باید نتیجه گرفت که حیوانات روح دارند و افراد نابینا روح ندارند و آنچنان که گفته شد این تناقض دارد با جوهر حیات بودن روح و همین مسئله فرضیه علت رویا دیدن بودن روح را باطل میکند.

در مورد اینکه چرا انسانها خواب میبینند تئوریهای مختلفی وجود دارد، فروید معتقد بود خوابهای انسان صرفا برگرفته از تلاش ضمیر ناخودآگاه ذهن انسان است برای دست یابی به چیزهایی که وقتی ما بیدار هستیم دسترسی به آنها نداریم و از نظر فروید آن چیزها غالباً مرتبط با غرایز جنسی انسان است که بطور روزمره سرکوب میشوند. شاگرد او کارل یانگ تئوری استاد را قبول نداشت و معتقد بود رویا دیدن برخاسته از ضمیر خودآگاه انسان است که تلاش میکند مشکلات ما را که در حال بیداری با آن روبرو هستیم حل کند و مسائل مختلف را پردازش کند. اما چیره ترین تئوری موجود برای توضیح خواب مربوط به آلان هابسون و رابرت مک کارلی (34) است که تئوریهای روانکاوانه قدیمی یانگ و فروید را نفی کرده و توضیحی مرتبط با فیزیولوژی ارائه میکند. مطالعه آنچه در هنگام خواب بر مغز انسان میگذرد باعث شد آنها به این نتیجه برسند که خواب دیدن نتیجه برانگیزشهای تصادفی مغز است که حافظه های باقی مانده از آثار تجربیات حسی پیشین را بویژه از بخش حافظه موقت مغز که دسترسی سریعتر و آسانتری به آن مقدور است بازپردازش میکند، این تئوری (Activation-Synthesis) نام دارد و از سال 1973 تاکنون معتبر ترین تئوری توضیح خواب به شمار میرود. (35)

به خواب رفتن انسان پنج مرحله مختلف دارد که در هر مرحله بدن در شرایط خاصی قرار میگیرد. عمیق ترین مرحله خواب REM نام دارد (36) که به معنی «حرکت سریع چشم» است. در این مرحله که معمولا 90 دقیقه بعد از بخواب رفتن وارد آن میشویم چشم انسان در زیر پلکهایش سریعاً حرکت میکند. هر انسانی هر شب بین 3 تا 4 دوره 90 تا 100 دقیقه ای به این مرحله وارد میشود و وارد شدن به این مرحله معمولا همزمان با خواب دیدن است، البته در سایر مراحل خواب نیز انسانها خواب میبینند ولی شفاف ترین خوابها در این مرحله دیده میشوند. در این مرحله ماهیچه های انسان در حال استراحت کردن هستند و فعالیت مغز انسان نیز کاهش مییابد و در مرحله حرکت سریع چشم مغز تنها امواج دلتا که ضعیف ترین امواج مغز هستند تولید میکند (برای اطلاعات بیشتر در مورد امواج مغزی به رویه دهم نشریه پیام ما آزادگان شماره پنجاهم مراجعه کنید.). میزان خونی که در این مرحله به مغز وارد میشود از حالت عادی حتی بیشتر است. گفته میشود نوزادها بیشتر مواقع خوابشان در این مرحله از خواب است و آنها نیز در خواب رویا میبینند.

خواب دیدن با شرایط جسمی و روحی بدن بسیار در ارتباط است، مواد مخدر، الکل و داروهای بسیاری هستند که میتوانند روی خواب تاثیر مستقیم بگذارند. قطع ناگهانی استفاده از برخی داروها که برای مدتی استفاده میشده اند، سردرد، حالت تهوّع در بسیاری از مواقع موجب دیدن کابوس میشوند. همچنین استرس، افسردگی، و ضربه های روحی بطور مستقیم خواب را مورد تاثیر قرار میدهند. رویاها را همچنین میتوان با فکر کردن قبل از خواب تحت تاثیر قرار داد، یعنی برخی از خوابها راجع به موضوعاتی هستند که انسانها راجع به آن موضوعات فکر کرده اند.

خواب هر شخص تا حدود زیادی محدود به دانش و اطلاعات او از محیط اطرافش نیز هست. معمولا گفتگوهایی که در خواب بین انسان و سایرین رد و بدل میشود به زبان مادری انسان یا زبانهایی که بر آنها تسلط دارند انجام میگیرد.

رویاهای انسان از آنجا که برخاسته از مغز وی است و متاثر از وضعیت جسمانی و روحانی او است میتواند بیانگر شرایط روحی و حتی جسمی افراد باشد، از این رو است که روانشناسان علاقه مند هستند خوابهای بیماران خود را بررسی کنند. لذا تعبیر علمی خواب برای دریافتن شرایط درونی انسانها مسئله ای مورد قبول روانشناسان است. این البته به معنی اعتبار تعبیر خواب برای پیش بینی آینده نیست، و هر خوابی باید برای شخصی که آنرا دیده است تعبیر شود نه اینکه مسئله ای برای همه یک معنی را داشته باشد، مثلا برای کسی که در باغ وحش کار میکند دیدن یک فیل در خواب میتواند معنی متفاوتی با کودکی که اسباب بازی اش یک فیل پلاستیکی است داشته باشد.

5.4- رویاهای راستین

دیدن رویاهای راستین (رویا های صادقه)، یعنی خوابهایی که انسان میبیند و بعدها آن خوابها به واقعیت می پیوندند یکی دیگر از دلایل بسیار رایجی است که باعث میشود برخی از انسانها به وجود روح اعتقاد داشته باشند، در این بخش نشان داده خواهد شد که صحت وجود رویاهای راستین، وجود روح و دنیای دیگری را معنی نمیدهد.

همانطور که در بخش پیشین گفته شد رویاهایی که انسان میبیند نیز همانند افکار انسانها کاملاً ساخته و پرداخته مغز انسان هستند، البته فکر کردن انسانها با خواب دیدنشان تفاوتهای اساسی دارد، اما به هر حال قوه عقلانیت و هوشیاری انسانها در هنگام خواب دیدن نیز فعال است، اگر چه به اندازه زمان بیداری فعال نیست و این خود بخود باعث میشود برخی از فکرهای انسان تا حدودی منطقی باشند؛ با این حساب واقعی از آب در آمدن برخی از خوابها هرگز عجیب نیست، زیرا این خوابها نتیجه عقلانیت انسان هستند و عقلانیت انسانها در برخی موارد میتواند چیزهایی را از روی دانسته ها پیش بینی کند.

بعنوان مثال کاملاً طبیعی است اگر شخصی قرار باشد در یک جلسه امتحان شرکت کند و شب قبل از امتحان خواب ببیند که فردا سر موقع از خواب بلند نشده است، حال اگر فردا واقعاً از خواب بیدار نشود و این رویای او به حقیقت بپیوندد هیچ اتفاق عجیبی نیافتاده است. شرایط محیط و اطلاعاتی که شخص از محیط دریافت کرده است باعث میشود او نگران این باشد که فردا خواب بماند، در نتیجه از آنجا که در مواردی خرد سلیم انسان در دیدن خوابها بی تاثیر نیست، اتفاق افتادن آن خوابها ابدا چیز غیر طبیعی نیست. اگر شخصی پدر پیری داشته باشد این کاملاً طبیعی است که خواب ببیند او مرده است زیرا چنین چیزی کاملاً محتمل است، همه انسانها احتمال میدهند که افراد پیر و فرسوده فوت شوند. اگر شما در طول زندگی خود در مورد 500 نفر خواب ببینید که مرده اند و بطور اتفاقی 2 نفر از آنها بمیرند این ابداً جای تعجب ندارد. همچنین است اگر شخصی علاقه مند باشد حضرت علی یا مریم مقدس و زرتشت و امام زمان را در خواب ببیند. اگر این اتفاق واقعاً در خواب رخ بدهد ابداً تعجبی ندارد، بعد از اینکه شخصی ذهن خود را از آلودگیهای دینی پاک کند نیز ممکن است با آقا امام زمان در خواب ملاقات کند اما اینبار زیر گوش مبارک حضرت بزند و از او بخواهد که خواب او را ترک کرده به لانه خود در چاه جمکران و یا هر چاه دیگر بازگردد.

مسئله دوم که باید به آن توجه کرد همان قضیه دژاوو است که در مورد علت آن بطور کامل توضیح داده شد. در بسیاری از مواقع  ما «گمان میکنیم» که با مفهوم یا صحنه ای از قبل آشنایی داریم و از آنجا که اطمینان داریم که قبلا در آن صحنه حضور نداشته ایم و یا محال است واقعا چنین تجربه ای را داشته باشیم، تنها راهی که باقی میماند این است که ما در خواب این تجربه را داشته باشیم. لذا در بسیاری از مواردی که دژاوو اتفاق می افتد افراد به این نتیجه میرسند که در خواب چنین چیزی را قبلا تجربه کرده اند. این درحالی است که آنها واقعا در خواب چنین چیزی را ندیده اند. به افرادی که این توضیح برایشان قانع کننده نیست توصیه میشود هر روز وقتی از خواب بیدار میشوند خوابهای خود را یاد داشت کنند، درصورتی که اینکار انجام گیرد این افراد بعد از مدتی با مراجعه به خوابهای خود درخواهند یافت که در بسیاری از مواقع آنها تنها «گمان» میکنند که چیزی را از قبل در خواب دیده اند. این مسئله معمولاً در مورد ادعاهای بسیار عجیب و نادری که ادعا میشود در خواب دیده شده اند صدق میکند.

مسئله سوم دیدگاه آماری به این قضیه است.  معمولاً افرادی که گمان میکنند خواب هایشان بعضی وقتها به واقعیت تبدیل میشود و از آنها مثالهایی در این زمینه خواسته میشود، نمیتوانند بیش از 10 مثال ذکر کنند. در مورد بسیاری از افراد این اتفاق تنها یک یا دوبار رخ داده است. با توجه به آنکه برخی مطالعات روانشناسی (37) نشان داده اند که هر انسان بطور متوسط حدود پنجاه موضوع مختلف را در هرکدام از دوره های حرکت سریع چشم خود در خواب میبیند و از آنجا که هر انسانی حدودا در هر شب پنج دوره حرکت سریع چشم را تجربه میکند بر اساس این تحقیق هر شب حدوداً دویست و پنجاه موضوع را در خواب میبیند. اگر فرض کنیم احتمال به حقیقت پیوستن یک رویا یک بر روی یک میلیون باشد، با توجه به جمعیت شش میلیاردی فعلی کره زمین در هر شبانه روز رویای بیش از یک و نیم میلیون نفر بر روی کره زمین به حقیقت خواهد پیوست. لذا بر اساس تئوری احتمال ریاضی این ابداً عجیب نیست اگر شخص در تمامی دوران حیات خود 100 بار واقعا خوابی را ببیند که آن خواب به واقعیت بپیوندد. البته باید توجه کرد که در یک رابطه احتمال باید احتمال اتفاق افتادن هریک از حالت ها باهم برابر باشد که باتوجه به مسئله اول که بیان شد چنین چیزی در مورد رویاها صدق نمیکند زیرا رویاها کاملا جهت دار و تولید شده توسط مغز هستند. لذا اگر قرار باشد بطور دقیق این احتمال را محاسبه کنیم (که در عمل محال است) به عددی بسیار بزرگتر از یک و نیم میلیون نفر در شبانه روز دست خواهیم یافت و در آن صورت به حقیقت پیوستن رویا ها بصورت کاملا تصادفی با توجه به تعداد آنها و تعداد آزمایشها (Trials) کاملاً عادی و محتمل به نظر خواهد آمد. در ریاضیات گسسته قانونی وجود دارد به نام «قانون اعداد حقیقتاً بزرگ» (5) این قانون که معمولا توسط بسیاری از انسانها نادیده گرفته میشود نتیجه میدهد که درصورتیکه احتمال وقوع اتفاقی بسیار پایین باشد ولی تعداد آزمایش ها زیاد باشد آن اتفاق بسیار اتفاق خواهد افتاد. مثلاً اگر بگوییم در هر شب تنها 1 درصد (که احتمال بسیار پایینی است) انسانها رویاهای راستین دارند، نتیجه آن خواهد بود که در هر شبانه روز در کشور ایالات متحده آمریکا 3 میلیون نفر رویاهای راستین خواهند داشت (که مقدار بسیار بزرگی است). پس با توجه به این مسئله آماری کاملا عادی و قابل انتظار است اگر میان برخی  از چیزهایی که یک شخص در خواب میبیند و آنچه در واقعیت اتفاق می افتد بطور تصادفی اشتراکاتی وجود داشته باشد.

مسئله چهارم روبرو شدن با افراد مذهبی است که ادعا میکنند خواب دیده اند. بسیاری از افراد شدیدا مومن و مذهبی برخی از اوقات ادعاهای عجیب غریبی در مورد خوابهایشان میکنند. تجربه نشان داده است که این افراد در مورد اتفاقات اطراف خود که واقعیت آنها بر همه آشکار است نیز دروغ های شاخدار میگویند. در مورد موارد واقعی و چیزهایی که آنها ادعا میکنند در واقعیت دیده اند نیز نمیتوان به این جماعت پست فرومایه و دروغگوی فاسد اعتماد کرد، چه برسد به اینکه به آنچه ادعا میکنند در خواب دیده اند اعتماد کرد. باید توجه داشت که انسانهای مذهبی خیلی راحت و با کمال میل دروغ میگویند و از نظر برخی از فلاسفه اسلامی مثل غزالی دروغ گفتن برای تقویت ایمان افراد نه تنها اشکالی ندارد بلکه ثواب نیز دارد. دروغ گفتن شرعی که به تقیه معروف است در میان شیعیان نه تنها یک امکان بلکه در مواردی یک ضرورت است. لذا باید توجه داشت بسیاری از ادعاهایی که برخی از افراد معلوم الحال کم خرد و بی اخلاق مذهبی در اینگونه موارد مطرح میکنند اساساً دروغ هستند و این افراد بیمار واقعا چنین چیزهایی را خواب ندیده اند. دین گرایان برای ترویج اباطیل دینی خود از گفتن هیچ دروغی ابایی ندارند و در صداقت گفتاری آنها همیشه باید بسیار بسیار شک کرد و با احتیاط رفتار کرد و هیچ دلیل خوبی برای اینکه این ادعاهای آنان پذیرفته شود وجود ندارد.

با در نظر گرفتن این چهار توضیح، آشکار است که رویاهای راستین علی رغم آنچه معمولاً فرض میشود اساسا چیزهای عجیب و غیر قابل توجیهی نیستند. این درحالی است که حتی اگر این توجیه ها نیز وجود نداشتند، بازهم دلیلی برای اعتقاد به روح و دنیای فرا مادی وجود نخواهد داشت. زمان آن رسیده است که انسان عادت تاریخی غیر خردمندانه خود را که ندانسته های خود را به موجودات نامرئی و فراطبیعی نسبت میدهد کنار بگذارد. اگر ما دلیل چیزی را ندانیم تنها باید بگوییم که نمیدانیم، نه آنکه دلایل فراطبیعی و خرافاتی برای آن در نظر بگیریم. چه دلیلی وجود دارد که باعث دیدن خوابهای راستین این روح انسان باشد که تاثیر گذار باشد، شاید این گوراگورا، بابانوئل، دختر شاه پریون و یا لولو خور خوره است که باعث میشود ما رویاهای راستین داشته باشیم!

البته این بد آموزی و کج اندیشی در میان مردم ما ظاهراً برخاسته از آموزه های قرآنی است.  در سوره انفال آیه 43 به این اشاره شده است که خداوند پیش از جنگ بدر میزان لشکر دشمن را به آنها «منظور مسلمانان است» کم تر از آنچه واقعاً هستند نشان داده است و اگر بیشتر نشان میداد آنها در جنگیدن مناقشه میکردند بنابر این خداوند توسط خواب تصویری دروغین برای آنها از جنگ پخش میکند تا مشتاق به جنگیدن شوند (توجه کنید که حتی خدای مسلمانان نیز دروغگو است و به مسلمانان دروغ گفتته اس). سوره صافات آیه 102 میگوید که ابراهیم در خواب دیده بود که باید پسرش را ذبح کند و در شرف عمل کردن به این خواب خود بوده است. در سوره یوسف آیه 4 یوسف خوابی میبیند که پدرش بعدا آنرا برای او تعبیر میکند و اتفاقی که پدرش پیش بینی کرده ات واقعا می افتد و خداوند به یوسف تعبیر خواب می آموزد. در همان سوره آیه 43 پادشاه خوابی میبیند و آن خواب توسط یوسف تعبیر میشود. گذشته از قرآن بسیاری از اتفاقات و باورهای مذهبی بویژه در تشیع کاملا مبتنی بر خواب هستند. مثلا مسجد جمکران بر اساس خوابی که شیخ حسن بن مثله جمکرانی دیده است، یا به دروغ گفته است که دیده است بنا شده است و مادر امام زمان نیز توسط خواب از اینکه در آینده با امام حسن عسکری ازدواج خواهد کرد آگاه شده است. اصولا رویاها در میان قدما بسیار جدی گرفته میشدند. در امپراطوری رم، بعضی از اوقات رویاهای افراد به مجلس سنا ارسال میشد تا اعضای مجلس راجع به آنها با یکدیگر بحث و نتیجه گیری کنند، این کار مشابه کاری است که اسلامگرایان انجام میدهند و از روی استخاره تصمیمات کشوری میگیرند.

به کسانیکه بعد از این توضیحات بسیار متعجب از وجود خوابهای راستین هستند توصیه میشود خوابهای خود را یاد داشت کنند، زیرا یاد داشت کردن و ثبت کردن رویاها میتواند نتیجه بهتری در مورد خواب به انسان بدهد. البته گفته میشود پنج دقیقه بعد از هر خواب، انسان 50 درصد آنرا فراموش میکند و 10 دقیقه بعد، انسان 90% آنرا فراموش میکند. بنابر این یاد داشت برداری از خواب بسیار دشوار است. اگر قصد یادداشت برداری از خوابهای خود دارید سعی کنید بعد از برخاستن از خواب از جای خود چندان تکان نخورید، ضبط صوت و یا کاغذ و قلمی در کنار خود از شب قبل آماده داشته باشید.

6- نتیجه گیری

آشکار است که باور به روح ریشه در خیالبافی های انسانهای پیشین دارد و پایه و اساسی علمی و فلسفی ندارد، و دلایل معتبر و یا شواهد علمی معتبری برای باور داشتن به آن وجود ندارد، بنابر این در نظر یک انسان خردگرا باور به وجود روح تنها به دلیل اینکه این باور از فیلتر خرد عبور نمیکند، باوری غیر معقول و غیر خردمندانه است.

7- توضیحات

(1)- این عبارت از جمله عبارات بی معنی است که نه معنایی فلسفی دارد نه معنایی فیزیکی خداباوران به استفاده از آن و عبارات شبیه آن مانند «نیروی برتر»، «انرژی متافیزیکی» و غیره علاقه خاصی نشان میدهند.

(2) – Positron Emission Tomography  و Magnetic Resonance Imaging

(3)- Neuroscience، رشته ای علمی است که بررسی اعصاب و دستگاه عصبی میپردازد و به دو شاخه بررسی مغز و نخاع و همچنین بررسی ارگانهای جانبی بدن میپردازد.

(4)- بسیاری از اطلاعات این بخش از دانشنامه فلسفی دانشگاه استندفورد نقل شده است. برای دسترسی به این منبع اینجا را کلیک کنید.

(5)- متن انگلیسی De Anima از اینجا قابل دسترسی است.

(6)- گویا اینکه مغز جایگاه تفکر است مسئله ای بسیار پیچیده برای قدما بوده است، در قرآن نیز به خطا از قلب بعنوان مرکز تفکر یاد شده است، برای اطلاعات بیشتر به نوشتاری با فرنام «قلب جایگاه تفکر» مراجعه کنید.

(7)- Can Science Explain the Soul, by Jeffrey Ernest Foss page 3

(8)- به نظر برخی از فلسفه دانان هیچ ایده ای در فلسفه کاملاً نمیمیرد، همواره افرادی هستند که مضحک ترین ایده های فلسفی را نیز همچنان باور دارند. از مهمترین افرادی که به ایده دوگانگی روه همچنان معتقد است سر جان اکلس (Sir John Eccles) برنده جایزه نوبل در رشته پزشکی است.

(9)- Pineal Gland

(10)- Descartes, Mediations, in philosophical writings, 2:10

(11)- این آزمایش بسیار مهم توسط راجر اسپری با هدف درمان بیماری صرع انجام گرفت و موجب شود او در سال 1981 جایزه نوبل پزشکی را ببرد. اطلاعات بیشتر را میتوانید در اینجا بیابید.

(12)- شبیه سازی سلولها تقریباً هیچگاه دقیق نخواهد بود، زیرا علاوه بر این واقعیت که سلول ها بر اساس اطلاعات DNA ساخته میشوند، شرایط محیطی نیز بر شکل گیری سلولها تاثیر مستقیم میگذارند، شبیه سازی دقیق سلولها نیازمند ایجاد دقیق آن عوامل است که اینکار در عمل تقریباً غیر ممکن است، زیرا نمیتوان فهمید که بر هر سلول در هر زمانی چه گذشته است و آنچه بر آن گذشته است را بر سلول جدید نیز گذراند.

(13)- به سوره فاطر آیه 11 و سوره واقعه آیه 60 مراجعه کنید.

(14)- http://www.efmoody.com/estate/lifeexpectancy.html

(15)- Natural Selection

(16)- The First Chimpanzee, In search of human origins, Jon gibbin and Jeremey Cherfas Page 1.

(17)- به آزمایش میلر مراجعه کنید

(18)- بسیاری از مطالب این بخش برگرفته از کتاب Whatever Happened to the Soul:Edoted by Warren S.Brown میباشند.

(19)- دکتر Robert Hare، پروفسور برجسته روانشناسی جرمشناسی در دانشگاه UBC است، تارنمای دکتر هار را در اینجا بیابید.

(20)- Robert D.Hare Without Conscience: The Disturbing World of the Psychopaths among Us.

(21)- The Astonishing Hypothesis, by Francis Crick

(22)-  Roger Wolcott Sperry

(23)- جزئیات بیشتر را در نوشتارهایی با فرنام عقبه بن ابی معیط  و نضر بن الحارث مطالعه کنید.

(24)- مراجعه شود به کتاب معارف قرآن (3-1)، ص 349 نوشته آیت الله مصباح یزدی.

(25)- باید توجه کرد هوا و هر چیز کاملاً شفاش دیگری نیز غیر قابل دیدن و غیبی است اما ماوراء طبیعی نیست، بنابر این کلمه غیب به هیچ عنوان برابر با ماوراء طبیعی بودن نیست.

(26)- مراجعه شود به ترجمه فارسی سیرت رسول الله، ابن هشام پوشینه دوم صفحه 749.

(27)- مراجعه شود به تهافت الفلاسفه، ص 284، امام محمد غزالی.

(28)- به این افراد ترانسکشوال (Transexual) گفته میشود.

(29)- سوره زخرف آیه 71 نوشته است هر آنچه مومنان نفسشان در بهشت آرزو کند برایشان فراهم خواهد شد.

(30)- Ouija Board

(31)- Ideomotor effect

(32)- Nietzsche, F. HUMAN, ALL TOO HUMAN, aphorism #5.

(33) – برای اطلاعات بیشتر در این زمینه مراجعه کنید به «نظرهای علمی درباره دین، پیدایش و تکامل دین» نوشته دکتر احمد ایرانی مراجعه کنید.

(34)- Allan Hobson and Robert McCarley

(35)- برای اطلاعات بیشتر در مورد این تئوری

(36)- Law of truly large numbers

(37)- ترنس هینس (Terence Hines) مینویسد «در هر REM حدود 5 رویا با موضوعات مختلف دیده میشود که کم و بیش با یکدیگر رابطه داستانی نیز دارند»، بنابر این هر انسان عادی حدوداً 250 خواب در هر شب میبیند.

شما چقدر از اسرائیل پول گرفته اید؟

اسلامگرایان معمولا چون خود بدون سود مادی دست به کاری نمیزنند و انسانهایی به شدت ریاکار هستند، همواره دیگران را نیز به چشم خود نگاه میکنند و گمان میکنند همه اینگونه هستند.

اما اسرائیل و یهودیان بیچاره همواره طعمه اینگونه تفکر مالیخولیایی و بچه گانه اسلامگرایان میشوند. اسلامگرایان هنوز آنقدر توسعه نیافته اند که درک کنند دشمنی ما لیبرالها و خردگرایان و انسانگرایان و متجدد با آیین ضد بشر و اهریمنی آنان بسیار بسیار بیشتر و موثر تر، پرانگیزه تر و منطقی تر از دشمنی سایر دینداران با آنها است.

تارنمای زندیق به هیچ گروه و سازمانی تعلق ندارد و یک تارنمای غیر انتفاعی است برای ترویج خردگرایی و مبارزه با خرافات و جنون.

اهداف تارنمای زندیق را در اینجا بخوانید.

چرا به جنایات دیگران نمیپردازید؟

یکی از رایج ترین سوالاتی که اسلامگرایان توسط پیامهایشان از ما میپرسند این است که چرا از جنایات سایر ادیان و همچنین جنایاتی که به بهانه دموکراسی و صهیونیسم انجام میشود چیزی نمینویسید؟ در آمورد آنها هم بنویسید تا ثابت شود بیغرض  و بیطرف هستید، در این نوشتار سعی شده پاسخ مناسبی به این پرسش بسیار رایج داده شود.

نخست اینکه ما بیطرف و بیغرض نیستیم و کاملا مغرض و هدفمند عمل میکنیم. این تارنما برای نشان دادن چهره زشت و خوی بربریت و توحش وافر اسلام و اسلامگرایان و نشان دادن خرافی و باطل بودن باورهای آنان تلاش میکند اهداف این تارنما را میتوانید در برگ  «درباره» بطور کامل بررسی کنید، بنابر این تارنمای زندیق بسیار مغرض و هدفمند است.

اما از این گذشته مبارزه با تمام جنایتکاران جهان و تمام ستمکاران و ادیان جهان از دست تارنمای زندیق بر نمی آید، ما تنها به بررسی مشکلاتی میپردازیم که منافع ملی و ملت ایران را تهدید میکنند ما خود را در قبال مشکلات ایران مسئول میدانیم نه مشکلات تمام کائنات. تارنمای زندیق یک تارنمای فارسی است و نوشتن در مورد ادیانی همچون دین مسیحیت و یهودیت و… چندان مخاطبانی در میان فارسی زبانان پیدا نخواهد کرد.

یهودیان و مسیحیان هرگز خطری برای ما نداشته اند، این یهودیان و مسیحیان نبوده اند که 1400 سال پیش و 23 سال پیش به ایران حمله کنند و قتل و جنایت و تجاوز کنند. ملایان ایران یهودی نیستند! اسلامگرا هستند! مشکل ایران یهودیت و صهیونیسم نبوده و نیست. تارنمای زندیق هرگونه جنایت وزیر پا گذاشتن قوانین حقوق بشر (حقوق بشر چیست؟) توسط هر گروه، فرد، سازمان، کشور را محکوم میکند و از تمام سازمانها و  افرادی که در زمینه صلح و آزادی و دموکراسی و حقوق بشر در هر رنگ و نژاد و مذهب و دین در هر نقطه از زمین تلاش میکنند پشتیبانی میکند. اما این تارنما فعالیت های خود را محدود به مبارزه فکری با اسلامگرایی و اسلامگرایان و خرافات اسلامی و مسائل فرهنگی ایران میداند. لذا انتظار اینکه تارنمای زندیق به افشای جنایات ژاپنی ها و آلمانی ها و صهیونیستها و آمریکایی ها و انگلیسی ها و… بپردازد انتظار غلطی است.

امروزه روشنگری و مبازرزه با اسلام به دلیل تهدید بسیار جدی که این ایدئولوژی باطل برای تمام جهان متمدن و انساندوستان و آزادیخواهان دارد، مسئله ای تنها محدود به ما ایرانیان نیست، مبارزه با اسلامگرایی یک حرکت جهانی است و بطوری سازمانیافته و دقیق برنامه ریزی میشود.

همانطور که در پاسخ به پرسش رایج «چطور اسرائیل حقوق بشر را رعايت نميکند ما بايد بکنيم؟» توضیح داده شد، میان جنایات غرب و جنایات اسلامگرایان تفاوتهای اساسی وجود دارد. اساسی ترین تفاوت این است که اگر در دنیای متمدن جنایتی صورت میگیرد این جنایت معمولا خطای یک شخص است و آن شخص طبق قانون مجرم است و مجریان قانون و یا قوه قضائیه آن شخص را تنبیه و مجازات میکند. اما درنقطه مقابل یعنی در جهان اسلام اگر جنایتی انجام میشود، این جنایت از طرف دولت حمایت میشود و کاملا قانونی است، مثلا شکنجه کردن در نظام مقدس ناجمهوری اسلامی کاملا قانونی است و کسی نمیتواند به آن اعتراض کند. اگر کار خلاف قانونی هم حتی انجام شود کسی جرأت اعتراض به آن ندارد چون دولت حامی آن است. تفاوت میان جنایات در ایران  و در غرب این است. به عبارت دیگر جنایات اسلامگرایان تماماً جنایات قانونی هستند و بر اساس مرام و منطق اسلامی نه تنها جرم نیستند بلکه کارهایی خداپرستانه هستند و اسلامگرایان انتظار دریافت پاداش در قبال آنها را دارند.

بعنوان مثال جنایت زندان ابوغریب را در نظر بگیرید، این جنایت به دلیل خطای عده ای انسان خطاکار انجام میگیرد و نمیتوان آنرا به نام تمام آمریکا نوشت. کسانیکه این جنایت را مرتکب شدند افرادی بودن که به خواست خودشان چنین کاری کردند و مقامات امریکایی به شدت آنها را محکوم کردند و این خاطیان محاکمه شدند و جرایم سنگینی برای آنها صادر شد. بنابر این، این دسته از جنایات سازمانیافته ای نیستند، این جنایتکاران از روی قوانین و یا مرام مشخصی به این جنایات دست نمیزنند بلکه صرفا عده ای خطاکار و جنایتکار هستند که دست به جنایت میزنند. عده ای خطاکار امریکایی، تعدادی از زندانیان القاعده را که در بیرون از زندان سر میبرند و دست و پا قطع میکنند، یا با حملات استشهادی خود را و دیگران را از بین میبرند، و عده ای بعثی را که در زمان حمله به ایران طبق سنت پیغمبرشان و دستور آیینشان به زنان و دختران شهرهایی همچون قصر شیرین که طبق قوانین اسلامی باید بعنوان کنیز و غنیمتهای جنگی بین مسلمانان تقسیم شوند تجاوز کردند، برای کسب اطلاعات و جلوگیری از جنایات بیشتر این افراد در زنادن ابوغریب شکنجه کردند. این مسئله تنها به خود این افراد مربوط میشود و جنایت آنها را نمیتوان به پای هیچ تفکر، مکتب یا کشور و نژادی نوشت.

اما در نقطه مقابل وقتی اسلامگرایان جنایتی انجام میدهند، همچون فیلمهای سر بریدن در عراق این جنایات توسط عده ای سرخود انجام نمیگیرد بلکه جنایات سازمان یافته و پیروی از آموزه های اسلامی هستند که چنین جنایاتی را باعث میشوند. افرادی مثل خمینی و خلخالی و بن لادن و محمد و علی تمام عمر خود را به بررسی مفاهیم اسلامی و مطالعه و تحقیق در مورد آن پرداخته اند و اعمالی که طرفداران آنها و خود آنها انجام داده اند کاملا مبتنی بر اسلام است و ریشه در تاریخ اسلام و حتی اعمال خود پیامبر این دین دارد (برای ارائه منابع تاریخی مراجعه کنید به محمد، پیام آور تروریسم. و جنگهای پیغمر وقتل عام یهودیان). بنابر این در این جنایات سازمانیافته آن سازمان که در این مورد دین اسلام است نیز زیر سوال میرود و محکوم میشود نه اشخاصی که این جرایم را مرتکب شده اند.

اندیشه کشی، دگر اندیش کشی، ترورسیم، دست و پا قطع کردن، سنگسار و بسیاری از سایر چیزهایی که ما آنها را جنایت مینامیم کاملا مبتنی بر آموزه های قرآن و تاریخ دین اسلام هستند.

بسیاری از افرادی که این سوال را مطرح میکنند، تلاش دارند که جنایات اسلام گرایان را با نشان دادن جنایات سایر مردمان توجیه کنند، در مورد این نوع سفسطه ها میتوانید در نوشته ای با فرنام «چطور اسرائیل حقوق بشر را رعايت نميکند ما بايد بکنيم؟» توضیحات کافی را بیابید.

از دیدگاه تارنمای زندیق همه ادیان بویژه ادیان خدامحور (خداوند چیست؟)  به دلیل مبتنی بر ایمان (ایمان چیست؟) بودنشان باطل هستند اما اولویت در روشنگری، مبارزه و افشای ادیان باطل مسیحیت، یهودیت، بهائیت، آیین زرتشت نیست، در ایران بزرگترین انگل اجتماعی در حال حاضر اسلام است نه هیچکدامیک از این ادیان. از این گذشته اسلام بدون شک در میان تمامی این ادیان مضر ترین دین برای اجتماعات انسانی است، سایر ادیان یا به دلیل کم تعداد بودن طرفدارانشان و یا به دلیل نقد های آهنینی که در طول تاریخ علیه آنها انجام گرفته است و همچنین قوانین مدرن و پیشرفته کشورهای متمدن، کاملاً اخته و رام و سکولار گشته اند اما دین اسلام به دلیل دگر اندیش ستیزی شدید آن و همچنین استبداد فکری رایج در کشورهای اسلامی تابحال به اندازه سایر ادیان مورد انتقاد قرار نگرفته است. و به همین دلیل است که موجب فساد و جنایت در اجتماع است، بنابر این با امکانات محدود تارنمای زندیق پرداختن به سایر ادیان حداقل فعلاً میسر نیست.

درست است که تمامی ادیان باطل هستند اما برابر دانستن تمامی ادیان با یکدیگر در زیانی که آنها به اجتماع میرسانند و میزان خشونت، خرافات، زن ستیزی و انسان ستیزی آنها هرگز با یکدیگر برابر نیست. با نگاهی سریع به اتفاقاتی که در جهان می افتد میتوان به سادگی دریافت که اسلام مشکلساز ترین دین است و تنها دینی است که در قرن 21 ام انسانها را برای خدا میکشد، کدام دین است که طرفدارانش بخاطر آن اینگونه سر انسانها را از تنشان جدا کنند؟ و یا انسانی را در زمین چال کرده و وی را سنگسار کنند؟ بنابر این تارنمای زندیق از تمامی انسانها از هر رنگ و دین و باور و نژادی دعوت میکند که علیه این دین اهریمنی، فاشیستی و انسان ستیز با یکدیگر علی رغم اختلافات فلسفی و سیاسی خود متحد شوند و آنرا با یاری یکدیگر بر بیاندازند. زیرا اسلام دشمن تمامی انسانها حتی خود مسلمانان است و برای هیچ دگر اندیشی حق حیات برابر قائل نیست.

از اینها گذشته بسیاری از چیزهایی که عموما توسط اسلامگرایان و چپی ها (کمونیست ها و سوسیالیست های ورشکسته) در مورد جنایات صهیونیسم و آمریکا مطرح میشوند اساساً بصورت دروغین و غیر منصفانه مطرح میشوند و ریشه در خصومت تاریخی این افراد با یهودیان و یا دموکراسی و لیبرالیسم و سرمایه داری دارند که با بررسی دقیق آنها و شنیدن حرفهای دو طرف میتوان به دروغ بودن چیزهایی که این افراد بسیار بر آن تکیه میکنند آگاه شد. بررسی این موارد در حوصله و در حوزه اهداف این تارنما نیست اما تنها چند منبع  خارجی در مورد چند مورد بسیار مشهور که اسلامگرایان بسیار به آنها اشاره میکنند و پاسخهایی که به آنها داده شده است و این اسلامگرایان و کمونیست ها هرگز به آنها اشاره نمیکنند اشاره خواهد شد.

سر کار نرفتن 4000 یهودی در روز یازده سپتامبر + + +

حمله و قتل عآم جنین توسط اسرائیل + + + +

قتل عآم صبرا و شتیلا توسط ارتش اسرائیل + + +

کشتن محمد الدوره کودک 12 ساله توسط اسرائیل + + + + +

تارنمای زندیق از تمام جنبش های ضد دینی با هدف گسترش انسانگرایی(هیومنیسم)، خردگرایی (راسیونالیسم)، بیخدایی(آتئیسم)، دنیاگرایی در هر کجای جهان پشتیبانی میکند. و تمامی جنایات انجام شده و نقض حقوق بشر (حقوق بشر چیست؟)، در هر زمان و هرکجا و توسط هر کسی را محکوم میکند.

دنیا و انسان را چه کسی خلق کرده؟

پاسخ کوتاه:

هیچکس!

پاسخ بلند:

این پرسش معمولا نخستین پرسشی است که از یک خداناباور توسط یک خداباور پرسیده میشود. این پرسش همچنین از پرسشهایی است که ذهن پرسشگر انسانها برای مدتهای زیادی بدنبال پاسخ آن بوده است و افراد زیادی از فلاسفه و دانشمندان گرفته تا شاعران و خرافه گرایان هرکدام تلاش کرده اند پاسخی به این پرسش دهند.  در این نوشتار تلاش خواهد شد که پاسخی کامل به این پرسش داده شود. این پرسش درون خود سه فرض اساسی دارد

1- دنیا خلق شده است.

2- انسان خلق شده است.

3- یک کسی دنیا و انسان را خلق کرده است.

و بعد از این سه فرض، خداباور معمولا تلاش میکند که نتیجه بگیرد

4- خداوند دنیا و انسان را خلق کرده است.

حال بعد از این 3 فرض خداباور آدرس کسی که فرض سوم به آن اشاره میکند را از خداناباور میخواهد و میپرسد اگر خدا وجود ندارد پس چه کسی دنیا و انسان را خلق کرده است؟ این درحالی است که خداباور و بیخدا حداقل در مورد یکی از این سه فرض و در مورد بسیاری از خداناباوران در مورد دو فرض نخست نیز، توافق وجود ندارد. لذا اساسا این پرسش چون بر فرضهای غیر مشترک مبتنی است پرسشی صحیح نیست و به یک پرسش غلط نمیتوان پاسخ داد. در این نوشتار ریشه این پرسش رایج و همچنین خطاهای آن پرداخته خواهد شد.

خداباور نخست باید 3 فرض اول را ثابت کند و بعد پرسش را مطرح کند؛ این مانند این است که شخصی از شخص دیگر بپرسد شما در چه زمانی همسر خود را غیب کرده اید؟ در پرسش شخص نخست فرض شده است که طرف مقابل همسری دارد، غیب کردن یک انسان ممکن است و اینکه این اتفاق در مورد همسر شخص مقابل و توسط شخص مقابل انجام گرفته است. حال اگر شخص نخست تمامی این فرضیات را ثابت نکند و یا حداقل این فرضیات مورد توافق طرفین نباشد، این پرسش، پرسش غلطی خواهد بود. و پاسخ شخص پرسش شونده این نخواهد بود که من در فلان زمان اینکار را انجام دادم.

در این نوشتار به بررسی این سه فرض پرداخته خواهد شد اما قبل از آن شایسته است راجع به انگیزه این پرسش و دلیل اینکه این پرسش بسیار پرسش رایجی است اندکی توضیح داده شود.

چرا این پرسش بسیار رایج است؟

آدمیان از روی غرور و غیر واقع بینی خود همواره از اعتراف به «ندانستن» در هراس بوده اند و برخی اوقات این هراس بیهوده و خام باعث میشده است که جوابهایی را برای پرسشهایی که جوابشان را «نمیدانسته اند» از خود بسازند و اوهام و خیالات خود را بجای حقایق به مخاطبان خود تحویل دهند. از بارزترین مثالهای این عادت زشت تاریخی قضیه «خداوند حفره ها» است، توضیحات مفصد پیرامون این مسئله را در نوشتاری با فرنام (خدای حفره ها چیست؟) بیابید. همواره بشر هروقت دلیل چیزی را نمیدانسه است آنرا به خدا و خدایان و سایر موجوداتی که مربوط به دنیای واقعی نبوده اند نسبت میداده است.  یعنی حفره های خالی دانش خود را با چپانیدن موجودات خیالی پر میکرده است، زیرا این روش ساده ترین راه برای رسیدن به پاسخ پرسش های انسان بوده است. نمود این واقعیت را میتوان در طول تاریخ اساطیر بشری دید، هرچه بیشتر به گذشته باز میگردیم فعالیت خدایان و حضور آنان بر روی زمین بیشتر میشود و کارهای عجیب و غریب بیشتری از خدایان و اعمالشان نقل میشود اما حوزه فعالیت خدایان با مرور زمان و با پیشرفت دانش بشری و حوزه فعالیت او کمتر و کمتر شده است و پس از تصعید آنها به آسمان و بعد متافیزیکی شدن آنها، اعمالشان واقعاً ساده و مختصر از سوی خداباوران تلقی میشود.

پرسیدن این پرسش نیز از همیجنا ناشی میشود، خداباور معمولاً چون با مفاهیم مرتبط به نحوه بوجود آمدن انسان و محیط اطراف خود و سیاره ها و ستاره ها و د ر انتها جهان آشنا نیست و اطلاعات چندانی نسبت به این مسائل ندارد، میخواهد نادانی خود را و این حفره ای را که در دانایی خود او وجود دارد را با ساده انگاری بسیاری پوشش دهد و نادانی خود را با دخالت دادن یک موجود ماوراء طبیعی پوشش دهد. شایسته است برای اینکه مسئله خدای حفره ها روشنتر شود مثالی بزنیم.

فرض کنید فضانوردی بر روی کره مریخ میرود و انسانی فضایی می یابد، و به رسم یادبود به او یک مجسمه ساخته شده از یخ هدیه میدهد. آدم فضایی مجسمه را به خانه اش میبرد اما بعد از مدتی نالان نزد فضانورد آمده و میگوید، مجسمه من را یک نفر دزدیده است، من آنرا روی بخاری در خانه ام گذاشته بودم و بعد از مدتی دریافتم که دیگر روی بخاری نیست، لذا یک نفر آنرا از من دزدیده است! چه کسی آنرا دزدیده است؟  فضا نورد بعداً برای او توضیح میدهد که یخ در مقابل بخاری ذوب میشود و کسی آنرا ندزدیده است.

در مثالی که زده شد نادانی آدم فضایی نسبت به چیستی یخ باعث شده بود که او دلیل اتفاق ذوب شدن و آب شدن یخ را نداند و به فکر این بیافتد که یک «کسی» باید حتماً این کار را انجام داده باشد. مثال خداباوران نیز وقتی که این پرسش را مطرح میکنند دقیقاً همینگونه است. یعنی همانطور که گفته شد چون با دنیا و انسان و سایر موجودات و چیستی و چگونگی آنها چندان آشنایی ندارند، فکر میکنند بوجود آمدن اینها را یک «کسی» انجام داده است. اینجاست که پرسش میکنند پس اگر خدایی وجود ندارد پس آن کس کیست که دنیا را بوجود آورده است؟ همواره انسانهایی عادت دارند اتفاقاتی را که علت واقعی آنرا درک نمیکنند به موجوداتی ذی شعور و هوشمند نسبت دهند. لذا این پرسش معمولا از روی نادانی نسبت به مسائل فیزیکی و بیولوژیکی و کیهان شناسی بر میخیزد و ضعف در فلسفه باعث میشود افرا به این نتیجه برسند که حتماً کسی باید جهان را و انسان را خلق کرده باشد و لزوماً آن شخص نیز خدا است. پس خدا وجود دارد، دقیقاً همانگونه که ضعف در زمین شناسی باعث میشود برخی گمان کنند زمین لرزه از طرف خدا است، و ضعف در پزشکی باعث میشود برخی گمان کنند مورد نفرین خدا قرار گرفته اند.

اصولا از جایگاهی بالاتر که به قضیه نگاه کنیم دلیل به وجود آمدن توهمی بنام خداوند همین قضیه بوده است. انسانهایی که در اعصار گذشته زندگی میکرده اند در مقابل پدیده ها، حوادث و اتفاقاتی که در اطرافشان می افتاده به دلیل اینکه از اطلاعات و آگاهی فوق العاده سطحی ای در مقایسه با امروز برخوردار بودند خدایانی میساختند، مثلا در یونان برای آتش و گیاه و باد و طوفان و دریا و جنگ و… خدایانی میساختند، اما به تدریج با کشف واقعیت ها این خدایان از میان رفتند و خدایان کاملتری مانند الله آمدند که یک تنه مسئولیت همه این قضایارا بر عهده گرفته اند. واقعیت در این نکته پنهان است که بشر بطور ناخود آگاه هرگاه علت پدیده ای را نمیدانسته از روی آموزشهای قبلی و محیطی ای که قبلا دیده علت آن پدیده را به سوی خدا سوق میدهد تا جایی که خداوند را در مفاهیم اسلامی علت العلل مینامند، در حالی که در دنیای واقعیت علت هیچ چیز خدا نیست. شما در هیچ کتاب فیزیک یا شیمی ای (مگر چاپ شده در کشورهای اسلامی) حرفی از خدا و یا قدرت خدا نمیبینید، علت ها همگی زمینی و علمی هستند. علوم بشری، چه تجربی و چه نظری همگی روزگاری متکی به الهیات بودند، ولی با فرارسیدن پیشرفتهای متعدد در زمینه های مختلف کم کم بشر دست به اکتشاف علت های ماقعی و منطقی و غیر الهی زد، از این روست که علم اصولا مادیگراست و شما در هیچ رشته علمی ای انشاء الله و ماشالله نمیبینید.

حتی دانشمندان و عالمان بزرگی نیز دچار این انحراف فکری شده اند که شاید بتوان معروف ترین آنها را نیوتون دانست. نیوتون را شاید بتوان بزرگترین مغز علمی تمام طول تاریخ نامید، وی برای کشفیات خود نیاز به ریاضیات جدیدی داشت که این ریاضیات در دوران او وجود نداشت و وی خود دست به کار شد و این ریاضیات را پدید آورد، حسابان (Calculus) بسیاری از مفاهیم خود را مدیون نیوتون است از دیگر خدماتی که نیوتون به علم کرد میتوان کشف نیروی جاذبه و قوانین حرکتی و بسیاری از چیزهای دیگر را نام برد. نیوتون که حدود 300 سال پیش زندگی میکرد خدا را باور داشت. شناخت نیروی جاذبه و حرکتهای فلکی سیارات و حرکت بیضی وار اجرام آسمانی به دور خورشید برای نیوتون همانطور که خود میگوید یک الهام بزرگ بود. نیوتون با نگاه کردن به اینکه چگونه ممکن است سیارات و اجرام آسمانی بر روی یک صفحه و در یک جهت و در مسیر مشخص حرکت کنند را نشان از یک نظم و طراحی و در نتیجه ناظم و یا طراح بزرگ و قادر دانست (نگاه کنید به برهان نظم و رد آن) و علت آنرا خدا دانست و گفت این نظم خدارا اثبات میکند. در حالی که ما امروز میدانیم چرا اجرام به دور خورشید میگردند و چرا در یک جهت و در یک صفحه میگردند و… بنابر این نیوتون در این نتیجه گیری خود دچار یک انحراف شده بود. ما میدانیم این شکاف در دانش نیوتون امروز دارای پاسخ های کاملی است و علت این پدیده ها خدا نیست بلکه پدیده های دیگر علمی است.

بعد از توضیحی مختصر در مورد انگیزه شکل گرفتن این گونه پرسشها در ذهن خداباوران به بررسی فرضهایی که در ابتدای این نوشتار مطرح شد خواهیم پرداخت؛ اما پیش از آن شایسته است چند عبارت را که در این نوشتار استفاده خواهد شد تعریف کنیم.

جهان/کائنات/دنیا

کائنات (Universe) مجموعه ای است که تمام چیزهایی که وجود دارند را در خود جای میدهد. هرچیز که وجود داشته باشد جزو این مجموعه جهانی است و اگر وجود نداشته باشد جزوی از جهان نیست، لذا میتوان گفت جهان و وجود دو مفهوم برابر هستند، هرجا جهان وجود داشته باشد، وجود، موجود است و هرجا و هرزمان وجود موجود باشد جهان وجود دارد. کلمه مترادف با وجود، هستی است، لذا میتوان گفت بر اساس تعریفی که از جهان داده شد، جهان و هستی هردو به یک معنی هستند. با این تعریف نه میتوان جایی غیر از جهان را در نظر گرفت و نه میتوان زمانی خارج از جهان را در نظر گرفت.

قدیم

چیزی قدیم است که وجود داشته باشد و هرگز آغاز به وجود نکرده باشد، یعنی همیشه وجود داشته باشد. چیزی که قدیم است تابع زمان نیست، یعنی در هر زمانی وجود داشته است. موجودی که قدیم است، هستی را در ذات خود دارد و بوجود آمدنی نیست.

حادث

چیزی است که وجود داشته باشد و آغاز به وجود کرده باشد، یعنی در لحظه ای وجود نداشته باشد و در لحظه دیگر بوجود آمده باشد. در زبان پارسی حادث را همچنین پدیده  مینامند. پدیده چیزی است که پدیدار شود یعنی در زمانی وجود نداشته باشد و در زمان دیگری بوجود آمده باشد. حادث هستی را در ذات خود ندارد و هستی در مورد آن اتفاق می افتد.

علت

علت اتفاقی است که انجام یافتن آن سبب تحقق معلول میشود. علت در واقع وجود دهنده معلول است و هستی را را به معلول میبخشد، علت و معلول لازمه یکدیگر هستند یعنی اگر علت وجود نداشته باشد، معلول نیز وجود نخواهد داشت. علت یک شیع نیست، بلکه یک اتفاق یا یک عمل است.

معلول

معلول اتفاقی (عملی) یا چیزی است که از خود (در ذات خود) هستی نداشته باشد، یعنی وجود خود را وابسته به چیز دیگری (علت) باشد، یعنی تنها و تنها اگر علت وجود داشته باشد معلول بوجود می آید و در غیاب علت هرگز معلول بوجود نمی آید. معلول لزوماً حادث نیست، ممکن است معلولی قدیم باشد و هستی خود را مدیون علتی که آن نیز قدیم است باشد.

علیت

رابطه موجود بین علت و معلول را علیت میخوانند. بین اینکه آیا علیت رابطه ای بین دو شیع است یا بین دو فعل (عمل یا اتفاق) است بین فلاسفه اختلاف نظر وجود دارد، علیت عمیق ترین و اساسی ترین رابطه ای است که میتواند بین دو چیز وجود داشته باشد زیرا هستی و نیستی آن چیز در گرو رابطه علیتی است که بین معلول و علت برقرار میشود.

آیا دنیا خلق شده است؟

با تعریفی که از دنیا داده شد، بسیاری از فلاسفه چه خداباور و چه بیخدا معتقدند جهان اساساً قدیم است و خلق نشده است. یعنی همواره وجود داشته است و آغاز بوجود نکرده است. دلایلی که این فلاسفه برای اثبات این ادعا می آورند بسیار متنوع است، البته قدیم بودن دنیا به خودی خود به معنی معلول نبودن آن نیست. برخی فلاسفه، چه خداباور چه بیخدا نیز معتقدند جهان آغاز به وجود کرده است و حادث و معلول است.  اگر دنیا خلق نشده باشد آشکار است که بر اساس توضیحات داده شده این پرسش اساسی که این نوشتار سعی در پاسخ آن دارد بطور کلی بی معنی خواهد بود و با تعریفی که از خلقت داده شد، دنیا خلق نشده است و نیاز به خالق نیز ندارد.

اما برخی از فلاسفه چه بیخدا و چه خداباور نیز معتقدند که جهان حادث است و قدیم نیست، و خلق شده است. تئوری بیگ بنگ (بیگ بنگ چیست؟) یا انفجار بزرگ امروزه معتبر ترین توضیح علمی برای تشریح چگونگی بوجود آمدن کائنات است. اما تئوری بیگ بنگ ثابت نمیکند که جهان برای وجود داشتن نیاز به علتی دارد. برای اطلاعات بیشتر در مورد اینکه چگونه جهان میتواند بدون وجود هیچ علتی خلق شده باشد به نوشتاری با فرنام «آغاز به وجود بدون نیاز به علت» مراجعه کنید. فیزیک مدرن و مدارک علمی نسبتاً جدید نشان میدهند که جهان میتواند بدون اینکه نیازی به علتی داشته باشد ناگهان بوجود بیاید. بسیاری از پدیده ها و اتفاقهای فیزیکی اساساً نیازی به علت ندارند و رابطه علیت در مورد آنها صدق نمیکند. این نوشتار بطور کامل این قضیه را نشان میدهد. لذا این نظر که «هر حادثی لزوماً معلول است و علتی دارد» زیر سوال است و مدارکی فیزیکی علیه آن وجود دارد. لذا حتی اگر با برهانهای صحیح و معتبر اثبات شود که دنیا بوجود آمده است و خلق شده است نیز هنوز اثبات نشده است که دنیا علتی دارد! لذا خلق شدن دنیا به معنی وجود خالقی برای آن نیست.

پیرامون تئوریهایی که برای آنچه باعث بیگ بنگ شده است به منابع زیر رجوع کنید.

  • تئوری رشته (String Theory) + + + + + + + + +
  • کائنات اکپیروتیکی (Ekpyrotic Universe) + + + + + +

و برای مناظره بین معروف ترین فلاسفه خداباور و بیخدا در مورد بیگ بنگ و خدا به کتاب خداباوری و خداناباوری و بیگ بنگ مراجعه کنید.

آیا انسان خلق شده است؟

پاسخ به این پرسش مربوط به رشته علمی بیولوژی است، خردگرایان بیولوژیست ها و انتروپولوژیست ها را شایسته ترین افراد برای پاسخ دادن به این پرسش میدانند. تئوری تکامل (تکامل چیست؟) قابل قبول ترین و معتبر ترین تئوری است که برای توضیح چگونگی رسیدن انسان به شکل فعلی خود وجود دارد، درصورت درست بودن این تکامل انسان خلق نشده است، تکامل و خلقت یک تئوری و یک فرضیه کاملاً مخالف یکدیگر در مورد موجودات زنده هستند. در مقابل تئوری تکامل دین داران «افسانه های خلقت» را مطرح میکنند و روی درستی این داستانها که در کتابهای دینیشان آمده است تعصب میورزند. این داستانهای مذهبی که اساساً ریشه در اساطیر سامی دارند و آن اساطیر نیز خود کپی برداری شده از سایر اساطیر ایرانی، مصری، هندی و غیره هستند معمولاً ماجرای خلقت را به یک زن و مرد اولیه منسوب میدانند و معتقدند آن دو مرد و زن توسط خدا بوجود آمده اند. در منطقه خاور میانه انواع و اقسام افسانه های خلقت حتی قبل از بوجود آمدن ادیان وجود داشته است و ریشه تمام این افسانه های خلقت در همان افسانه ها و اسطوره های باستانی است، برای شرحی کامل و تحقیقی علمی در این زمینه به کتابی با فرنام «افسانه های خلقت در خاورمیانه»  رجوع کنید.

افسانه خلقت یهودیان که ریشه در باورهای اسطوره ای خاور میانه ای دارد ابتدا آدم از خاک پدید آمد و بعد حوا از دنده چپ آدم بوجود آمد (انجیل به این مسئله اشاره دارد اما قرآن نمیگوید حوا از دنده چپ آدم بدنیا آمده است، اساساً در قرآن نامی از حوا نیامده است). و بعد این دو شخص از بهشت اخراج شدند. بین تمامی ملتها اینگونه داستانها رواج داشته اند و هرکدام برای بوجود آمدن انسان نظریاتی داشتند که هرگز بر شواهد و بررسی های علمی مبتنی نبوده اند بلکه صرفاً مبتنی بر داستان پردازی ها و اسطوره های باستانی آنها بوده است، برای نمونه های فراوان از این داستانها به کتابی با فرنام «افسانه های اولیه: افسانه های خلقت در اقصی  نقاط جهان» رجوع کنید. لذا ماجرای خلقت انسان با تعریفی که از خلقت داده شد اساساً غیر علمی و در نتیجه از نظر خردگرایان غیر معتبر است. اسلامگرایان در مورد سازگاری نظریه تکامل با قرآن نظرات مشترکی ندارند، عده ای روی غلط بودن این نظریه اسرار میورزند و دلایل(!)ی برای رد آن می آورند (هارون يحيي) و عده ای نیز میگویند تکامل اساساً در قرآن وجود دارد (فرقه رجویه و برخی از افرادی که خود را روشنفکر دینی میدانند) و داستان قرآن در مورد آدم و حوا به معنی  وجود اولین انسانها و ماجرای خلقت نیست. اما در قرآن بطور مستقیم در آیه ای اشاره شده است که آدم از خاک بوجود آمده است (سوره آل عمران آیه 59) و این آیه باعث میشود نظر قرآن کاملاً در تضاد با تئوری تکامل قرار بگیرد و در نتیجه نظری که قرآن راجع به خلقت انسان میزند کاملا ضد علمی و اسطوره ای و همردیف با تمام افسانه های خلقت است. لذا خلق شدن انسان از آنجا که غیر علمی است مورد توافق بین خردگرایان و اسلامگرایان نیست.

اسلامگرایان باید مدارک علمی را نشان دهند و تئوری تکامل را زیر سوال ببرند و ثابت کنند که انسان آنگونه که قرآن میگوید از خاک پدید آمده است و آدم و حوایی وجود داشته اند. البته قرآن در مورد خلقت انسانها دچار تناقض میشود قرآن درمورد انسان در جایی میگوید که او از لخته خون (سوره 96 آیات 1-2) پدید آمده است، در جای دیگر میگوید  از آب (سوره 21 آیه 30، سوره 24 آیه 45، سوره 25 آیه 54) پدید آمده است و در جایی میگوید از «چیزی مانند سفال» (سوره 3 آیه 59، سوره 30 آیه 20، سوره 35 آیه 11) پدید آمده است.

آیا کسی دنیا و جهان را خلق کرده است؟

خلق شدن کائنات هرگز به این معنی نیست که لزوماً کسی آنرا خلق کرده است. بسیاری از چیزها هستند که بدون نیاز به «کسی» خلق میشوند، مثلاً گیاهان وحشی بدون نیاز به «کسی» خلق میشوند. سیاره های جدید در کائنات بدون دخالت «کسی» خلق میشوند. هر چیزی که خلق میشود لزوماً نیاز به خالق ندارد. تمام تلاشهای خداباوران از اقامه براهین مختلف این است که ثابت کنند جهان معلول است و خدا علت آن است. حتی اگر تمامی براهین خداباوران را برای اثبات معلول بودن دنیا بدون در نظر گرفتن خطاهای براهین آنها قبول کنیم، به چه دلیل باید این علت خدا باشد؟ خدا  یک شخص (دارای شخصیت، بودن یعنی مختار و هوشمند بودن و زنده بودن) است که ویژگیهای خود را دارد. مثلا قادر مطلق است، همه جا حاضر است. چه دلیلی وجود دارد که «علت» جهان نیز این ویژگیها را داشته باشد؟

یعنی خداباور با ثابت کردن اینکه جهان معلول است و علتی دارد، وجود خدا را ثابت نکرده است، بلکه تنها وجود یک علت برای دنیا را ثابت کرده است، حال این علت میتواند هر چیزی باشد. یک علت مکانیکی و طبیعی مانند تمامی علتهای دیگر میتواند علت پدید آمدن دنیا باشد، در مورد اینکه علیت رابطه ای بین اتفاقها است یا بین افراد است اختلاف نظر وجود دارد، و در مورد اینکه آیا یک موجود غیر طبیعی میتواند معلول اتفاقات و چیزهای طبیعی شود خداباور با مشکلات و تناقضات بسیار مهمی روبرو میشود که توضیح دادن در مورد آنها در حوصله این نوشتار نیست. اما حتی اگر فرض کنیم علت میتواند در رابطه علیت یک شخص نیز باشد، به چه دلیلی باید این شخص خدا باشد؟

خداباور بعد از اینکه ثابت میکند دنیا علتی دارد، باید ثابت کند آن علت یک شخص است و بعد باید ثابت کند آن شخص خدا است، و ویژگیهای خدا را دارد. اثبات کردن چنین چیزی بسیار برای خداباوران دشوار خواهد بود. این برهان به همانقدر برای اثبات خدا به خداباور کمک میکند که شخصی ادعا کند دنیا توسط یک اسب شاخدار نامرئی، یا بابانوئل یا هر شخص دیگری خلق شده است. هیچ دلیل قانع کننده ای برای اثبات اینکه علت دنیا باید دارای شخصیت باشد و ویژگیهای خدا را داشته باشد وجود ندارد. خداباوران معمولاً برای اثبات این قضیه به برهان نظم پناه میبرند که خود برهان نظم خطاها و سفسطه های زیادی درون خود دارد و مشکلات آن در نوشتاری با فرنام «رد برهان نظم» بررسی شده است.

آیا خداوند میتواند خالق جهان باشد؟

کسانی که خداوند را علت بوجود آمدن دنیا میدانند از قدیمی ترین و ابتدائی ترین تئوریهای موجود برای علیت که به دوران ارسطو برمی گردد استفاده میکنند. این درحالی است که تئوریهای زیادی برای علیت بعد از ارسطو بوجود آمده است و فلاسفه بسیاری این تئوری را پیشرفت داده اند و تعاریف و شرایط دقیقی برای آن وضع کرده اند. برای ارسطو و کسانیکه پیروان او بوده اند و هستند کاملاً طبیعی و منطقی به نظر میرسد که بگویند خداوند علت جهان است، اما همانطور که علم پیشرفت کرده است فلسفه نیز پابه پای آن پیشرفت کرده است. دیدگاهی که امروز نسبت به تئوری علیت وجود دارد نسبت به دیدگاه ارسطو که 2400 سال پیش زندگی میکرده است بسیار متفاوت است و کسانیکه از آن رابطه علیت استفاده میکنند مانند این است که از دست آوردهای علمی آن دوران استفاده کنند. خدا با تعریفی که خداباوران از آن دارند (خداوند چیست؟) با تئوریهای جدیدتر از تئوری علیت ابداً سازگار نیست و اگر درستی این تئوری ها را قبول کنیم، خداوند هرگز نمیتواند علت پدید آمدن کائنات باشد، زیرا خداوند هرگز در تعریف علت نمیگنجد و لذا نمیتواند علت هیچ چیزی باشد. برای اطلاعات و توضیحات بیشتر در این مورد به نوشتاری با فرنام «علیت و محال بودن منطقی یک علت الهی» مراجعه کنید.

آیا شما بیشتر از همه مسلمانان میفهمید؟

این همه مسلمان و خداپرست در دنیا وجود دارد! آیا اینها همگی اشتباه میکنند و شما این وسط تنها عاقل و خردمند هستید و بقیه احمق هستند؟

 

پاسخ کوتاه:

این گفته مغلطه است هم حمله به آدم پوشالین است هم توسل به اکثریت یا محبوبیت است. یعنی نه ما معتقدیم از مخالفان خود بیشتر میدانیم نه اینکه باورمند بودن عده زیادی از آدمها به باوری باعث میشود آن باور درست باشد.

پاسخ بلند:

کاملا ممکن است که یک شخص درست بگوید و همه انسانهای دیگر اشتباه بگویند و کثرت برای هیچ باوری حقانیت نمی آورد. اصولا تعدد و تکثر افرادی که به اندیشه ای وابستگی دارند برای آن اندیشه حقانیت نمی آورد. متاسفانه بسیاری از عقاید و استدلالهایی که مسلمانان دارند مربوط به دوران وحشیگری اعراب زمان رسول الله است، بسیاری از این مفاهیم را میتوان در زندگی قبیله ای و بادیه نشینی ریشه یابی کرد. در میان گفتمان ناگهان یاد جنگ بدر می افتند و میگویند لشگر ما بیشتر است، ما میلیاردها نفر هستیم و شما یک نفر هستید! پس ما درست میگوییم و شما اشتباه میکنید! ما حق هستیم و شما باطل!!

این درحالی است که اگر تریلیونها نفر به چیزی غلط باور داشته باشند آن چیز همچنان غلط باقی خواهد ماند. بسیار در طول تاریخ پیش آمده است که تمامی مردمان یک چیز را باور داشتند و شخصی چیزی بر خلاف آن باور رایج را باور داشت. و از اتفاق همان یک شخص به چیز درستی باور داشته است و تمامی باقی مردمان به چیز غلطی باور داشتند.

برای نمونه مخترعین، مکتشفین و یا متفکرینی که نظریه نوینی میدهند،  اولین کسانی هستند که چیزی را اختراع یا کشف میکنند و تمامی انسانهای دیگر که همزمان با این افراد زندگی میکنند و نیز قبل از آنها میزیسته اند با این کشف و یا اختراع بیگانه هستند و حتی نظریاتی مخالف آن داشته اند، و الا نمیتوان به آن اشخاص مخترع یا مکتشف گفت! بنابر این تابحال در طول تاریخ به تعداد تمامی اختراعات و اکتشافات و نظریات علمی اتفاق افتاده است که تمامی انسانهای روی زمین خطا بکنند و یا نسبت به چیزی به اطلاع باشند و تنها یک شخص نسبت به آن چیز آگاهی درستی داشته باشد.

سفسطه ای که اسلامگرایان و یا خداباوران میکنند مانند آن است که شخصی مقابل مندلیف مبتکر جدول دوره ای عناصر باستد و بگوید، نادان! هیچکس نمیگوید عناصر را میتوان به این صورت که تو میگویی دسته بندی کرد! آیا همه اشتباه میکنند و تو کسی هستی که درست فکر میکنی؟! بقیه همه احمق هستند و تو فقط میفهمی؟

واقعیت این است که حوزه علم و فلسفه حوزه دموکراسی نیست. اینکه تمامی دانشمندان به چیزی اعتقاد داشته باشند یا تمامی فلاسفه چیزی را قبول داشته باشند لزوماً به آن معنی نیست که آن چیز درست است. تمامی فرضهای علمی و فلسفی و تمامی نتایج و احکام آنها باید بطور عینی و بدون توجه به تعداد باورمندان و موافقان آنها باید درست باشند.

بنابر این بعنوان افراد خردگرا، ما معتقد به این دلیل به نتایج علمی یک سری از دانشمندان و یا نتایج فلسفی یک عده از فلاسفه نیستیم چون آن فلاسفه در اکثریت هستند یا حتی اینکه آن فلاسفه و دانشمندان مورد تایید ما هستند. بلکه به آنچه آنها گفته اند باور داریم تنها و تنها به دلیل اینکه آن مفاهیم درست هستند. بعبارت دیگر اساساً برای یک انسان خردگرا مهم نیست که یک حرف را چه کسی زده است، بلکه تنها مسئله مهم این است که آیا له و یا علیه آن حرف و ایده شواهد و دلایل معتبر و صحیح وجود دارد یا نه، و صحت و حقانیت آن حرف و ایده از روی آن شواهد و دلایل است که روشن میشود نه از روی نام و اعتبار گوینده آن.

کسانیکه اشتباه میکنند احمق نیستند.

بسیاری از افرادی که تازه اسلام را کنار گذاشته اند و خردگرا و بیخدا شده اند گمان میکنند خداباوران و مسلمانان انسانهای احمقی هستند. ممکن است از لحاظ منطقی بتوان احمق را کسی دانست که به چیزی احمقانه اعتقاد داشته باشد، اما مسئله اینجاست که آنچه از نظر ما احمقانه است از نظر آن باورمندان احمقانه نیست. خداباوران و مسلمانان معمولاً به دلیل اینکه از آنچه خردگرایان و خداناباوران راجع به اسلام و خدا میدانند نا آگاه هستند به این مفاهیم گرایش دارند.

دانش در مورد دین و خدا خود نوعی علم است و طبیعی است که عده زیادی از این دانش و شناخت سکولار نسبت به دین و خدا آگاه نباشند. این افراد را نمیتوان احمق نامید. همانطور که هر شخصی قطعاً راجع به بسیاری از علوم که در تخصص و علاقه او نیستند نا آگاه است. نتیجه آنکه هر آنکس که به چیز غلطی اعتقاد دارد لزوماً احمق و خنگ نیست. در بیشتر از مواقع بی اطلاعی و خطا در استدلالها و سفسطه های متعدد است که باعث میشود افرادی به دین و خدا اعتقاد داشته باشند. بنابر این بیخدایان و خردگرایان باور ندارند که خداباوران احمق هستند و فرضی که در پرسش شده است فرضی غلط است.

البته آزمایشها و مطالعات علمی و آمار متعددی وجود دارند که نشان میدهند افرادی که از تواناییهای ذهنی کمتری برخوردار هستند و یا از هوش پایینتری برخوردار هستند تمایلات بیشتری نسبت به دین و خداباوری دارند. نمونه های متعددی از این مطالعات را میتوانید در نوشتاری با فرنام «رابطه مستقیم خداباوری با نادانی» بخوانید، این فرض تنها در صورتی درست است که انسانهای کم هوش را احمق بنامیم. و از آنجا که کم هوشی مسلماً به کسانی اطلاق خواهد شد که هوششان از میانگین هوش دیگران کمتر باشد، باید حداقل نیمی از جمعیت زمین را احمق خواند.

آیا همه مردمان دنیا باورمند به خدا هستند؟

متاسفانه افراد مذهبی چون معمولا در محیطی کاملا بسته زندگی میکنند و یا اجازه ارتباط با دنیای خارج را ندارند و یا جرات آنرا ندارند یا به دلیل اینکه تشنه دانش نیستند، و خود را دست یافته به حقیقت مطلق میدانند نیازی برای افزودن به دانسته های خود احساس نمیکنند. بنابر این بدون مشاهده و ارائه آمار معتبر همه دنیا را همفکر خود میدانند و بدون اینکه بدانند در دنیا چه میگذرد، برای خود فکر میکنند همه دنیا خداپرست هستند و همه دنیا عاشق ما مسلمانان هستند مگر یک عده اسرائیلی و امریکایی خبیث! این افراد چون عمه و خاله و دایی و خواهر و برادر خود را همفکر با خود میدانند و آنها را نیز مسلمان فرض میکنند، فکر میکنند کل جامعه بشری در دنیا موافق با آنها هست و مانند عمه و خاله آنها فکر میکنند و شخص خداناباور تنها 1 نفر است که به حرف جدیدی رسیده است! اما واقعیت این است که دنیا از خانواده و کوچه و محله و شهر و استان و کشور این افراد بسیار بزرگتر است! در دنیای امروز جمعیت زیادی از مردم، بی خدا، بی دین، شک گرا، ملحد، کافر و مشرک هستند! نه تنها امروز در دنیا تعداد قابل توجهی از این افراد وجود دارد و بعد از مسیحیت، اسلام و هندوئیسم، بی خدایی بالاترین میزان جمعیت را در جهان دارد و در بسیاری از کشورهای جهان میزان خرد و شعور بشری جایگاه دین را همچون جایگاه دخانیات محدود به مکانهای مشخصی میدانند بلکه از همه مهمتر اینکه رشد بی دینی در تمام دنیا در تمام کشورها و در تمام ادیان سریعتر از رشد هر نوع دینی است! برای بدست آوردن آماری از بیخدایی به «آمار بیخدایی» سری بزنید! از اینها گذشته بودایی ها حدود 2500 سال قدمت دارند و به هیچ عنوان به هیچ نوع خدایی اعتقاد ندارند، بودایی ها اکثریت مردم ژاپن، چین، برمه و سایر کشورهای آسیایی را تشکیل میدهند. بودائی ها همچون آئتئیست ها وجود پدیده ای به نام خدا را خرافی و باطل میدانند. (1) همچنین ادیان چینی همچون تائوئیسم و کنفسیوسیم نیز کاملاً بیخدا هستند و وجود هر نوع خدایی را انکار میکنند. خداناباوری و خردگرایی از حیث قدمت نیز سنتی بسیار بسیار کهنتر از ادیان جدیدی مانند اسلام و مسیحیت هستند.

مورد دومی که در این استدلال باید به آن پرداخت این است که چطور دینداران به خود اجازه میدهند خود را جزو یک دسته کلی بدانند؟ در دنیا بزرگترین جامعه دینی جامعه مسیحیت است. مسیحیان به محمد به عنوان یک فرد دروغگو و جنایتکار نگاه میکنند و برخی از مسیحیان معتقدند محمد از شیطان وحی میگرفته است و اسلام دینی است ساخته شیطان برای گمراه کرده مردم از راه مسیح (2). از آنجا که مسیحیان اعتقاد دارند عیسی پسر خداوند است و انجیل کتاب مقدسشان میگوید من (عیسی) و پدر (خدا) یکی هستیم و قرآن به شدت با این قضیه مخالف است (سوره توبه آیات 28 تا 30) اسلام تمامی مسیحیان امروز را مشرک میداند (ممکن است  مسلمانانی که سواد ندارند و زحمت خواندن تازینامه را به خود نداده اند یا میخواهند از اصول اسلام دست بردارند و به اتحادیه اروپا یا سایر اتحادیه های بشری بپیوندند این واقعیت را انکار کنند)، بنابر اصول اسلامی تمامی مسیحیان این دوران را نجس و مشرک میدانند یا حداقل باید بدانند اگر تقیه نکنند! نه مسیحیان خدای مسلمانان را قبول دارند نه مسلمانان خدای مسیحیان را. مسیحیان خدای مسلمانان را دروغین میدانند و مسلمانان خدای سه گانه مسیحیان را شرکی آشکار.

بنابر این مسلمانان و مسیحیان و اگر به همین روال به قضیه نگاه کنیم هیچکدام از دین باوران به خدای ادیان دیگر بگونه ای که باورمندان آن ادیان به خدایانشان اعتقاد دارند، باورمند نیستند. در واقع هر خداباوری تنها یک خدا را قبول دارد و تمامی خدایان دیگر را دروغین دانسته و وجودشان را انکار میکند. مثلاً مسلمانان وجود اهوره مزدا، زئوس، زحل، کریشنا و مسیح (بعنوان خدا) را انکار میکنند و تنها به یک خدا یعنی الله اعتقاد دارند. در میان تمامی ملتها و فرهنگهای دنیا در حدود 2700 خدای مختلف در اذهان مردم وجود داشته است (3). اگر این تعداد را دقیق فرض کنیم هر خداباوری نسبت به 2699 خدا کاملا «خداناباور» است و تنها نسبت به یکی از این 2700 خدا باورمند است. کدام مسلمانی میتواند بطور جدی لحظه ای به این فکر کند که به زئوس خدای یونان باستان و خانواده اش اعتقاد داشته باشد؟ خدایان یونان، روم، مصر و ایران باستان در باور خداباوران امروزی مسخره هستند، و در باور خداناباوران خدایان مدرن همچون الله نیز به همان میزان مضحک و مسخره هستند. بنابر این خداناباوران و خداباوران همیشه در مورد اینکه 2699 خدای موجود در تاریخ و اذهان مردمان جهان دروغین و باطل هستند توافق نظر دارند و تنها در مورد یک خدا است که با هم اختلاف نظر دارند. آشکار است که خداباوران نمیتوانند خود را با سایر خداباوران همدسته و همفکر بدانند زیرا به چیزهای مشترکی معتقد نیستند. تفاوت میان خدایان ادیان مختلف مثلا یهودیت و مسیحیت و اسلام تنها در نامشان نیست. این خدایان در ماهیت بسیار با یکدیگر متفاوتند. بعنوان مثال خدای یهودیت بر روی زمین راه میرود و میدود و حتی کشتی میگیرد. خدای مسیحیت به شکل انسان تجسد پیدا میکند و برای بخشیده شدن گناهان انسانها از انسانها کتک میخورد. خدای اسلام نیز آنورتر از آسمان هفتم بر روی عرش یا تخت الهی اش نشسته است و در روز قیامت فرشته هایی او را حمل خواهند کرد.

از ادیان که بگذریم در فرقه ها و مذاهب موجود در ادیان نیز تفاوتهای بسیاری وجود دارد، مثلا اهل تسنن جمعیت بسیار بیشتری از شیعیان دارند و تشیع را انحرافی در اسلام و ساخته شده توسط فردی یهودی (4) میدانند و معتقدند تشیع مرده پرستی و شخص پرستی و  مکان پرستی و در نتیجه شرک و بت پرستی است اهل تسنن به هیچ وجه زیر بار زیارت اماکن مقدس شیعی نمیروند، زیارت امام حسین و امام رضا رفتن و کمک و یاری خواستن از امامان و مقدسین را شرک مطلق و نابخشودنی میدانند! بنابر این اهل تسنن نیز اهل تشیع را قبول ندارند! تشیعیان نیز اهل تسنن را منحرف و نادان میدانند چون در تاریخ اسلام با آنها اختلاف دارند و دو اصل امامت و عدل را از اصول دیگر اسلام میدانند. شیعیان معتقدند عمر فاطمه دختر پیامبر و همسر امام علی را کشته است و سنی ها این را انکار میکنند. شیعیان معتقدند علی قرار بوده است جانشین محمد شود و سنی ها میگویند چنین قراری نبوده است و ابوبکر شایسته ترین فرد بعد از محمد بوده است.

در میان شیعیان نیز اکثر شیعیان به دین سیاسی اعتقاد ندارند و برای آخوندها و عمامه به سر ها و حکومتشان به مبلغ دو شاهی ارزش و اعتبار قائل نیستند و این افراد را شیاد و دروغین میدانند! تنها عده بسیار اندکی هستند که عکس خمینی را در ماه میبینند و دفتر ولی فقیه را دفتر نمایندگی بارگاه الهی بر روی زمین میدانند و سید علی خامه ای را ولی امر مسلمین جهان! این اختلافات تا جایی پیش میرود که این مذاهب همدیگر را تکفیر میکنند و گاهی حکم به قتل یکدیگر داده اند و جنگها در طول تاریخ میانشان وجود داشته است.

شاید لازم به ذکر نباشد که مسلمانان علیه مسیحیان جهاد میکنند و آنها را تکه تکه میکنند و مسیحیان نیز علیه مسلمانان جنگهای صلیبی کرده اند و آنها را تکه تکه کرده اند و شیعیان به مقدسات اهل تسنن بسیار توهین میکنند «مراسم عمر کشان» و آنها را در مواقع ضروری میکشند  و سنی ها نیز در کشورهایی مثل پاکستان و عراق هر چند وقت یکبار چند شیعه ای را به رگبار میبندند یا الله اکبر میگویند و در جمعیت خودشان را منفجر میکنند. و سعی میکنند دشمنی خود را نشان ندهند اما در واقع تشنه به خون یکدیگر هستند. همچنین لازم به ذکر نیست که دسته ای از آدمهای مذهبی که در جامعه شیعی ایران وجود دارند به شدت مورد تنفر و تمسخر قرار دارند و به آدمهای عقده ای و روانی و دیوانه مشهور هستند و مردم برای آنها جوک درست میکنند به «مجموعه جوکهای اسلامی» نیز سری بزنید.

بنابر این اگر یک دیندار این سفسطه را میکند، در نظر داشته باشید که

  • اکثریت و یا اقلیت برای یک ایده حقانیت نمی آورد.
  • شما تنها نیستید و 800 میلیون آدم دیگر همفکر با شما هستند
  • طرف مقابل شما تمامی مردم خداپرست جهان را نمایندگی نمیکند و 99 درصد مردم خداپرست دنیا از طرف مقابل شما بیزار هستند و اورا احمق میدانند!

نکته آخر اینکه اگر این افراد به حرف خود اعتقاد دارند، نباید شیعه باشند! چون تعداد سنی ها چندین برابر شیعیان است! اگر بازهم به حرف خود اعتقاد دارند نباید مسلمان باشید! چون تعداد مسیحیان بیشتر از تعداد مسلمانان است! و چقدر نابخردانه است اگر شخصی تنها به دلیل اینکه اندیشه ای طرفداران بیشتری دارد از هواداران آن اندیشه باشد، نان به نرخ روز بخورد.

چرا بسیاری از مردم به دین گرایش پیدا میکنند؟

این پرسش پاسخ ساده ای ندارد و موضوع بسیار گسترده ای است که هم میتوان آنرا در بعد شخصی از دیدگاه روانشناسی پاسخ داد و هم میتوان در بعد اجتماعی از دیدگاه جامعه شناسی به آن پرداخت. از آنجا که پرداختن به این پرسش از حوصله این نوشتار خارج است تنها بگونه ای بسیار خلاصه چند دلیل را بر خواهیم شمرد.

1- بسیاری از انسانها درست فکر کردن را بلد نیستند. آنها معمولاً چیزهایی را قبول میکنند که «دوست دارند» و چیزهایی را که «دوست ندارند» قبول نمیکنند. برای افرادی که درست فکر کردن را بلد نیستند «درست بودن» مفاهیم ارزشی ندارد، و هرگاه تمایلات آنها با عقلانیتشان در تناقض باشد، تمایلاتشان پیروز خواهد شد. این افراد درصورتیکه خردگرا (خردگرایی چیست؟) شوند دین را کنار خواهند گذاشت.

2- دین یک صنعت بسیار بزرگ و گسترده است و میلیاردها دلار در سال خرج حفاظت از این صنعت بزرگ میشود. دین فروختن و تبلیغ دین حرفه و شغل افرادی است و این افراد همچون هر صاحب حرفه دیگری در جلب مشتریان خود میکوشند و برای آن تبلیغ میکنند. دین ابزار خوبی برای تحمیق مردم است و افراد زیادی بر حماقت مردم حکمرانی میکنند. این افراد با هر وسیله که بتوانند دین را تبلیغ میکنند و دشمنان دین را به هر وسیله که باشد یا نابود میکند یا خفه میکنند. قطعاً اگر برای هر چیزی آنقدر که برای دین تبلیغ میشود تبلیغ میشد آن چیز به اندازه دین رایج و محبوب میشد.

3- انسانها از آنچه واقعا باعث مسائل میشود نا آگاه هستند و همین نا آگاهی باعث میشود موجودات غیبی و ناپیدا را علت مسائلی که اطرافشان اتفاق می افتد بدانند. این درست همان چیزی است که باعث شده است انسانهای بدوی خدا را خلق کنند و انسانهایی که همانند آن انسانهای بدوی فکر و حتی زندگی میکنند نیز به دلایل بسیار مشابهی هنوز خداباور و دیندار هستند. (10)

4- دین با احساسات افراد در آمیخته است، خداباوران از ترس جهنم رفتن و یا به طمع به بهشت رفتن حتی از  بررسی افکار دینی خودشان هراسانند چه برسد که بخواهند آنها را نعوذ بالله بررسی کنند و در حقانیت آنها شک کنند.

5- دین قسمتی از هویت فردی برخی از افراد میشود و افراد بدون هیچ دلیل و شواهد معتبری آنرا از محیط خود کسب میکنند. (11) افراد معمولاً در مورد اخباری که میشنوند موشکافانه و شکگرایانه برخورد میکنند اما در مورد مفاهیم دینی آنچنان خنگ میشوند که تو گویی مغزشان فلج شده است.

چرا دانشمندان و فلاسفه بسیاری به وجود خدا اعتقاد داشته اند؟

براستی نمیتوان یک دلیل را برای تمامی دانشمندان و فلاسفه برشمرد، هرکدام از فلاسفه و دانشمندان به دلیل و یا دلایل خاصی به خدا اعتقاد داشته اند و تمامی این دلایل اشتباه هستند. تارنمای زندیق در بخشی با فرنام «رد براهین اثبات وجود خدا» به رد تمامی این دلایل پرداخته است، و اگر دلایل جدیدی ارائه شود، در صورتیکه در آن دلایل سفسطه و یا فرضهای غلط وجود داشته باشد به رد آنها نیز خواهد پرداخت.

باید توجه کرد که مسئله وجود یا عدم وجود خدا یک بحث فلسفی است و هیچ ارتباطی با علم  (5)ندارد. خداوند به دلیل فرا طبیعی بودن خود نمیتواند یک فرضیه علمی باشد زیرا علم چیزی به نام فراطبیعی (Supernatural) را به رسمیت نمیشناسد. خداباوران اصرار دارند بگویند حوزه علم محدود به واقعیت های طبیعت است و به واقعیت روحانی از حوزه علم خارج است، اما واقعیت این است که علم وجود چیزهای فراطبیعی را به این دلیل به رسمیت نمیشناسد که کوچکترین مدرک و شواهدی برای وجود چنین چیزی موجود نمیباشد. در واقع چیزهای فراطبیعی تماماً ساخته ذهن و تخیل انسانها است و حقیقتی ندارد. موسسه هایی مانند موسسه جیمز رندی سالها تمامی ادعاهای مربوط به وجود چیزهای فراطبیعی را بررسی کرده اند اما هرگز به شواهد معتبری دست نیافته اند. موسسه جیمز رندی مبلغ یک میلیون دلار جایزه را به کسی که بتواند وجود هر پدیده غیر طبیعی و فرا طبیعی را نشان بدهد و در شرایط آزمایشگاهی ثابت کند پاداش خواهد داد. برای اطلاعات بیشتر به نوشتاری با فرنام «جایزه یک میلیون دلاری موسسه جیمز رندی» مراجعه کنید. نتیجه آنکه مسئله وجود یا عدم وجود خدا در تخصص دانشمندان نیست.

مسئله وجود خدا مربوط به فلسفه و بطور مشخص مربوط به شاخه فلسفه دین از فلسفه است. البته ممکن است در علم مسائلی مطرح شود که فلاسفه دین (6) علاقه مند شوند ممکن بودن پدیده خدا را با آن بسنجند. مثلا در کیهان شناسی قضیه بیگ بنگ (7) و در بیولوژی قضیه تکامل و مسائل بسیار متعدد ریاضی که با فلسفه دین پیوند میخورند، مثلاً تئوری مجموعه ها و تعریف جورج کانتور از مجموعه بینهایت. اما این باعث نمیشود که دانشمندان مستقیماً به پدیده خدا بپردازند. همچنین ممکن است دانشمندانی از روی فقر فلسفیشان نظم و پیچیدگی موجود در کشفیات خود را به وجود خدا نسبت بدهند. مثلاً نیوتون از این دسته افراد بوده است (برای جزئیات بیشتر پیرامون خداباوری نیوتون به نوشتاری با فرنام نیوتون و خداباوری او مراجعه کنید). برخی وجود نظم در طبیعت را اثباتی برای وجود خدا دانسته اند که بی اساس و غلط بودن این استدلال را در نوشتاری با فرنام «برهان نظم» نشان داده ایم. برخی از دانشمندان دلایل شخصی و غلط ویژه خود را داشته اند مثلا پاسکال برای وجود خدا استدلالی آورده است که به «شرط پاسکال» معروف است(برای جزئیات بیشتر از خداباوری پاسکال و ایرادات وارد بر آن به نوشتاری با فرنام شرح سفسطه اگر آخرتی باشد شما ضرر کرده اید ما ضرر نکرده ایم اگر نباشد باز هم ما ضرر نکرده ایم مطالعه کنید). افرادی مانند انیشتن اساساً خداباور نبوده و خداباوران به خطا آنان را خداباور می انگارند (برای جزئیات به نوشتاری با فرنام انیشتن و خدای او مراجعه کنید).

اگر دانشمندی در یک کتاب علمی و دانشگاهی خداوند را وارد علوم خود کند، مثلاً در کتاب بیولوژی بنویسد که خداوند انسانها را خلق کرده است، و یا در کتاب مکانیک بنویسد که اگر نیرویی به جسم متحرک وارد شود انشاءالله از حرکت خواهد ایستاد، این نظر او ارزش و اعتبار علمی نخواهد داشت و باقی دانشمندان بعنوان دیوانه به او نگاه خواهند کرد. از همین رو است که در هیچ کتاب علمی (مثلاً کتابهایی که در دانشگاه ها تدریس میشوند) هیچ اثری از خدا نیست. خدا از دیدگاه علمی یک پدیده تخیلی همانند لولوخورخوره و سوپر من است. لذا اگر دانشمندی در مورد خدا اظهار نظر کند همانند این است که باقالی فروشی در مورد فیزیک کوانتومی نظر بدهد، یا یک فیزیکدان متخصص در زمینه فیزیک کوانتوم در مورد اینکه باقالی را چگونه باید پخت و در کجا باید ایستاد تا فروش بیشتری داشته باشد نظر بدهد. البته این به این معنی نیست که نظر یک باقالی فروش راجع به فیزیک کوانتوم و نظر یک دانشمند در مورد خدا بی اعتبار است و تنها فلاسفه دین حق دارند که در مورد پدیده خدا نظر بدهند. بلکه به این معنی است که از آنجا که پدیده خدا در حوزه دین علم مطرح نیست، باید احتمال آنرا داد که از آنجا که اکثر مردم خداباور هستند و به نوعی خدا اعتقاد دارند، و از آنجا که این دانشمندان نیز برخاسته از همان مردم هستند و تخصص ویژه ای در مورد قضیه خدا ندارند و اطلاعاتشان معمولاً در مورد دین و خداوند همانقدر است که اطلاعات مردم عادی است، باورهای دینی اکثر آنها همچون باورهای دینی اکثر مردم باشد. نتیجه آنکه باید انتظار داشت اکثر دانشمندان نیز مانند اکثر مردم به وجود خدا اعتقاد داشته باشند.

اما شگفت آور است که آمار چیزی بر خلاف این انتظار را نشان میدهند. در کشور آمریکا 90% مردم به وجود خدا و حیات پس از مرگ اعتقاد دارند و تنها 10 درصد مردم وجود خدا را انکار میکنند. این درحالی است که تنها 40% از کسانیکه تحصیلات لیسانس در یکی از رشته های علمی دارند، به این دو موضوع اعتقاد دارند، و تنها 10% از کسانیکه دانشمندان برجسته به شمار می آیند به خدا و زندگی پس از مرگ باورمندند. و همچنین میان اعضای از میان اعضای آکادمی ملی دانشمندان امریکا، 72% بیخدا (آتئیسم، بیخدایی، الحاد چیست؟) 21 درصد ندانمگرا (اگناستیسزم، چیست؟) و تنها 7% معتقد به یک خدای دارای شخصیت (8) هستند. (9).

جالب است که در میان فلاسفه ای که در 300 سال گذشته زندگی میکرده اند نیز برجسته ترین نامها بیخدا هستند. براستی برابر با فلاسفه بیخدایی همچون، آرتور شوپنهاور، توماس هابس، مارتین هیدگر، دیوید هیوم، آلبرت کاموس، فرانز کافکا، سر آلفرد جولیوس آیر، بوکونین میخائیل ،چارلز برادلف ، ردلف کارناپ، ویلیام ک کلیفورد، آگوسته کمته، دارو کلارنس، جان دوی، الیس آلبرت، جورج ویلیام، زیگموند فروید، لودوینگ آندریاس فوئرباخ، گیبون ادوارد، اما گلدمن، هلدمن جولیس امانوئل، هوباخ پاول هنری، جورج جاکوب (یعقوب)، هوک سیدنی، توماس هنری، یگرسول روبرت گرین، لوئیس جوزف، کارل مارکس، مک کاب جوزف مارتین، فردریش نیچه، منکن هنری لوئیس، توماس پین، آین رند، جان مکینون رابرتسون، برترند راسل، کارل سایگن، مارگارت سانگر، ژان (شاان) پاول سارتر، که تغییر شگرفی در فلسفه ایجاد کرده اند و برخی از آنها پدر علوم جدیدی بودند و علومی را پایه گذاری کرده اند تنها میتوان تعداد اندکی فیلسوف همچون امانوئل کانت را برشمرد که به خدا اعتقاد داشته اند، اکثر فلاسفه در 300 سال گذشته نسبت به خدا حالت انکار داشته اند و دین را آفتی بزرگ برای بشریت و ترمز تمدن میدانسته اند.

اما در گذشته اینچنین نبوده است، پیشرفت علم پیشرفت بیخدایی را نیز به همراه داشته است، البته ممکن است این پیشرفت بیخدایی و کمرنگ شدن نفوذ دین در زندگی و اجتماع و قانون و کوتاه شدن دست آن از علم بوده باشد که موجب پیشرفت علم شده باشد اما به هرحال بدون شک در گذشته خداباوری باور مرسوم تری بوده است. قدما را نباید بخاطر خداباوری و یا حتی اسلامشان توبیخ کرد و از دست آنها عصبانی بود. از هر انسانی در حد شعور و هوش او و اطلاعاتی که در اطراف او وجود داشته است و او میتوانسته است آنها را کسب کند انتظار داشت. یک دانشجوی سال اول رشته فلسفه اطلاعات فلسفی اش ده ها برابر بیشتر از اطلاعات سقراط و افلاطون و ارسطو است.

بنابر این علی رغم اینکه اگر تمامی فلاسفه و دانشمندان نیز یک حرف را بزنند بازهم این مسئله به خودی خود دلیل بر درستی آن حرف نیست، تعداد دانشمندان و فلاسفه بیخدا در صورتیکه در اکثریت بودن جمعیت خداباوران را در نظر بگیریم بسیار بسیار شگفت انگیز است و آشکار میسازد که خداباوری بیشتر به طبقه ای از اجتماع بشری تعلق دارد که از دانش و فلسفه بیشتر محروم است. رابطه میان باورهای دینی و میزان دانش رابطه ای معکوس است. هرچقدر امکانات آموزشی و فکری کمتر باشد باورهای دینی قوی تر و هرچقدر علم و دانش قوی تر باشد باورهای دینی ضعیفتر و کمتر خواهد بود.

نتیجه گیری:

نتیجه آنکه چه 2 نفر به ایده ای اعتقاد داشته باشند چه 20 میلیون نفر و چه 1.5 میلیارد نفر، آن عقیده همچنان میتواند اشتباه و زشت باشد! عرصه علم و گفتمان عرصه دموکراسی نیست! هیچ وقت در بررسی علوم نمی آیند و بگویند چون 10 تا فیزیک دان به این اعتقاد دارند که ذرات بی انتها هستند و 20 تا فیزیک دان به این اعتقاد دارند که ذرات بی نهایت نیستند، پس فیزیک میگوید ذرات بی نهایت هستند! در گفتمان و بحث علمی و فلسفی در مورد اسلام و خدا نیز استفاده از این سفسطه، نوعی لگد پرانی و فرار از بحث است! به افرادی که چنین حرفی میزنند بگویید چرا وقتی بیمار میشوند پیش دکتر میروند؟ چرا بیماریشان را از طریق دموکراسی حل نمیکنند؟ از 20  نفر از آشنایانشان بپرسند بیماریشان چی هست و از روی نظر آنها به تیمار بپردازند.

توضیحات:

1) روحانیون بودیست در کتاب پرسش های خوب برای پاسخ های خوب در مورد این مسئله توضیحات کافی داده اند.

2) سایت مسیحی پیامبر آور مرگ یک نمونه از این نوع باور مسیحیان به اسلام است.

3) تارنمایی با نام آزمایشگر خدا لیستی از این 2700 خدا و مشخصات آنها ارائه میکند.

4) بسیاری از اهل تسنن معتقدند شخصی یهودی با نام عبدالله ابن سبا برای فتنه جویی تشیع را پایه گذاری کرده است و شیعیان حتی وجود چنین شخصی را انکار میکنند، بحث مفصلی در این مورد را در اینجا و اینجا بخوانید.

5) در این نوشتار منظور از کلمه علم همان (Science) و منظور از دانشمند (Scientist) است نه دانش و یا کسی که چیزی را میداند.

6) منظور از فلاسفه دین، دینداران فیلسوف نیست، بسیاری از کسانیکه متخصص در رشته فلسفه دین هستند خود باورمند به دین نیستند و اغلب کسانیکه در فلسفه دین باعث تحول شده اند خود دیندار نبوده اند.

7) یک اثر بسیار درخشان در مورد بیگ بنگ و وجود خدا، کتابی است که بصورت مناظره میان دو تن از بزرگترین فلاسفه خداباور و خداناباور زمان حال توسط دانشگاه آکسفورد منتشر شده است. نام این کتاب «Big Bang Cosmology, Atheism and Theism» است و یک نوشتار از نوشتارهای آنرا میتوانید در نوشتاری با فرنام «آغاز بی علت جهان» به زبان فارسی بخوانید.

8) منظور از خدای دارای شخصیت، خدایی است زنده که دارای شعور و اراده است.

9) منابع این آمار را در نوشتاری با فرنام «رابطه مستقیم خداباوری با نادانی» بیابید.

10) نوشتار جالبی در این زمینه توسط دکتر احمد ایرانی با فرنام «نظرهای علمی درباره دین، پیدایش و تکامل دین» نوشته شده است که نحوه شکل گیری دین را توضیح میدهد، و خواندن آن توصیه میشود.

11) دکتر ریچارد داوکینز در همین زمینه نوشتاری با فرنام «دلایل خوب و بد برای باورمند بودن» بودن دارد که خواندن آن توصیه میشود.

جایگزین شما برای اسلام چیست؟

نویسنده – آرش بیخدا

این سوال یکی از سوالهای رایجی است که در ذهن بسیاری از مسلمانانی که عقاید ضد اسلامی را میشنوند شکل میگیرد.

پاسخ:

قبل از پاسخ به این سوال، ابتدا باید مسئله ای را روشن کنیم. بطور کلی برای اعتراض کردن به یک مفهوم غلط نیازی به معرفی آلترناتیو و جایگزین وجود ندارد. شما برای اینکه بعنوان مثال بگویید نگهداری فیل در خانه کار غلطی است نباید حتما حیواناتی را که نگهداری آنها در خانه مناسب است را معرفی کنید. روشن شدن این مطلب از این دیدگاه لازم است که بعضی از اسلامگرایان ادعا میکنند که منتقدین اسلام باید قبل از نقد اسلام، جایگزینی برای آن معرفی کنند، و این  ادعا به دلیلی که گفته شد غلط است و چنین بایدی وجود ندارد.

اگر بخواهیم به این سوال پاسخ دهیم ابتدا باید ببینیم اسلام واقعا چه هست؟ اسلام در واقع مجموعه ای از مفاهیم است که در حوزه های مختلف مطرح میشوند. از این گذشته اسلام عبارت است از اعتقاد داشتن به یک سری موجودات و وجودات خیالی از جمله خدا.

در مورد مفاهیم مختلف میتوان جایگزین هایی را معرفی کرد اما در مورد موجودات و وجودات آیا میتوان جایگزینی معرفی کرد؟

همانگونه که در بین مسلمانان اعتقاد به جن وجود دارد، تا جایی که حتی در قرآن سوره ای به نام جن وجود دارد و ابلیس از اجنه بوده است و خیلی ها ادعا میکنند که جن دیده اند، یا با اجنه رابطه برقرار میکنند، در مغرب زمین و در میان سایر ملتهای مختلف نیز جانوران خیالی ای وجود دارند. بعنوان مثال در غرب موجودی به نام خون آشام (Vampire). برای مشرقیها خون آشام یک موجود خیالی و سینمایی است اما انسانهایی در حد شعور همان مشرقیها که ادعا میکنند جن دیده اند، در غرب نیز ادعا میکنند که خون آشام دیده اند. خون آشام ها در واقع انسانهایی هستند که در دوران حیات خود روح پلیدی داشته اند و به دلایلی از قبر بر میخیزند و خون انسانهای زنده را میخورند و آن انسانهای زنده نیز خود بعدا به خون آشام تبدیل میشوند. باید دانست که خرافات مسئله ای محلی است یعنی از منطقه جغرافیایی تا منطقه ای دیگر متفاوت است.

حال فرض کنید به کسی که برای سالها به وجود موجودی به نام خون آشام اعتقاد داشته اثبات کنیم که چنین وجودی نمیتواند وجود داشته باشد و هرگز وجود نداشته و تنها یک موجود افسانه ای و خیالی است که عده ای از انسانها آنرا ساخته و پرداخته اند. در مورد قضیه خدا (خداوند چیست؟) نیز مسئله کاملا همینگونه است، حال سوالی که خداپرست ممکن است بپرسد، یعنی «جایگزین شما برای خدا چیست؟» مثل این است که آن انسانی که به وجود خون آشام اعتقاد داشته بپرسد «خوب جایگزین شما برای خون آشام چیست؟». این سوال را میتوان به این گونه تفسیر کرد، اگر خون آشامی وجود ندارد که خون انسانها را بمکد پس چه کسی خون انسانها را میمکد؟  پر واضح است که این سوال به دلیل اینکه فرض مکیده شدن خون انسانها توسط کسی را در خود دارد یک سوال غلط است و در واقع جایگزینی برای خون آشام وجود ندارد، چون ماهیت خون آشام جایگزین پذیر نیست!

در مورد خدا و جانوران کبریایی (مثل جن و فرشته و ابلیس و امام زمان…) نیز مسئله کاملا مشابه همین مثال است، خدا وجود ندارد و جایگزینی برای او نیز وجود ندارد (از کجا میدانید خدا وجود ندارد؟). اما این سوال که «پس اگر خدا وجود ندارد پس خالق دنیا و هستی کیست؟» یک سوال خوب است که میتوان به آن پاسخ داد (پاسخ را در نوشتاری با فرنام از کجا میدانید خدا وجود ندارد؟  بخوانید).

بعد از اشاره به موجودات اسلامی که البته چندان نیز اسلامی نیستند و از سایر ادیان و اندیشه ها به عاریت گرفته شده اند بپردازیم. اسلام را میتوان در چندین حوزه مورد بررسی قرار داد. بطور کلی به نظر میرسد اسلام در عرصه های، نظام فکری، نظام سیاسی، نظام اقتصادی، نظام قضایی، نظام اخلاقی، نظام متافیزیکی، و نظام پزشکی و موضوعات دیگری همچون تسلای دینی، هدمندی زندگی و غیره مطرح کرد.

نظام فکری:

گویا نظام فکری ای که اسلام معرفی میکند مبتنی بر ایمان (ایمان چیست؟) و اتفاقات غیر عادی و تقلید و اینگونه مسائل است، بجای نظام فکری اسلامی که مسلمانان از آن رنج میبرند، خردگرایی (خردگرایی چیست؟) و عرفی گرایی را میتوان بهترین نظام و روش فکر کردن دانست.

تسلای روانی:

خبری که برای خداباوران در واقع خبر بسیار خوبی است این است که در تمام آن زمانهایی که فکر میکردید با خدا راز و نیاز میکردید و با او سخن میگفتید و او به شما پاسخ میداد، این در واقع خود شما بودید که با خودتان صحبت میکردید، بنابر این پس از بیخدایی نیز همچنان میتوانید به این گفتگو ادامه بدهید. شما میتوانید از طریق مدیتیشن تا حدود زیادی به آرامش روانی دست یابید، آنهم رایگان و بدون خرافات.

توصل و کمک از خدا:

برخی میپرسند اگر خدایی وجود نداشته باشد ما باید از چه کسی کمک بگیریم؟ خداباور شبیه شخصی است که عمیقا فکر میکند یک برادر بزرگتر دارد که در سختی ها به کمک او میرسد، اما مشکل اینجاست که این شخص برادری ندارد. همه آدمها چه خداباور چه بیخدا برای حل مشکلاتشان بر خود و دیگران تکیه میکنند. خداباوران تنها به خطا فکر میکنند خدا این وسط کاری کرده است. بنابر این، اینجا نیز نیاز به معرفی جایگزین نیست. مگر این توصیه که مشکلات دو دسته اند آنهایی که حل شدنی هستند که انسان با دانش و مهارت و همیاری و همت خود میتواند آنها را حل کند، که باید چنین کند و یا مشکلاتی که حل نمیشوند و باید آموخت که با آنها کنار آمد و آثار منفی آنها را حداقلی کرد.

پیشارویی با سختی ها:

از جانب خدا به دلیل اینکه خدایی وجود ندارد به کسی در مواقع سختی کمک رسانده نمیشود، برخی از روی عادت های زبانی در مواقع سختی میگویند ای خدا کمکم کن… یا در موقع بلند کردن چیز سنگین میگویند یا علی… یا موقع تصادف میگویند یا حضرت عباس و… بجای اینها میتوانید چیزی نگویید و آرامش خود و دیگران را به هم نزنید و به فکر چاره ای منطقی و عملی باشید. همچنین برای مبارزه با سختی ها بد نیست  به آدمهای سخت کوش و قوی فکر کنید،‌ با زندگی آدمهای بزرگ تاریخ آشنا شوید، به قهرمانان رشته های ورزشی نگاه کنید و به روحیه و عادتهای آنها. اما همچنان که گفته شد شما چه در مواقع سختی بگویید یا حضرت عباس یا یا حضرت پنلوپه کروز فرقی در عمل حاصل نمیشود.

نظام اخلاقی:

اسلام و دین نه تنها ضامن اخلاق در جامعه نیستند بلکه در جامعه امروز بزرگترین مانع در مقابل پیشرفت اخلاقی جامعه هستند. واقعیت این است که اخلاق نیز همچون دانش در حال تکامل است و ما امروز رفتارهایی را بر اساس دانش خود میفهمیم که دیروز نمیفهمیم و دین با تاکید بر اخلاقیات دیروز که در مورد اسلام اخلاقیات عرب بیابانهای عربستان ۱۴۰۰ سال پیش است در مقابل این تکامل قرار گرفته است.

افزون بر این در بعد فردی وقتی خدایی برای انسان وجود نداشته باشد برترین موجود برای آن انسان کیست؟‌ خود انسان است. انسان برای بیخدا از خدا برای خداباور بسیار شگفت انگیز تر،‌ بزرگتر، نیرومند تر، گرامی تر و با ارزشتر است. اگر یک انسان بیخدا دست به کار نیکی بزند تنها بخاطر نیکی آنکار بوده است، ارزش این خیلی بالاتر از خداباوریست که برای پاداش و یا تنبیه نشدن دست به کار نیکی میزند

هدفمندی زندگی:

برخی میپرسند اگر قرار است حیاتی پس از مرگ وجود نداشته باشد زندگی چه معنا و ارزشی خواهد داشت؟‌ باید گفت محدود بودن یک چیز معمولا باعث پر ارزش شدن آن چیز میشود نه کم ارزش شدن. زندگی نیز چنین است طول زندگی به اندازه عمر است اما وسعت زندگی به اندازه جهان و ذهن بشر. معنی زندگی هر کس به دست خود او شکل میگیرد، به تعبیری این دست ماست که در زندگی چه جانوری باشیم؟‌ برخی تصمیم میگیرند عقاب باشند، برخی لاشخور، برخی طاووس و این تنها شما هستید که با افکار و رفتارتان تصمیم میگیرید کدام باشید.

همه آدمها در طول حیاتشان بدنبال معنی هستند، بسیاری این معنی را در فرزند داشتن، تعالی در یک مهارت یا هنر، و خاطرات خوب، دوستان خوب، تفریح، و غیره پیدا میکنند. حتما در خیابان سگ یا گربه های لنگ و زخمی را دیده اید که در پست ترین شرایط همچنان مواظب جان خود هستند. شما نیز چه خدایی باشد چه نباشد در زندگی برای خود معنی دست و پا خواهید کرد. معنای زندگی در اسلام این است که شما برده خدا هستید و خدا با شما با سیستم چماغ و هویج برخورد میکند یعنی اگر کار خوب کنید در آن دنیا سکس و شراب و غذا خواهید داشت، اگر بد رفتار کنید چوب و سیخ داغ. به همین دلیل زندگی پس از اسلام بسیار با معنی تر است.

نظام سیاسی:

نظام سیاسی ای که اسلام از ابتدای پیدایش خود تابحال داشته است نوعی سلطنت مطلقه بوده است که اسامی مختلفی از قبیل خلافت، سلطنت و ولایت مطلقه فقیه را به خود گرفته است. نظامی که در آن مخالف حق حیات ندارد و سرکوب و اختناق و سانسور و اندیشه کشی و تروریسم از استراتژیهای اصلی به شمار میرفته و همچنان میرود! اسلامگرایان جدید سعی میکنند با پر رنگ کردن قضیه بیعت گرفتن با خلیفه، نظام سیاسی اسلام را مبتنی بر مردمسالاری جا بزنند، این ادعا بقدری مضحک و مسخره است که حتی ارزش بررسی را نیز ندارد، بجای نظام سیاسی اسلام میتوان مردمسالاری (دموکراسی چیست؟) را معرفی کرد.

واقعیت تلخ تاریخی دیگر این است که اسلام نظام فکری سیاسی ندارد، در طول تاریخ اسلام یک دور وجود دارد،‌ شخصی به ستیز با ظلم میپردازد سپس پیروز شده و خود ظالم میشود. این از آنجاست که ایده مسلمانان از یک حکومت خوب ایده ای بسیار کودکانه و ابلهانه است. این دور را میتوانید در زندگی خود محمد،‌ مختار، و خمینی ببینید.

نظام اقتصادی:

قوانینی که سیستم اقتصادی اسلام را تشکیل میدهند از قبیل زکات، خمس، جزیه، فطریه، حرمت ربا و… بقدری مسخره هستند که حتی خود مسلمانان امروز به این قضیه پی برده اند که این مسئله اقتصاد کشور را نابود خواهد کرد و کل نظام بانکداری را بطور جدی با اخلال مواجهه خواهد کرد. این است که خود با تعاریف جدید و کلاه شرعی گذاشتن این قوانین مسخره را به نوعی در کشورهای اسلامی حذف کرده اند. اسلام برنامه مشخصی بعنوان نظام اقتصادی ندارد، به نظر میرسد نظام اقتصادی اسلام، فئودالیسم و برده داری رسمی باشد که در کشورهای اسلامی به تازگی منع شده است. میتوان بجای نظام اقتصادی اسلام، نظام سوسیالیسم و یا کاپیتالیسم را معرفی کرد.

نظام قضایی و حقوقی:

قوانین اسلامی و حقوق اسلامی به غیر از موارد اندکی هیچ کدام چیزهای جدیدی نبوده اند. همگی قوانین اعراب بیابانگرد و اجداد محمد و یا قوانین قوم یهود هستند. قوانین و حقوق و مجازات های اسلامی ( مجموعه قوانين مجازات اسلامی گردآورنده: ناصر رسائی نيا) مثل سنگسار، دست و پا قطع کردن، قصاص، شلاق، صیغه، محلل، ازدواج با خردسالان (آزادی آزار جنسی به کودکان، بچه بازی (پدوفیلیا؛ Pedophilia) در دین مبین اسلام از کتاب تحریر الوسیله امام خمینی.) تنها در شان مردمی که این قوانین بینشان وجود داشت یعنی اعراب بیابانگرد، و بازماندگانشان یعنی حزب اللهی ها و اسلامگرایان است. نظام قضایی و حقوقی محدود به قوانین جهانشمول حقوق بشر (حقوق بشر چیست؟) و میثاقهای آن و قوانین تصویب شده در مجلس آزاد توسط نمایندگان واقعی مردم میتواند بهترین جایگزین برای قوانین کثیف الهی باشد.

نظام متافیزیکی:

به نظر میرسد با توجه به خرافات و اراجیف بیشمار راه یافته به مذاهب اسلامی و یا اصلی ترین اصل اسلام یعنی قرآن (تضادهای برونی تازینامه)، اسلام کاملا مکتبی ایده آلیسم (Idealism) باشد. میتوان مکتب ماده گرایی (Materialism) یا واقع گرایی (Realism) را جایگزینهایی برای مکتب ایدالیستی اسلام دانست.

نظام پزشکی:

نظام پزشکی اسلامی همان قضایای شفا یافتن بیماران توسط امامان شیعی (مراجعه کنید به معجزه و شفاء) و یا مطالب مضحک امام رضا در کتاب طب الرضا و مطالب حلیه المتقین (فرازهایی از حلیه المتقین در باب جماع و زفاف) و کشکول شیخ بهایی یا خود آزاری توسط روزه دانست. تغزیه مناسب و نظام پزشکی مبتنی بر دانسته های پزشکی و بیمارستانی را میتوان جایگزین مناسبی برای این خرافات دانست.

در ضمن خردگرایان تعصبی روی این قضیه که تمامی جنبه های اسلامی غلط هستند ندارند، خردگرا میتواند چیزهای خوب اسلام را بیاموزد و چیزهای بدش را دور بیاندازد. بعنوان مثال ممکن است نظام پزشکی اسلامی واقعا به درد مسئله توریسم بخورد، بنابر این میتوان جایگزین آنرا در کنار این نظام عرضه کرد، زیرا بعضی از این جایگزین ها با خود اسلام تناقض چندانی ندارند. بعنوان مثال آیت الله سیستانی بزرگترین مرجع شیعی وقتی بیمار شدند به جای رفتن به حرم امام رضا یا قبرستان بقیع، برای درمان به کشور انگلستان رفتند. البته منتقدان مختلف اسلام جایگزینهای مختلفی برای اسلام در نظر دارند، جایگزینهایی که در اینجا مطرح شد تنها جایگزینهای پیشنهادی غیر دینی و زمینی هستند.

چطور اسرائیل حقوق بشر را رعایت نمیکند و ما باید بکنیم؟

نویسنده – آرش بیخدا

پاسخ کوتاه:

این گفته مغلطه خودت هم همینطور است.

پاسخ بلند:

چطور پلیس های امریکایی سیاه پوستان را کتک میزنند؟ چرا اسرائیل میتواند بمب اتم داشته باشد و ما نمیتوانیم؟ ما زن ستیزیم یا غربی ها که زن را کاملا به عنوان یک ابزار در آورده اند؟

این سفسطه کاملا کودکانه و این قیاس غیر عقلی و ابتدائی همواره روی زبان انواع و اقسام مسلمانان است. حتی در روزنامه ها و تریبون هایشان این سفسطه را رسما و مدام اعلام میکنند. اسلامگرایان به مجرد اینکه محکوم به توحش و عقب ماندگی و جنایت پیشگی میشوند، سعی میکنند اتهام خود را با بر شمردن جنایاتی دیگر، چه خیالی و چه حقیقی توجیه کنند. اسرائیل معمولاً اولین نظامی است که اسلامگرایان برای فرار کردن از پاسخ گویی به جنایاتشان به نام آن دست آویز میشوند. اسلامگرایان معمولا همیشه اسرائیل را محکوم به جنایت میکنند، اما پاسخ آنها بسیار ساده است زیرا:

اگر رعایت نکردن حقوق بشر اشتباهی است که از سوی اسرائیل انجام میگیرد؛ شما خطا میکنید اشتباه اسرائیل را تکرار میکنید.

اگر رعایت نکردن حقوق بشر در اسرائیل کار درستی است؛ شما خطا میکنید از اسرائیل ایراد میگیرید.

این سفسطه مانند این است که شما در جامعه ای قرار بگیرید که در آن اکثر انسانها آدم میکشند، و شما نیز یک آدم بکشید و بگویید چون بقیه هم میکشند، من هم میکشم! آیا این میتواند عمل شما را توجیه کند؟! هرکس مسئول اعمال خودش است، شما هرگز حق ندارید به دلیل اینکه دیگران جرمی را مرتکب میشوند مرتکب جرمی شوید. دو کار بد یک کار خوب نتیجه نمیدهند!

این نوع تفکر در بسیاری از استدلالهای اسلامگرایان دیده میشود مثلا در مورد همبستر شدن رسول الله با عایشه دختر 9 ساله ابوبکر، مسلمانان معمولا سفسطه میکنند که این در آن دوران رسم بوده و همه این کار را میکرده اند!

آیا اینکه در زمان محمد اعراب بدوی با دختران 9 ساله همبستر میشدند و این یک رسم و فرهنگ (ضد فرهنگ) بود، میتواند تکرار این کار زشت را توسط پیامبر اسلام توجیه کند؟! خیر! محمد هم با تکرار کردن این کار اعراب، توحش آنها را تکرار کرده است و خود به زمره اعراب وحشی پیوسته است. و حتی این جرم محمد سنگین تر از جرم سایر اعراب است، زیرا  تکرار این عمل توسط محمد برای مسلمانان جواز برای تکرار آن حساب میشود. بطوری که حضرت امام در رساله خویش میفرمایند:

مسئله ۲۴۱۰ «اگر كسى دختر نابالغى را براى خود عقد كند و پيش از آنكه نه سال دختر تمام شود، با او نزديكى و دخول كند، چنانچه او را افضا نمايد هيچ وقت نبايد با او نزديكى كند» و از نظر آقایان  «آميزش جنسى باهمسرى كه هنوز نه سالش تمام نشده، جايزنيست خواه آزاد باشد يا كنيز، همسر دائم باشد يا موقت، اماكامجوييهاى ديگر جز دخول، اعم از نظر يا نوازش با شهوت ياملاعبه ونظاير آن جايز است»

یعنی دین مبین اسلام که دین آزادی است مرد ۵۴ ساله را آزاد میگذارد که با دختر از ۱ سالگی ازدواج کند ولی خوب حق دخول را ندارد و فقط وقتی میتواند دخول کند که دختر بالغ شود و ۹ ساله شود و اینگونه مسائل به نظر مسلمانان فوق العاده انسانی و آزاد است! ولی البته دین مبین اسلام به مرد اجازه میدهد که سایر لذت هارا از همسری که کمتر از ۹ سال نیز سن دارد ببرد مثلا نوازش های شهوت آمیز و یا نعوذ بالله سایر موارد غیر اخلاقی دیگر؛  بنابر این  اسلام ‌اجازه میدهد مردان با یک دختر در هر سنی ازدواج کنند اما فقط وقتی میتوانند با او آمیزش جنسی داشته باشند که دختر به سن ۹ سالگی میرسد. جالب است بدانید پیامبر اسلام اگر فقط و فقط بخواهد ۱ روز در روزگار ما زندگی بکند و یکی از کارهایی که در دوران زندگی خویش انجام داده است را دوباره انجام بدهد بدون شک بعنوان یک بیمار روانی حتی توسط خود اسلامگرایان که در تمدن و فرهنگ بسیار عقب مانده هستند دستگیر خواهند شد و به گوشه زندان پرتاب خواهند شد.

علمای اسلام پارا فراتر میگذارند و برای اینکه به غرب وحشی اثبات کنند اسلام حامی حقوق زنان است حتی بحث شیرین افضاء را مطرح میکنند،‌ حضرت امام، اولین نایب امام زمان و رئیس دفتر نمایندگی پروردگار بر روی زمین بعد از قرنها در کتاب تحریر الوسیله خود میفرمایند «مساءله 12 – كسيكه زوجه اى كمتر از نه سال دارد وطى او براى وى جايز نيست چه اينكه زوجه دائمى باشد، و چه منقطع ، و اما ساير كام گيريها از قبيل لمس بشهوت و آغوش گرفتن و تفخيذ( اشكال ندارد هر چند شيرخواره باشد، و اگر قبل از نه سال او را وطى كند اگر افضاء نكرده باشد بغير از گناه چيزى بر او نيست ، و اگر كرده باشد يعنى مجراى بول و مجراى حيض او را يكى كرده باشد و يا مجراى حيض و غائط او را يكى كرده باشد تا ابد وطى او بر وى حرام مى شود، لكن در صورت دوم حكم بنابر احتياط است و در هر حال بنا بر اقوى بخاطر افضاء از همسرى او بيرون نمى شود در نتيجه همه احكام زوجيت بر او مترتب مى شود يعنى او از شوهرش و شوهرش از او ارث مى برد…..» لازم به ذکر است کلمه تخفیذ در شرع مقدس اسلام دین آزادی یعنی «با ران شهوترانی کردن» بنابر این نه تنها ازدواج اشکالی ندارد بلکه همخوابی کردن هم به شرطهایی مجاز است. در واقع مسلمان بودن یعنی توحش اعراب را به امروز آوردن! در مورد ازدواج بسیار بحث برانگیز محمد با عایشه به نوشتاری با فرنام «سن پایین عایشه، بخش نخست مناظره ای بین آیت الله منتظری و دکتر علی سینا» مراجعه کنید.

اسلامگرایان هراسان از غرب و آمریکا همواره شمشیر دشمنی را در مقابل هر آنچه محصولات فکری و فرهنگی غربیست میکشند و همواره میگویند ملاک ما غرب نیست، چگونه است که در این نوع سفسطه ها که میکنند غرب را ملاک میگیرند؟ چگونه است که امریکا را شیطان بزرگ خطاب میکنند اما کیفیت رفتار خویش را با امریکا میسنجند؟

مسئله اینجاست که ما در کشورهای پیشرفته دنیا معمولا به دلیل آزادی بیان و مطبوعات جنایت سازمانیافته علیه مردم خود آن کشور نمیبینیم، بیشتر خطاها یا جرایم شخصی بوده اند، یا علیه مردم دیگر کشورها مثلا در مورد جرایم جنگی. یا اگر چنین اتفاقاتی بیافتند بدون تعارف و با شفافیت سرانجام مورد نکوهش و اصلاح قرار میگیرند.

اما درنقطه مقابل یعنی در جهان اسلام اگر جنایتی انجام میشود، این جنایت از طرف دولت حمایت میشود و کاملا قانونی است، مثلا شکنجه کردن در نظام مقدس ناجمهوری اسلامی کاملا قانونی است و کسی نمیتواند به آن اعتراض کند. چون اعتراض به حکومت دینی و رفتار دینی اعتراض به دین است. اگر کار خلاف قانونی هم حتی انجام شود کسی جرأت اعتراض به آن ندارد چون دولت حامی آن است. تفاوت میان جنایات در ایران  و در غرب این است. به عبارت دیگر جنایات اسلامگرایان تماماً جنایات قانونی هستند و بر اساس مرام و منطق اسلامی نه تنها جرم نیستند بلکه کارهایی خداپرستانه هستند و اسلامگرایان انتظار دریافت پاداش در قبال آنها را دارند.

از اینها گذشته، اگر پشت جنایتی اندیشه و ایدئولوژی و یا سازمانی باشد این جنایت متوجه کل آن اندیشه و ایدئولوژی و سازمان میشود و آن ایدئولوژی بطور کلی ممنوع و آن حزب منحل اعلام میشود. مثلا فاشیست ها اجازه حیات در خیلی از کشور ها ندارند. این بلاییست که باید بر سر اسلامگرایان (منظور مسلمانان نیست، اسلامگرا تعریف مشخصی دارد) نیز بیاید. چون این اندیشه کاملا بر ضد قوانین حقوق بشر (حقوق بشر چیست؟) و دموکراتیک (دموکراسی چیست؟) است. نتیجه آنکه در اکثر موارد جنایات در غرب خطاهای فردی یا گروهی است اما جنایات اسلامگرایان سازمانیافته و بر اساس مرام و آموزه های دینی آنان است.

جدا از این، مغله حمله به آدم پوشالین را میتوان در چنین سخنانی دید. زیرا ما از اسلامگرایان میپرسیم چرا وحشیانه و ابلهانه فکر و رفتار میکنید و آنها میگویند غرب هم اینچنین است، انگار دارند با دیپلماتهای غربی سخن میگویند نه با مالکان واقعی کشور ایران یعنی مردم ایران. دیکتاتورها در ایران و در سایر کشورهای دیکتاتوری مثل کره شمالی معمولا با بزرگنمایی خود و دشمنی دشمنان خود از پاسخگویی و رفتار مسئولانه طفره میروند. ما از آنها میپرسیم به چه حقی اسلام کثیفتان را به مردم تحمیل میکنید و آنها میگویند در بورکینا فاسو هم جنایاتی شده.

توسط  آرش بيخدا

چگونه از شر جمهوری اسلامی راحت شویم؟

نویسنده – آرش بیخدا

زندیق البته یک سایت سیاسی نیست، بدین معنی که ما بدنبال وقایع سیاسی روز نیستیم و هدف ما یاری به تحول فکری و فرهنگی اجتماع است. اما به هر روی از ما بارها این پرسش شده است که چگونه باید با جمهوری اسلامی مبارزه کرد؟ پاسخی که من به این افراد میتوانم بدهم بسیار ساده است، حزب گرایی کنید.

باید توجه داشته باشیم که یک دست صدا ندارد، اکثر ما ایرانیان بدون شک خواهان بر اندازی و نابودی این حکومت ننگین و اسلامگرا هستیم اما شیطنتها و کارشکنی هایی که خود رژیم طراحی میکند باعث تفرقه در میان ایرانیان گشته و آنها را از هدف اصلی منحرف کرده است. برای انجام یک عمل بزرگ مثل بر اندازی یک حکومت کاری نیست که از دست یک شخص در بیاید و فعالیت انفرادی در این زمینه نتیجه چندانی به بار نخواهد آوررد.

کاری که هر کدام از ما باید انجام دهیم این است که ابتدا تکلیف خودمان را با خودمان مشخص کنیم، ما براستی چه جور انسانی هستیم؟ طرفدار چه نوع اندیشه و مخالف چه نوع اندیشه ای هستیم؟ هر کدام از ما هر عقیده ای را داشته باشیم، افرادی هستند که همفکر ما هستند. شما باید این افراد را پیدا کنید و به آنها بپیوندید و آنها را پشتیبانی معنوی، مادی و عملی کنید. لازم نیست که شما برای این احزاب 24 ساعت کار کنید، وابستگی به این احزاب شاید کمتر از روزی 10 دقیقه از وقت شما را به خود مشغول کند، اما همین 10 دقیقه میتواند پیشرفتی شگرف ایجاد کند. قوت گرفتن احزاب و گروه های سیاسی و این کثرت گرایی خود به خودی خود موجب پدید آمدن فضای دموکراتیک در جامعه میشود. فعال سیاسی مستقل فعال سیاسی خوبی نیست. شخصی که مستقل فکر میکند و وابستگی سیاسی ندا